Multiple sequence alignment - TraesCS1B01G067900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G067900 chr1B 100.000 2513 0 0 1 2513 52416615 52414103 0 4641
1 TraesCS1B01G067900 chr7D 96.746 2520 69 8 1 2511 421675281 421677796 0 4187
2 TraesCS1B01G067900 chr6D 96.743 2518 71 8 1 2513 459129169 459131680 0 4185
3 TraesCS1B01G067900 chr6D 96.585 2518 73 10 1 2511 451600150 451597639 0 4161
4 TraesCS1B01G067900 chr1D 96.475 2525 70 11 1 2511 361004138 361006657 0 4152
5 TraesCS1B01G067900 chr1D 96.544 2517 70 13 1 2508 43033315 43035823 0 4150
6 TraesCS1B01G067900 chr1D 96.463 2516 79 9 1 2511 10688673 10691183 0 4145
7 TraesCS1B01G067900 chr5D 96.431 2522 74 11 1 2511 426130343 426132859 0 4145
8 TraesCS1B01G067900 chr2D 96.426 2518 78 10 1 2511 403583162 403580650 0 4141
9 TraesCS1B01G067900 chr3D 96.387 2519 78 12 1 2511 533780632 533783145 0 4135


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G067900 chr1B 52414103 52416615 2512 True 4641 4641 100.000 1 2513 1 chr1B.!!$R1 2512
1 TraesCS1B01G067900 chr7D 421675281 421677796 2515 False 4187 4187 96.746 1 2511 1 chr7D.!!$F1 2510
2 TraesCS1B01G067900 chr6D 459129169 459131680 2511 False 4185 4185 96.743 1 2513 1 chr6D.!!$F1 2512
3 TraesCS1B01G067900 chr6D 451597639 451600150 2511 True 4161 4161 96.585 1 2511 1 chr6D.!!$R1 2510
4 TraesCS1B01G067900 chr1D 361004138 361006657 2519 False 4152 4152 96.475 1 2511 1 chr1D.!!$F3 2510
5 TraesCS1B01G067900 chr1D 43033315 43035823 2508 False 4150 4150 96.544 1 2508 1 chr1D.!!$F2 2507
6 TraesCS1B01G067900 chr1D 10688673 10691183 2510 False 4145 4145 96.463 1 2511 1 chr1D.!!$F1 2510
7 TraesCS1B01G067900 chr5D 426130343 426132859 2516 False 4145 4145 96.431 1 2511 1 chr5D.!!$F1 2510
8 TraesCS1B01G067900 chr2D 403580650 403583162 2512 True 4141 4141 96.426 1 2511 1 chr2D.!!$R1 2510
9 TraesCS1B01G067900 chr3D 533780632 533783145 2513 False 4135 4135 96.387 1 2511 1 chr3D.!!$F1 2510

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
607 631 1.071699 GGATCCTACCAAGCGCCATAA 59.928 52.381 2.29 0.0 0.0 1.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1796 1823 1.13461 ACTCGAGGACAAAACGTTGGT 60.135 47.619 18.41 3.12 39.22 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
209 220 6.653020 TGAACATGTTCATAGGTGATAGCTT 58.347 36.000 32.36 0.0 43.90 3.74
258 269 9.747898 TGAAAATGACCTACACCAAGTTTATAT 57.252 29.630 0.00 0.0 0.00 0.86
451 475 4.379813 GGTCTCATAAACGGACGAACTACA 60.380 45.833 0.00 0.0 0.00 2.74
573 597 1.295423 GCTCCAAACCCTAGCGTCA 59.705 57.895 0.00 0.0 0.00 4.35
605 629 1.344953 TGGATCCTACCAAGCGCCAT 61.345 55.000 14.23 0.0 36.96 4.40
607 631 1.071699 GGATCCTACCAAGCGCCATAA 59.928 52.381 2.29 0.0 0.00 1.90
683 707 1.273606 GCTACTGCACTGTCCTTCTCA 59.726 52.381 0.00 0.0 39.41 3.27
698 722 6.209986 TGTCCTTCTCAGGTTTTTACGATCTA 59.790 38.462 0.00 0.0 41.69 1.98
700 724 6.209986 TCCTTCTCAGGTTTTTACGATCTACA 59.790 38.462 0.00 0.0 41.69 2.74
875 899 5.950758 GAGCAGATCGAGTAATTCCTCTA 57.049 43.478 0.00 0.0 0.00 2.43
938 963 1.896465 CCTCTGTTTCTTCCTCTCGGT 59.104 52.381 0.00 0.0 0.00 4.69
940 965 2.558795 CTCTGTTTCTTCCTCTCGGTCA 59.441 50.000 0.00 0.0 0.00 4.02
946 971 5.186992 TGTTTCTTCCTCTCGGTCAATATGA 59.813 40.000 0.00 0.0 0.00 2.15
1098 1123 1.491563 GCGCGAGTTCGTCAAATGT 59.508 52.632 12.10 0.0 42.22 2.71
1151 1176 5.253330 TGAGTTTTCCTCGCATCCTTTATT 58.747 37.500 0.00 0.0 43.64 1.40
1157 1182 7.931578 TTTCCTCGCATCCTTTATTTCTAAA 57.068 32.000 0.00 0.0 0.00 1.85
1272 1297 3.181423 ACATCCAAAGGCTTCAAGGGTTA 60.181 43.478 0.00 0.0 0.00 2.85
1281 1306 2.618045 GCTTCAAGGGTTAGGCTTGCTA 60.618 50.000 0.00 0.0 0.00 3.49
1321 1346 1.741401 CGCGAGTTCAATCTGCCCA 60.741 57.895 0.00 0.0 0.00 5.36
1384 1409 2.865343 GACGGTGGTAGATGTCGAAT 57.135 50.000 0.00 0.0 0.00 3.34
1566 1592 7.615582 TTAGCAATCCAAGTCTGTTTATCTG 57.384 36.000 0.00 0.0 0.00 2.90
1728 1755 1.982660 TCATACCCTAGCTCGTCAGG 58.017 55.000 0.00 0.0 0.00 3.86
1796 1823 4.518249 TCATCTCTTCTCTCTCGCACTTA 58.482 43.478 0.00 0.0 0.00 2.24
1801 1828 3.057456 TCTTCTCTCTCGCACTTACCAAC 60.057 47.826 0.00 0.0 0.00 3.77
1802 1829 1.199327 TCTCTCTCGCACTTACCAACG 59.801 52.381 0.00 0.0 0.00 4.10
1888 1918 2.324541 AGTTGCAATAGGCCCACAAAA 58.675 42.857 0.59 0.0 43.89 2.44
2409 2444 3.756933 TTAGCCGTGTCTAAACTTGGT 57.243 42.857 0.00 0.0 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
426 450 2.921754 GTTCGTCCGTTTATGAGACCTG 59.078 50.000 0.00 0.00 0.00 4.00
605 629 1.002659 CCACATCTGACGGGTGGTTTA 59.997 52.381 13.80 0.00 45.48 2.01
607 631 1.374947 CCACATCTGACGGGTGGTT 59.625 57.895 13.80 0.00 45.48 3.67
683 707 5.479124 AGTGGTGTAGATCGTAAAAACCT 57.521 39.130 0.00 0.00 0.00 3.50
865 889 8.350180 AGATGGGGAAAGAAATAGAGGAATTA 57.650 34.615 0.00 0.00 0.00 1.40
875 899 4.576330 ACGAGAAGATGGGGAAAGAAAT 57.424 40.909 0.00 0.00 0.00 2.17
1098 1123 3.393970 CCCTCCGGCTTGCTCTCA 61.394 66.667 0.00 0.00 0.00 3.27
1218 1243 2.029110 CCACTCGAAATGGTGGCATTTT 60.029 45.455 8.46 0.00 44.94 1.82
1272 1297 0.755686 CCCTCGAATCTAGCAAGCCT 59.244 55.000 0.00 0.00 0.00 4.58
1281 1306 0.918983 TTGCATTCCCCCTCGAATCT 59.081 50.000 0.00 0.00 29.85 2.40
1321 1346 2.434884 CGGAGCGGCACTGTCATT 60.435 61.111 1.45 0.00 0.00 2.57
1384 1409 6.230472 TCATCTTCTTCAATTCCGTCTTCAA 58.770 36.000 0.00 0.00 0.00 2.69
1566 1592 4.858935 TGCACTAAACAGAGTTGCATTTC 58.141 39.130 0.00 0.00 32.33 2.17
1728 1755 3.675698 GCTCAAGTACTGCTTACTGTCAC 59.324 47.826 0.00 0.00 40.44 3.67
1796 1823 1.134610 ACTCGAGGACAAAACGTTGGT 60.135 47.619 18.41 3.12 39.22 3.67
1801 1828 1.450905 GACGAACTCGAGGACAAAACG 59.549 52.381 18.41 12.67 43.02 3.60
1802 1829 2.466846 TGACGAACTCGAGGACAAAAC 58.533 47.619 18.41 2.67 43.02 2.43
1850 1880 1.428912 ACTTGATTCTCTTTGGGCCCA 59.571 47.619 24.45 24.45 0.00 5.36
1888 1918 4.591321 TGTTTCTGGGCCTCATTTATCT 57.409 40.909 4.53 0.00 0.00 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.