Multiple sequence alignment - TraesCS1B01G064100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G064100 chr1B 100.000 2351 0 0 1 2351 48624522 48626872 0.000000e+00 4342.0
1 TraesCS1B01G064100 chr1B 99.018 2342 15 3 1 2335 48587515 48589855 0.000000e+00 4191.0
2 TraesCS1B01G064100 chr1B 97.540 1626 35 4 1 1623 48655803 48657426 0.000000e+00 2776.0
3 TraesCS1B01G064100 chr1B 97.478 1626 36 4 1 1623 48707181 48708804 0.000000e+00 2771.0
4 TraesCS1B01G064100 chr1B 97.475 1624 38 3 1 1623 48660215 48661836 0.000000e+00 2769.0
5 TraesCS1B01G064100 chr1B 97.420 1628 35 5 1 1623 48674584 48676209 0.000000e+00 2767.0
6 TraesCS1B01G064100 chr1B 87.288 1180 72 30 472 1632 48734837 48735957 0.000000e+00 1277.0
7 TraesCS1B01G064100 chr1B 98.431 701 10 1 1 701 48679008 48679707 0.000000e+00 1232.0
8 TraesCS1B01G064100 chr1B 90.518 791 54 7 861 1632 48563782 48564570 0.000000e+00 1026.0
9 TraesCS1B01G064100 chr1B 94.255 557 30 1 1767 2321 48716599 48717155 0.000000e+00 850.0
10 TraesCS1B01G064100 chr1B 88.089 722 74 10 1639 2351 48708868 48709586 0.000000e+00 846.0
11 TraesCS1B01G064100 chr1B 88.147 599 59 10 1639 2228 48657490 48658085 0.000000e+00 702.0
12 TraesCS1B01G064100 chr1B 88.147 599 59 9 1639 2228 48676273 48676868 0.000000e+00 702.0
13 TraesCS1B01G064100 chr1B 87.980 599 60 9 1639 2228 48661900 48662495 0.000000e+00 697.0
14 TraesCS1B01G064100 chr1B 89.362 564 42 4 1189 1735 48715745 48716307 0.000000e+00 693.0
15 TraesCS1B01G064100 chr1B 87.977 524 54 7 1807 2321 48679710 48680233 5.550000e-171 610.0
16 TraesCS1B01G064100 chr1B 86.391 507 59 6 1639 2136 48564623 48565128 1.590000e-151 545.0
17 TraesCS1B01G064100 chrUn 98.800 1250 11 3 1 1247 383151398 383150150 0.000000e+00 2222.0
18 TraesCS1B01G064100 chrUn 96.648 1074 30 4 554 1623 393542780 393541709 0.000000e+00 1779.0
19 TraesCS1B01G064100 chrUn 99.830 587 1 0 1749 2335 387643264 387642678 0.000000e+00 1079.0
20 TraesCS1B01G064100 chrUn 86.737 377 40 7 1639 2008 393541645 393541272 6.050000e-111 411.0
21 TraesCS1B01G064100 chrUn 100.000 34 0 0 432 465 27012108 27012075 1.950000e-06 63.9
22 TraesCS1B01G064100 chr1A 87.573 853 75 6 786 1627 30268415 30269247 0.000000e+00 959.0
23 TraesCS1B01G064100 chr1A 85.384 691 86 12 1639 2317 30265818 30266505 0.000000e+00 702.0
24 TraesCS1B01G064100 chr1A 86.865 571 63 10 1758 2317 30269848 30270417 1.530000e-176 628.0
25 TraesCS1B01G064100 chr1A 96.667 270 8 1 1 269 30252547 30252816 4.610000e-122 448.0
26 TraesCS1B01G064100 chr1A 87.539 321 24 8 469 781 30268127 30268439 7.990000e-95 357.0
27 TraesCS1B01G064100 chr1A 95.210 167 8 0 264 430 30252980 30253146 4.980000e-67 265.0
28 TraesCS1B01G064100 chr1D 87.302 693 70 13 1639 2317 30125302 30125990 0.000000e+00 776.0
29 TraesCS1B01G064100 chr1D 95.539 269 12 0 1 269 30123345 30123613 4.640000e-117 431.0
30 TraesCS1B01G064100 chr1D 85.099 302 28 6 469 756 30124098 30124396 2.290000e-75 292.0
31 TraesCS1B01G064100 chr1D 96.407 167 6 0 264 430 30123777 30123943 2.300000e-70 276.0
32 TraesCS1B01G064100 chr1D 92.174 115 8 1 1639 1753 445611433 445611546 6.720000e-36 161.0
33 TraesCS1B01G064100 chr2B 100.000 32 0 0 434 465 76027011 76026980 2.520000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G064100 chr1B 48624522 48626872 2350 False 4342.00 4342 100.00000 1 2351 1 chr1B.!!$F2 2350
1 TraesCS1B01G064100 chr1B 48587515 48589855 2340 False 4191.00 4191 99.01800 1 2335 1 chr1B.!!$F1 2334
2 TraesCS1B01G064100 chr1B 48707181 48709586 2405 False 1808.50 2771 92.78350 1 2351 2 chr1B.!!$F7 2350
3 TraesCS1B01G064100 chr1B 48655803 48662495 6692 False 1736.00 2776 92.78550 1 2228 4 chr1B.!!$F5 2227
4 TraesCS1B01G064100 chr1B 48674584 48680233 5649 False 1327.75 2767 92.99375 1 2321 4 chr1B.!!$F6 2320
5 TraesCS1B01G064100 chr1B 48734837 48735957 1120 False 1277.00 1277 87.28800 472 1632 1 chr1B.!!$F3 1160
6 TraesCS1B01G064100 chr1B 48563782 48565128 1346 False 785.50 1026 88.45450 861 2136 2 chr1B.!!$F4 1275
7 TraesCS1B01G064100 chr1B 48715745 48717155 1410 False 771.50 850 91.80850 1189 2321 2 chr1B.!!$F8 1132
8 TraesCS1B01G064100 chrUn 383150150 383151398 1248 True 2222.00 2222 98.80000 1 1247 1 chrUn.!!$R2 1246
9 TraesCS1B01G064100 chrUn 393541272 393542780 1508 True 1095.00 1779 91.69250 554 2008 2 chrUn.!!$R4 1454
10 TraesCS1B01G064100 chrUn 387642678 387643264 586 True 1079.00 1079 99.83000 1749 2335 1 chrUn.!!$R3 586
11 TraesCS1B01G064100 chr1A 30265818 30270417 4599 False 661.50 959 86.84025 469 2317 4 chr1A.!!$F2 1848
12 TraesCS1B01G064100 chr1A 30252547 30253146 599 False 356.50 448 95.93850 1 430 2 chr1A.!!$F1 429
13 TraesCS1B01G064100 chr1D 30123345 30125990 2645 False 443.75 776 91.08675 1 2317 4 chr1D.!!$F2 2316

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
726 2582 1.317431 TGCGTACGTACAGGCCAGAT 61.317 55.0 24.5 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1700 3675 3.941483 CAGGGGTGTGTATGTCAATTCTC 59.059 47.826 0.0 0.0 0.0 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
438 609 1.949525 AGTGACAACATCAGCGCTTTT 59.050 42.857 7.50 0.0 38.28 2.27
726 2582 1.317431 TGCGTACGTACAGGCCAGAT 61.317 55.000 24.50 0.0 0.00 2.90
1179 3065 3.845259 GCCGCATCCGACAGGGTA 61.845 66.667 0.00 0.0 38.33 3.69
1265 3151 3.005554 CGTCCTTGTCTTGCATCTCATT 58.994 45.455 0.00 0.0 0.00 2.57
1502 3422 6.173339 TCTGACACTTTCCATTTACTGATCC 58.827 40.000 0.00 0.0 0.00 3.36
1525 3445 1.643868 CGGCGCATGCTAGAAACCAA 61.644 55.000 17.13 0.0 42.25 3.67
1526 3446 0.740737 GGCGCATGCTAGAAACCAAT 59.259 50.000 17.13 0.0 42.25 3.16
2335 9169 1.265635 GTGTGTGTGTGTGTGTGTGTT 59.734 47.619 0.00 0.0 0.00 3.32
2337 9171 2.739379 TGTGTGTGTGTGTGTGTGTTAG 59.261 45.455 0.00 0.0 0.00 2.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 4.202233 GGGTAATAGTTAGAGACTGCACCC 60.202 50.000 8.15 8.15 42.59 4.61
805 2661 3.808174 GGACTCGGCTCGCTATTTTTAAT 59.192 43.478 0.00 0.00 0.00 1.40
1179 3065 3.863041 GAAACCTTCGACAGCCTTATCT 58.137 45.455 0.00 0.00 0.00 1.98
1247 3133 3.314635 GGCTAATGAGATGCAAGACAAGG 59.685 47.826 0.00 0.00 0.00 3.61
1265 3151 1.822990 AGTTTGCTAGTGCGTAGGCTA 59.177 47.619 9.11 0.00 43.34 3.93
1700 3675 3.941483 CAGGGGTGTGTATGTCAATTCTC 59.059 47.826 0.00 0.00 0.00 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.