Multiple sequence alignment - TraesCS1B01G055500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G055500 chr1B 100.000 2264 0 0 1 2264 38183391 38185654 0.000000e+00 4181
1 TraesCS1B01G055500 chr7B 97.145 2277 51 2 1 2264 687040622 687042897 0.000000e+00 3832
2 TraesCS1B01G055500 chr7B 92.301 2286 116 27 1 2264 235458094 235455847 0.000000e+00 3192
3 TraesCS1B01G055500 chr7B 97.231 1661 32 2 617 2264 713543514 713541855 0.000000e+00 2800
4 TraesCS1B01G055500 chr7B 96.707 1670 35 5 608 2264 95041366 95039704 0.000000e+00 2761
5 TraesCS1B01G055500 chr7B 91.429 245 8 1 2033 2264 95040066 95039822 7.800000e-85 324
6 TraesCS1B01G055500 chr7B 91.429 245 8 1 2033 2264 713542217 713541973 7.800000e-85 324
7 TraesCS1B01G055500 chr7B 90.204 245 11 1 2033 2264 687042535 687042779 7.860000e-80 307
8 TraesCS1B01G055500 chr4B 96.440 2107 47 5 1 2083 402787203 402785101 0.000000e+00 3450
9 TraesCS1B01G055500 chr4B 95.028 181 9 0 2084 2264 402771973 402771793 3.680000e-73 285
10 TraesCS1B01G055500 chr4B 94.505 182 9 1 2084 2264 74253925 74254106 1.710000e-71 279
11 TraesCS1B01G055500 chr5B 96.900 1968 36 4 1 1944 464634106 464636072 0.000000e+00 3273
12 TraesCS1B01G055500 chr5B 94.157 1968 81 24 1 1948 530940831 530938878 0.000000e+00 2966
13 TraesCS1B01G055500 chr2B 96.692 1965 41 5 1 1944 563917140 563915179 0.000000e+00 3247
14 TraesCS1B01G055500 chr2B 94.447 2089 94 14 1 2082 42193403 42195476 0.000000e+00 3195
15 TraesCS1B01G055500 chr2B 90.099 303 14 6 1881 2167 29752638 29752336 1.640000e-101 379
16 TraesCS1B01G055500 chr2B 92.857 266 6 1 1915 2167 563915127 563914862 7.640000e-100 374
17 TraesCS1B01G055500 chr2B 81.781 247 10 16 1733 1947 154583843 154583600 8.310000e-40 174
18 TraesCS1B01G055500 chr2B 87.162 148 8 7 1733 1872 364336393 364336249 8.370000e-35 158
19 TraesCS1B01G055500 chr3B 96.392 1968 45 5 1 1944 16124436 16122471 0.000000e+00 3217
20 TraesCS1B01G055500 chr3B 93.570 1322 48 7 659 1944 112910432 112911752 0.000000e+00 1936
21 TraesCS1B01G055500 chr3B 89.486 1322 94 27 551 1860 16202941 16201653 0.000000e+00 1629
22 TraesCS1B01G055500 chr3B 89.058 329 22 2 1949 2264 16122502 16122175 1.630000e-106 396
23 TraesCS1B01G055500 chr3B 92.481 266 7 1 1915 2167 16122419 16122154 3.550000e-98 368
24 TraesCS1B01G055500 chr3B 88.806 268 14 5 1915 2167 28618954 28619220 4.690000e-82 315
25 TraesCS1B01G055500 chr4A 96.176 1883 55 11 1 1872 712877478 712879354 0.000000e+00 3062
26 TraesCS1B01G055500 chr6B 94.651 1533 47 8 551 2050 687513888 687512358 0.000000e+00 2344
27 TraesCS1B01G055500 chr2A 81.159 483 40 20 1733 2167 148613586 148613107 7.740000e-90 340
28 TraesCS1B01G055500 chrUn 82.902 386 28 15 1733 2083 437460742 437461124 1.690000e-81 313


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G055500 chr1B 38183391 38185654 2263 False 4181.0 4181 100.000000 1 2264 1 chr1B.!!$F1 2263
1 TraesCS1B01G055500 chr7B 235455847 235458094 2247 True 3192.0 3192 92.301000 1 2264 1 chr7B.!!$R1 2263
2 TraesCS1B01G055500 chr7B 687040622 687042897 2275 False 2069.5 3832 93.674500 1 2264 2 chr7B.!!$F1 2263
3 TraesCS1B01G055500 chr7B 713541855 713543514 1659 True 1562.0 2800 94.330000 617 2264 2 chr7B.!!$R3 1647
4 TraesCS1B01G055500 chr7B 95039704 95041366 1662 True 1542.5 2761 94.068000 608 2264 2 chr7B.!!$R2 1656
5 TraesCS1B01G055500 chr4B 402785101 402787203 2102 True 3450.0 3450 96.440000 1 2083 1 chr4B.!!$R2 2082
6 TraesCS1B01G055500 chr5B 464634106 464636072 1966 False 3273.0 3273 96.900000 1 1944 1 chr5B.!!$F1 1943
7 TraesCS1B01G055500 chr5B 530938878 530940831 1953 True 2966.0 2966 94.157000 1 1948 1 chr5B.!!$R1 1947
8 TraesCS1B01G055500 chr2B 42193403 42195476 2073 False 3195.0 3195 94.447000 1 2082 1 chr2B.!!$F1 2081
9 TraesCS1B01G055500 chr2B 563914862 563917140 2278 True 1810.5 3247 94.774500 1 2167 2 chr2B.!!$R4 2166
10 TraesCS1B01G055500 chr3B 112910432 112911752 1320 False 1936.0 1936 93.570000 659 1944 1 chr3B.!!$F2 1285
11 TraesCS1B01G055500 chr3B 16201653 16202941 1288 True 1629.0 1629 89.486000 551 1860 1 chr3B.!!$R1 1309
12 TraesCS1B01G055500 chr3B 16122154 16124436 2282 True 1327.0 3217 92.643667 1 2264 3 chr3B.!!$R2 2263
13 TraesCS1B01G055500 chr4A 712877478 712879354 1876 False 3062.0 3062 96.176000 1 1872 1 chr4A.!!$F1 1871
14 TraesCS1B01G055500 chr6B 687512358 687513888 1530 True 2344.0 2344 94.651000 551 2050 1 chr6B.!!$R1 1499

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
833 906 0.89694 GGTGGTGGTGGTCGTAGAGA 60.897 60.0 0.0 0.0 36.95 3.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2140 2415 3.691342 CGGACCTTGGCGTCTGGA 61.691 66.667 6.64 0.0 35.79 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
379 380 3.119990 ACAATTTGGTAGCGGTCATTTCG 60.120 43.478 0.78 0.0 0.00 3.46
487 488 1.673920 GAAAAACAAGTCGTGGAGGCA 59.326 47.619 0.00 0.0 0.00 4.75
547 548 1.000506 GTGGTCGAGGAAGCACAAGTA 59.999 52.381 1.66 0.0 44.90 2.24
620 621 4.147321 AGTGTTCGTAGAGGGAGTACAAA 58.853 43.478 0.00 0.0 38.43 2.83
631 692 4.880164 AGGGAGTACAAATGCTAGAGGTA 58.120 43.478 0.00 0.0 0.00 3.08
727 794 1.072331 CAAGTGCTAGAGGTGGTGGTT 59.928 52.381 0.00 0.0 0.00 3.67
833 906 0.896940 GGTGGTGGTGGTCGTAGAGA 60.897 60.000 0.00 0.0 36.95 3.10
858 931 4.798882 TGGTTTATAATGGATCGGCCTTT 58.201 39.130 0.00 0.0 37.71 3.11
1156 1229 3.236047 TGTAAGCTGAAGGTGTCCACTA 58.764 45.455 0.00 0.0 0.00 2.74
2052 2314 1.542375 ACCCAGATGCCAAGGTCCT 60.542 57.895 0.00 0.0 0.00 3.85
2157 2432 3.019003 ATCCAGACGCCAAGGTCCG 62.019 63.158 0.00 0.0 37.66 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 0.255033 TACTAGGCCTCTCGCACTGA 59.745 55.000 9.68 0.00 40.31 3.41
144 145 2.950673 TGCATCCGCACGGTTTTC 59.049 55.556 9.23 0.00 45.36 2.29
379 380 1.410882 GATAGTGTCAGGAGCCTCCAC 59.589 57.143 14.46 3.72 39.61 4.02
547 548 1.203313 ACCACCACTACCACCTCTGAT 60.203 52.381 0.00 0.00 0.00 2.90
620 621 2.577700 CTCGACCACTACCTCTAGCAT 58.422 52.381 0.00 0.00 0.00 3.79
631 692 0.244994 CTTGTGCTAGCTCGACCACT 59.755 55.000 17.23 0.00 0.00 4.00
656 717 1.972198 CTTGCTCGACCACCACCTA 59.028 57.895 0.00 0.00 0.00 3.08
727 794 3.118629 CCTCTAGCATTTGTGGTAGCTCA 60.119 47.826 9.19 0.00 39.11 4.26
833 906 5.393866 AGGCCGATCCATTATAAACCATTT 58.606 37.500 0.00 0.00 37.29 2.32
858 931 6.194235 ACCATCTGGATTAAGCAAATAACCA 58.806 36.000 2.55 0.00 38.94 3.67
1129 1202 4.278419 GGACACCTTCAGCTTACAAACATT 59.722 41.667 0.00 0.00 0.00 2.71
1156 1229 0.951558 GTCCATGACTTGTTGCGGTT 59.048 50.000 0.00 0.00 0.00 4.44
2140 2415 3.691342 CGGACCTTGGCGTCTGGA 61.691 66.667 6.64 0.00 35.79 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.