Multiple sequence alignment - TraesCS1B01G046900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G046900 chr1B 100.000 2636 0 0 1 2636 26649834 26652469 0 4868
1 TraesCS1B01G046900 chr2B 98.749 2637 32 1 1 2636 106932543 106935179 0 4686
2 TraesCS1B01G046900 chr2B 98.596 2636 36 1 1 2636 563765488 563768122 0 4662
3 TraesCS1B01G046900 chr2B 98.445 2636 41 0 1 2636 297490672 297493307 0 4641
4 TraesCS1B01G046900 chr2B 98.369 2637 42 1 1 2636 327771259 327768623 0 4630
5 TraesCS1B01G046900 chr5B 98.597 2637 36 1 1 2636 36453226 36450590 0 4663
6 TraesCS1B01G046900 chr3B 98.558 2636 38 0 1 2636 717599927 717597292 0 4658
7 TraesCS1B01G046900 chr6B 98.445 2636 41 0 1 2636 586281584 586278949 0 4641
8 TraesCS1B01G046900 chr6B 98.407 2636 42 0 1 2636 21617471 21614836 0 4636
9 TraesCS1B01G046900 chr4B 98.445 2637 38 3 1 2636 11627306 11624672 0 4639


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G046900 chr1B 26649834 26652469 2635 False 4868 4868 100.000 1 2636 1 chr1B.!!$F1 2635
1 TraesCS1B01G046900 chr2B 106932543 106935179 2636 False 4686 4686 98.749 1 2636 1 chr2B.!!$F1 2635
2 TraesCS1B01G046900 chr2B 563765488 563768122 2634 False 4662 4662 98.596 1 2636 1 chr2B.!!$F3 2635
3 TraesCS1B01G046900 chr2B 297490672 297493307 2635 False 4641 4641 98.445 1 2636 1 chr2B.!!$F2 2635
4 TraesCS1B01G046900 chr2B 327768623 327771259 2636 True 4630 4630 98.369 1 2636 1 chr2B.!!$R1 2635
5 TraesCS1B01G046900 chr5B 36450590 36453226 2636 True 4663 4663 98.597 1 2636 1 chr5B.!!$R1 2635
6 TraesCS1B01G046900 chr3B 717597292 717599927 2635 True 4658 4658 98.558 1 2636 1 chr3B.!!$R1 2635
7 TraesCS1B01G046900 chr6B 586278949 586281584 2635 True 4641 4641 98.445 1 2636 1 chr6B.!!$R2 2635
8 TraesCS1B01G046900 chr6B 21614836 21617471 2635 True 4636 4636 98.407 1 2636 1 chr6B.!!$R1 2635
9 TraesCS1B01G046900 chr4B 11624672 11627306 2634 True 4639 4639 98.445 1 2636 1 chr4B.!!$R1 2635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
206 207 1.816224 GTTCATTTCTTAGCCGCCCAA 59.184 47.619 0.0 0.0 0.0 4.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2151 2154 1.229082 TTCGGTAGTCAGGGCTGGT 60.229 57.895 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
206 207 1.816224 GTTCATTTCTTAGCCGCCCAA 59.184 47.619 0.00 0.0 0.00 4.12
273 274 7.985184 CCTACCTAGTAACTTCATTGTATGCAA 59.015 37.037 0.00 0.0 39.16 4.08
639 640 3.398318 TGTGGCAGGGAATACTCTCTA 57.602 47.619 0.00 0.0 28.20 2.43
1101 1102 1.546476 ACGCTCATCTTCCTCGACTTT 59.454 47.619 0.00 0.0 0.00 2.66
1169 1170 4.084537 CGTCTGCAGTTAACTAAGTTGTGG 60.085 45.833 14.67 0.0 0.00 4.17
1330 1331 7.470935 TGGTACTGCATGAGTTTTACTACTA 57.529 36.000 0.00 0.0 35.96 1.82
1365 1366 4.935808 AGTATTTACTACTGCCAACACAGC 59.064 41.667 0.00 0.0 41.60 4.40
1373 1374 1.658409 GCCAACACAGCGACTTTGC 60.658 57.895 0.00 0.0 0.00 3.68
1563 1565 5.767816 ATGTTGGTGGTTTTGTTCTACTC 57.232 39.130 0.00 0.0 0.00 2.59
2151 2154 5.407502 CGTGTTGTTCATCTGACTATGGTA 58.592 41.667 0.00 0.0 0.00 3.25
2212 2215 7.289782 AGTTGCATAGAAATATGAGAGAGTCCT 59.710 37.037 0.00 0.0 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 198 3.050339 CAAACATGTTGGGCGGCT 58.950 55.556 12.82 0.00 0.00 5.52
206 207 5.221185 GCAGATGGATGATTAGCAAACATGT 60.221 40.000 0.00 0.00 30.21 3.21
273 274 4.817318 AATTGAACCAACACCACAAGTT 57.183 36.364 0.00 0.00 0.00 2.66
1101 1102 3.458163 CAGGGGCGAGCGTCCTTA 61.458 66.667 13.65 0.00 40.34 2.69
1169 1170 4.718961 ACATTAGTAGGACATCAATGGGC 58.281 43.478 0.00 0.00 32.20 5.36
1330 1331 8.460428 GCAGTAGTAAATACTCTCTGTGTTAGT 58.540 37.037 18.21 0.00 43.13 2.24
1373 1374 2.548480 CACTCATCAGGTAGCATGCATG 59.452 50.000 22.70 22.70 32.49 4.06
1411 1412 7.201696 CGAATAAACCTATGCATACAAAGGTGT 60.202 37.037 17.66 15.09 41.51 4.16
1947 1949 5.278266 GCTAGTACCATGCTTTTTGTTGTCA 60.278 40.000 0.00 0.00 0.00 3.58
2151 2154 1.229082 TTCGGTAGTCAGGGCTGGT 60.229 57.895 0.00 0.00 0.00 4.00
2212 2215 2.210013 ACAAGCTCCTGGACTCGCA 61.210 57.895 8.85 0.00 0.00 5.10
2418 2421 2.434702 CAGGTAAGTGGGTCCCATCTAC 59.565 54.545 15.49 17.21 35.28 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.