Multiple sequence alignment - TraesCS1B01G043900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G043900 chr1B 100.000 4127 0 0 1 4127 23895120 23899246 0.000000e+00 7622.0
1 TraesCS1B01G043900 chr1B 99.329 4025 25 2 1 4023 23596344 23600368 0.000000e+00 7282.0
2 TraesCS1B01G043900 chr1B 93.159 2748 111 33 1051 3747 16225736 16223015 0.000000e+00 3962.0
3 TraesCS1B01G043900 chr1B 90.571 1909 129 29 1859 3747 16400916 16402793 0.000000e+00 2481.0
4 TraesCS1B01G043900 chr1B 88.267 2037 191 26 1738 3747 39814791 39816806 0.000000e+00 2394.0
5 TraesCS1B01G043900 chr1B 93.774 1574 85 8 1604 3173 39732722 39734286 0.000000e+00 2351.0
6 TraesCS1B01G043900 chr1B 96.502 829 25 3 3199 4023 39734285 39735113 0.000000e+00 1367.0
7 TraesCS1B01G043900 chr1B 85.072 556 33 20 1051 1571 39806095 39806635 4.730000e-144 521.0
8 TraesCS1B01G043900 chr1B 82.470 502 55 15 1110 1609 39732139 39732609 3.840000e-110 409.0
9 TraesCS1B01G043900 chr1B 92.887 239 15 2 3777 4014 16222798 16222561 3.050000e-91 346.0
10 TraesCS1B01G043900 chr1B 91.129 248 20 2 3778 4023 39809202 39809449 6.610000e-88 335.0
11 TraesCS1B01G043900 chr1B 96.104 77 2 1 929 1005 16225810 16225735 1.560000e-24 124.0
12 TraesCS1B01G043900 chr1A 92.759 2831 157 19 929 3747 13212249 13215043 0.000000e+00 4048.0
13 TraesCS1B01G043900 chr1A 91.052 2917 201 35 1136 4023 13229041 13231926 0.000000e+00 3886.0
14 TraesCS1B01G043900 chr1A 90.429 2121 149 30 1210 3302 13009792 13007698 0.000000e+00 2743.0
15 TraesCS1B01G043900 chr1A 91.922 1597 97 16 1438 3023 22790901 22789326 0.000000e+00 2206.0
16 TraesCS1B01G043900 chr1A 85.268 2111 195 42 1692 3747 22761589 22759540 0.000000e+00 2069.0
17 TraesCS1B01G043900 chr1A 90.846 1158 80 6 2179 3331 13005011 13003875 0.000000e+00 1528.0
18 TraesCS1B01G043900 chr1A 86.418 670 66 9 3037 3689 13257203 13257864 0.000000e+00 710.0
19 TraesCS1B01G043900 chr1A 85.671 663 65 14 3054 3708 22778865 22778225 0.000000e+00 671.0
20 TraesCS1B01G043900 chr1A 92.541 362 21 2 1051 1409 22791316 22790958 7.910000e-142 514.0
21 TraesCS1B01G043900 chr1A 93.141 277 15 4 3473 3747 13007700 13007426 1.790000e-108 403.0
22 TraesCS1B01G043900 chr1A 91.532 248 20 1 3777 4023 13215240 13215487 1.420000e-89 340.0
23 TraesCS1B01G043900 chr1A 91.532 248 20 1 3777 4023 13258103 13258350 1.420000e-89 340.0
24 TraesCS1B01G043900 chr1A 80.637 377 47 13 1203 1570 13250481 13250840 6.800000e-68 268.0
25 TraesCS1B01G043900 chr1A 84.436 257 37 2 1129 1385 22773280 22773027 2.460000e-62 250.0
26 TraesCS1B01G043900 chr1A 83.682 239 23 9 3777 4007 22778038 22777808 1.160000e-50 211.0
27 TraesCS1B01G043900 chr1A 88.136 59 2 1 1514 1572 13005892 13005839 9.580000e-07 65.8
28 TraesCS1B01G043900 chr1D 93.815 2021 106 8 1737 3747 10775143 10773132 0.000000e+00 3022.0
29 TraesCS1B01G043900 chr1D 89.991 2128 120 41 929 3017 10843675 10845748 0.000000e+00 2663.0
30 TraesCS1B01G043900 chr1D 87.937 2089 190 34 1692 3747 10930363 10932422 0.000000e+00 2405.0
31 TraesCS1B01G043900 chr1D 88.805 1992 162 37 1056 3023 10764355 10762401 0.000000e+00 2386.0
32 TraesCS1B01G043900 chr1D 88.157 1351 122 19 1692 3017 10836395 10837732 0.000000e+00 1574.0
33 TraesCS1B01G043900 chr1D 91.678 709 51 4 3046 3747 10762293 10761586 0.000000e+00 976.0
34 TraesCS1B01G043900 chr1D 85.896 709 63 12 3048 3747 10845864 10846544 0.000000e+00 721.0
35 TraesCS1B01G043900 chr1D 80.305 655 98 17 3 643 457553972 457553335 2.250000e-127 466.0
36 TraesCS1B01G043900 chr1D 92.991 214 14 1 3777 3989 10761367 10761154 1.110000e-80 311.0
37 TraesCS1B01G043900 chr1D 79.770 435 65 9 2443 2873 10910856 10911271 1.120000e-75 294.0
38 TraesCS1B01G043900 chr1D 93.478 184 12 0 460 643 341843937 341843754 1.460000e-69 274.0
39 TraesCS1B01G043900 chr1D 84.825 257 23 7 3774 4022 10846817 10847065 1.150000e-60 244.0
40 TraesCS1B01G043900 chr1D 95.370 108 5 0 4020 4127 10761151 10761044 5.480000e-39 172.0
41 TraesCS1B01G043900 chr1D 92.857 98 7 0 763 860 75663198 75663295 4.300000e-30 143.0
42 TraesCS1B01G043900 chr1D 88.889 90 8 2 677 765 75662623 75662711 4.360000e-20 110.0
43 TraesCS1B01G043900 chr2B 87.250 651 65 13 3 645 14987576 14986936 0.000000e+00 726.0
44 TraesCS1B01G043900 chr6B 85.891 645 73 12 3 642 65232497 65231866 0.000000e+00 671.0
45 TraesCS1B01G043900 chr6B 95.294 85 4 0 766 850 542582504 542582420 7.200000e-28 135.0
46 TraesCS1B01G043900 chr6B 91.209 91 8 0 769 859 126865198 126865108 1.560000e-24 124.0
47 TraesCS1B01G043900 chr5B 91.323 461 34 5 3 457 63495850 63495390 3.500000e-175 625.0
48 TraesCS1B01G043900 chr5B 94.565 184 9 1 462 645 677816890 677816708 2.430000e-72 283.0
49 TraesCS1B01G043900 chr5B 92.784 194 12 2 460 653 36396845 36397036 3.140000e-71 279.0
50 TraesCS1B01G043900 chr5B 93.684 95 6 0 766 860 645057542 645057448 4.300000e-30 143.0
51 TraesCS1B01G043900 chr7D 89.391 443 42 4 4 442 70365168 70364727 1.680000e-153 553.0
52 TraesCS1B01G043900 chr7D 88.696 460 43 9 3 457 484748529 484748074 1.680000e-153 553.0
53 TraesCS1B01G043900 chr7D 95.833 96 3 1 766 860 396381293 396381198 1.990000e-33 154.0
54 TraesCS1B01G043900 chr2D 88.671 459 40 9 4 457 133300528 133300077 2.170000e-152 549.0
55 TraesCS1B01G043900 chr2D 91.489 94 7 1 766 859 186812379 186812287 1.200000e-25 128.0
56 TraesCS1B01G043900 chr2D 96.000 75 2 1 788 861 629978354 629978280 2.020000e-23 121.0
57 TraesCS1B01G043900 chr5D 89.367 442 36 9 3 436 402695385 402695823 2.810000e-151 545.0
58 TraesCS1B01G043900 chr5D 93.514 185 12 0 460 644 395182055 395182239 4.060000e-70 276.0
59 TraesCS1B01G043900 chr5D 93.514 185 12 0 460 644 395187372 395187556 4.060000e-70 276.0
60 TraesCS1B01G043900 chr4D 86.680 488 52 8 3 487 447990738 447991215 2.830000e-146 529.0
61 TraesCS1B01G043900 chr6D 93.878 98 6 0 763 860 56341553 56341456 9.240000e-32 148.0
62 TraesCS1B01G043900 chr6D 93.000 100 6 1 762 860 62497335 62497434 1.200000e-30 145.0
63 TraesCS1B01G043900 chr6D 93.684 95 6 0 766 860 361375359 361375265 4.300000e-30 143.0
64 TraesCS1B01G043900 chr6D 90.000 90 8 1 677 765 361377657 361377568 9.370000e-22 115.0
65 TraesCS1B01G043900 chr7A 96.552 87 3 0 772 858 12904416 12904330 1.200000e-30 145.0
66 TraesCS1B01G043900 chr7A 93.684 95 3 1 766 860 40860259 40860168 5.560000e-29 139.0
67 TraesCS1B01G043900 chr3D 95.122 82 2 2 783 864 474550313 474550392 1.200000e-25 128.0
68 TraesCS1B01G043900 chr4A 97.222 72 2 0 789 860 648377659 648377588 5.600000e-24 122.0
69 TraesCS1B01G043900 chr3B 83.810 105 14 2 4020 4122 77890851 77890748 3.400000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G043900 chr1B 23895120 23899246 4126 False 7622.000000 7622 100.000000 1 4127 1 chr1B.!!$F3 4126
1 TraesCS1B01G043900 chr1B 23596344 23600368 4024 False 7282.000000 7282 99.329000 1 4023 1 chr1B.!!$F2 4022
2 TraesCS1B01G043900 chr1B 16400916 16402793 1877 False 2481.000000 2481 90.571000 1859 3747 1 chr1B.!!$F1 1888
3 TraesCS1B01G043900 chr1B 39814791 39816806 2015 False 2394.000000 2394 88.267000 1738 3747 1 chr1B.!!$F4 2009
4 TraesCS1B01G043900 chr1B 16222561 16225810 3249 True 1477.333333 3962 94.050000 929 4014 3 chr1B.!!$R1 3085
5 TraesCS1B01G043900 chr1B 39732139 39735113 2974 False 1375.666667 2351 90.915333 1110 4023 3 chr1B.!!$F5 2913
6 TraesCS1B01G043900 chr1B 39806095 39809449 3354 False 428.000000 521 88.100500 1051 4023 2 chr1B.!!$F6 2972
7 TraesCS1B01G043900 chr1A 13229041 13231926 2885 False 3886.000000 3886 91.052000 1136 4023 1 chr1A.!!$F1 2887
8 TraesCS1B01G043900 chr1A 13212249 13215487 3238 False 2194.000000 4048 92.145500 929 4023 2 chr1A.!!$F3 3094
9 TraesCS1B01G043900 chr1A 22759540 22761589 2049 True 2069.000000 2069 85.268000 1692 3747 1 chr1A.!!$R1 2055
10 TraesCS1B01G043900 chr1A 22789326 22791316 1990 True 1360.000000 2206 92.231500 1051 3023 2 chr1A.!!$R5 1972
11 TraesCS1B01G043900 chr1A 13003875 13009792 5917 True 1184.950000 2743 90.638000 1210 3747 4 chr1A.!!$R3 2537
12 TraesCS1B01G043900 chr1A 13257203 13258350 1147 False 525.000000 710 88.975000 3037 4023 2 chr1A.!!$F4 986
13 TraesCS1B01G043900 chr1A 22777808 22778865 1057 True 441.000000 671 84.676500 3054 4007 2 chr1A.!!$R4 953
14 TraesCS1B01G043900 chr1D 10773132 10775143 2011 True 3022.000000 3022 93.815000 1737 3747 1 chr1D.!!$R1 2010
15 TraesCS1B01G043900 chr1D 10930363 10932422 2059 False 2405.000000 2405 87.937000 1692 3747 1 chr1D.!!$F3 2055
16 TraesCS1B01G043900 chr1D 10836395 10837732 1337 False 1574.000000 1574 88.157000 1692 3017 1 chr1D.!!$F1 1325
17 TraesCS1B01G043900 chr1D 10843675 10847065 3390 False 1209.333333 2663 86.904000 929 4022 3 chr1D.!!$F4 3093
18 TraesCS1B01G043900 chr1D 10761044 10764355 3311 True 961.250000 2386 92.211000 1056 4127 4 chr1D.!!$R4 3071
19 TraesCS1B01G043900 chr1D 457553335 457553972 637 True 466.000000 466 80.305000 3 643 1 chr1D.!!$R3 640
20 TraesCS1B01G043900 chr2B 14986936 14987576 640 True 726.000000 726 87.250000 3 645 1 chr2B.!!$R1 642
21 TraesCS1B01G043900 chr6B 65231866 65232497 631 True 671.000000 671 85.891000 3 642 1 chr6B.!!$R1 639

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
501 519 2.344025 GACCAAAGGCGTTAGACGAAT 58.656 47.619 4.46 0.0 46.05 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3311 4026 6.56705 GTGACCATGAGCAATCAATACAAAT 58.433 36.0 0.0 0.0 0.0 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
501 519 2.344025 GACCAAAGGCGTTAGACGAAT 58.656 47.619 4.46 0.00 46.05 3.34
3360 4075 6.473778 CGTCTCTGTTATGTAAATGTCCTGAG 59.526 42.308 0.00 0.00 0.00 3.35
3803 5013 4.100653 TGGAAAATGTTGGAATTGCTGACA 59.899 37.500 8.61 8.61 0.00 3.58
3833 5642 6.183347 ACAAGGATTTAGAACAATGAGAGGG 58.817 40.000 0.00 0.00 0.00 4.30
3842 5651 4.019231 AGAACAATGAGAGGGTAAAGGTCC 60.019 45.833 0.00 0.00 0.00 4.46
4042 8285 1.073923 CCCTCCCCACCTGTATATTGC 59.926 57.143 0.00 0.00 0.00 3.56
4113 8356 7.396339 GGTCCAGTTTATAAGGGAAACAAGATT 59.604 37.037 4.69 0.00 38.91 2.40
4124 8367 7.669089 AGGGAAACAAGATTGAAAACCTAAA 57.331 32.000 0.00 0.00 0.00 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3311 4026 6.567050 GTGACCATGAGCAATCAATACAAAT 58.433 36.000 0.00 0.0 0.00 2.32
3730 4474 5.512060 CCCTAGGTAATCATCACAGATGTGG 60.512 48.000 12.77 0.0 45.65 4.17
3803 5013 7.118723 TCATTGTTCTAAATCCTTGTAGCCAT 58.881 34.615 0.00 0.0 0.00 4.40
3870 5686 5.404946 AGATGGCAATCATTCAAAAGTTCG 58.595 37.500 3.34 0.0 35.97 3.95
4088 8331 7.939784 ATCTTGTTTCCCTTATAAACTGGAC 57.060 36.000 0.00 0.0 37.64 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.