Multiple sequence alignment - TraesCS1B01G043600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G043600 chr1B 100.000 3890 0 0 1 3890 23596453 23600342 0.000000e+00 7184.0
1 TraesCS1B01G043600 chr1B 99.332 3890 24 2 1 3890 23895229 23899116 0.000000e+00 7038.0
2 TraesCS1B01G043600 chr1B 93.193 2747 113 31 942 3639 16225736 16223015 0.000000e+00 3969.0
3 TraesCS1B01G043600 chr1B 90.571 1909 130 28 1750 3639 16400916 16402793 0.000000e+00 2483.0
4 TraesCS1B01G043600 chr1B 88.267 2037 192 25 1629 3639 39814791 39816806 0.000000e+00 2394.0
5 TraesCS1B01G043600 chr1B 93.647 1574 87 8 1495 3064 39732722 39734286 0.000000e+00 2340.0
6 TraesCS1B01G043600 chr1B 97.136 803 21 1 3090 3890 39734285 39735087 0.000000e+00 1354.0
7 TraesCS1B01G043600 chr1B 87.464 1037 104 8 1870 2901 39740193 39741208 0.000000e+00 1171.0
8 TraesCS1B01G043600 chr1B 85.072 556 33 20 942 1462 39806095 39806635 4.450000e-144 521.0
9 TraesCS1B01G043600 chr1B 82.470 502 55 15 1001 1500 39732139 39732609 3.620000e-110 409.0
10 TraesCS1B01G043600 chr1B 92.793 222 15 1 3669 3890 16222798 16222578 1.740000e-83 320.0
11 TraesCS1B01G043600 chr1B 91.441 222 18 1 3670 3890 39809202 39809423 1.760000e-78 303.0
12 TraesCS1B01G043600 chr1B 90.783 217 20 0 3674 3890 39817106 39817322 1.370000e-74 291.0
13 TraesCS1B01G043600 chr1B 96.104 77 2 1 820 896 16225810 16225735 1.470000e-24 124.0
14 TraesCS1B01G043600 chr1A 92.794 2831 157 19 820 3639 13212249 13215043 0.000000e+00 4054.0
15 TraesCS1B01G043600 chr1A 91.076 2891 200 33 1027 3890 13229041 13231900 0.000000e+00 3856.0
16 TraesCS1B01G043600 chr1A 90.335 2121 151 30 1101 3193 13009792 13007698 0.000000e+00 2732.0
17 TraesCS1B01G043600 chr1A 91.797 1597 99 16 1329 2914 22790901 22789326 0.000000e+00 2194.0
18 TraesCS1B01G043600 chr1A 85.822 663 64 14 2945 3599 22778865 22778225 0.000000e+00 676.0
19 TraesCS1B01G043600 chr1A 92.541 362 21 2 942 1300 22791316 22790958 7.450000e-142 514.0
20 TraesCS1B01G043600 chr1A 94.382 267 14 1 3373 3639 13007691 13007426 3.620000e-110 409.0
21 TraesCS1B01G043600 chr1A 92.342 222 17 0 3669 3890 13215240 13215461 2.260000e-82 316.0
22 TraesCS1B01G043600 chr1A 91.892 222 18 0 3669 3890 13258103 13258324 1.050000e-80 311.0
23 TraesCS1B01G043600 chr1A 84.436 257 37 2 1020 1276 22773280 22773027 2.320000e-62 250.0
24 TraesCS1B01G043600 chr1A 88.136 59 2 1 1405 1463 13005892 13005839 9.020000e-07 65.8
25 TraesCS1B01G043600 chr1D 93.864 2021 106 8 1628 3639 10775143 10773132 0.000000e+00 3029.0
26 TraesCS1B01G043600 chr1D 89.897 2128 122 41 820 2908 10843675 10845748 0.000000e+00 2652.0
27 TraesCS1B01G043600 chr1D 88.705 1992 164 37 947 2914 10764355 10762401 0.000000e+00 2375.0
28 TraesCS1B01G043600 chr1D 92.243 709 48 3 2937 3639 10762293 10761586 0.000000e+00 998.0
29 TraesCS1B01G043600 chr1D 79.380 548 92 14 1 534 457553875 457553335 2.210000e-97 366.0
30 TraesCS1B01G043600 chr1D 93.548 217 14 0 3669 3885 10761367 10761151 1.350000e-84 324.0
31 TraesCS1B01G043600 chr1D 94.022 184 11 0 351 534 341843937 341843754 2.960000e-71 279.0
32 TraesCS1B01G043600 chr1D 92.857 98 7 0 654 751 75663198 75663295 4.050000e-30 143.0
33 TraesCS1B01G043600 chr1D 88.889 90 8 2 568 656 75662623 75662711 4.110000e-20 110.0
34 TraesCS1B01G043600 chr2B 85.793 542 61 11 1 536 14987467 14986936 9.440000e-156 560.0
35 TraesCS1B01G043600 chr6B 84.358 537 69 10 1 533 65232391 65231866 2.680000e-141 512.0
36 TraesCS1B01G043600 chr6B 95.294 85 4 0 657 741 542582504 542582420 6.780000e-28 135.0
37 TraesCS1B01G043600 chr6B 91.209 91 8 0 660 750 126865198 126865108 1.470000e-24 124.0
38 TraesCS1B01G043600 chr5B 90.831 349 28 3 4 348 63495738 63495390 7.610000e-127 464.0
39 TraesCS1B01G043600 chr5B 95.109 184 8 1 353 536 677816890 677816708 4.920000e-74 289.0
40 TraesCS1B01G043600 chr5B 93.299 194 11 2 351 544 36396845 36397036 6.360000e-73 285.0
41 TraesCS1B01G043600 chr5B 93.684 95 6 0 657 751 645057542 645057448 4.050000e-30 143.0
42 TraesCS1B01G043600 chr2D 87.500 352 36 6 1 348 133300424 133300077 2.180000e-107 399.0
43 TraesCS1B01G043600 chr2D 91.489 94 7 1 657 750 186812379 186812287 1.130000e-25 128.0
44 TraesCS1B01G043600 chr2D 96.000 75 2 1 679 752 629978354 629978280 1.900000e-23 121.0
45 TraesCS1B01G043600 chr5D 87.500 352 35 7 1 348 229324033 229324379 7.830000e-107 398.0
46 TraesCS1B01G043600 chr5D 87.688 333 33 7 1 327 402695493 402695823 7.890000e-102 381.0
47 TraesCS1B01G043600 chr5D 94.054 185 11 0 351 535 395182055 395182239 8.230000e-72 281.0
48 TraesCS1B01G043600 chr5D 94.054 185 11 0 351 535 395187372 395187556 8.230000e-72 281.0
49 TraesCS1B01G043600 chr7D 87.240 337 38 4 1 333 70365062 70364727 2.840000e-101 379.0
50 TraesCS1B01G043600 chr7D 86.364 352 40 8 1 348 484748421 484748074 1.020000e-100 377.0
51 TraesCS1B01G043600 chr7D 95.833 96 3 1 657 751 396381293 396381198 1.870000e-33 154.0
52 TraesCS1B01G043600 chr6D 93.878 98 6 0 654 751 56341553 56341456 8.710000e-32 148.0
53 TraesCS1B01G043600 chr6D 93.000 100 6 1 653 751 62497335 62497434 1.130000e-30 145.0
54 TraesCS1B01G043600 chr6D 93.684 95 6 0 657 751 361375359 361375265 4.050000e-30 143.0
55 TraesCS1B01G043600 chr6D 90.000 90 8 1 568 656 361377657 361377568 8.830000e-22 115.0
56 TraesCS1B01G043600 chr7A 96.552 87 3 0 663 749 12904416 12904330 1.130000e-30 145.0
57 TraesCS1B01G043600 chr7A 93.684 95 3 1 657 751 40860259 40860168 5.240000e-29 139.0
58 TraesCS1B01G043600 chr3D 95.122 82 2 2 674 755 474550313 474550392 1.130000e-25 128.0
59 TraesCS1B01G043600 chr4A 97.222 72 2 0 680 751 648377659 648377588 5.280000e-24 122.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G043600 chr1B 23596453 23600342 3889 False 7184.000000 7184 100.000000 1 3890 1 chr1B.!!$F2 3889
1 TraesCS1B01G043600 chr1B 23895229 23899116 3887 False 7038.000000 7038 99.332000 1 3890 1 chr1B.!!$F3 3889
2 TraesCS1B01G043600 chr1B 16400916 16402793 1877 False 2483.000000 2483 90.571000 1750 3639 1 chr1B.!!$F1 1889
3 TraesCS1B01G043600 chr1B 16222578 16225810 3232 True 1471.000000 3969 94.030000 820 3890 3 chr1B.!!$R1 3070
4 TraesCS1B01G043600 chr1B 39732139 39735087 2948 False 1367.666667 2340 91.084333 1001 3890 3 chr1B.!!$F5 2889
5 TraesCS1B01G043600 chr1B 39814791 39817322 2531 False 1342.500000 2394 89.525000 1629 3890 2 chr1B.!!$F7 2261
6 TraesCS1B01G043600 chr1B 39740193 39741208 1015 False 1171.000000 1171 87.464000 1870 2901 1 chr1B.!!$F4 1031
7 TraesCS1B01G043600 chr1B 39806095 39809423 3328 False 412.000000 521 88.256500 942 3890 2 chr1B.!!$F6 2948
8 TraesCS1B01G043600 chr1A 13229041 13231900 2859 False 3856.000000 3856 91.076000 1027 3890 1 chr1A.!!$F1 2863
9 TraesCS1B01G043600 chr1A 13212249 13215461 3212 False 2185.000000 4054 92.568000 820 3890 2 chr1A.!!$F3 3070
10 TraesCS1B01G043600 chr1A 22789326 22791316 1990 True 1354.000000 2194 92.169000 942 2914 2 chr1A.!!$R4 1972
11 TraesCS1B01G043600 chr1A 13005839 13009792 3953 True 1068.933333 2732 90.951000 1101 3639 3 chr1A.!!$R3 2538
12 TraesCS1B01G043600 chr1A 22778225 22778865 640 True 676.000000 676 85.822000 2945 3599 1 chr1A.!!$R2 654
13 TraesCS1B01G043600 chr1D 10773132 10775143 2011 True 3029.000000 3029 93.864000 1628 3639 1 chr1D.!!$R1 2011
14 TraesCS1B01G043600 chr1D 10843675 10845748 2073 False 2652.000000 2652 89.897000 820 2908 1 chr1D.!!$F1 2088
15 TraesCS1B01G043600 chr1D 10761151 10764355 3204 True 1232.333333 2375 91.498667 947 3885 3 chr1D.!!$R4 2938
16 TraesCS1B01G043600 chr1D 457553335 457553875 540 True 366.000000 366 79.380000 1 534 1 chr1D.!!$R3 533
17 TraesCS1B01G043600 chr2B 14986936 14987467 531 True 560.000000 560 85.793000 1 536 1 chr2B.!!$R1 535
18 TraesCS1B01G043600 chr6B 65231866 65232391 525 True 512.000000 512 84.358000 1 533 1 chr6B.!!$R1 532

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
392 398 1.458445 GACCAAAGGCGTTAGACGAAC 59.542 52.381 4.46 0.0 46.05 3.95 F
2600 3159 2.108514 CAGTTGGCATCGCGGATGT 61.109 57.895 6.13 0.0 41.60 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2193 2724 2.031682 GCATGGCATAAAAGCTACTCCG 60.032 50.0 0.0 0.0 34.17 4.63 R
3852 4814 0.807496 GCCTCTTGGTGCTCATCAAC 59.193 55.0 0.0 0.0 35.27 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 2.817844 GACCGCCAAACCTAGACAAATT 59.182 45.455 0.00 0.0 0.00 1.82
392 398 1.458445 GACCAAAGGCGTTAGACGAAC 59.542 52.381 4.46 0.0 46.05 3.95
2600 3159 2.108514 CAGTTGGCATCGCGGATGT 61.109 57.895 6.13 0.0 41.60 3.06
3705 4666 3.445096 GGAATTGCTGACTTGGCTACAAT 59.555 43.478 0.00 0.0 35.73 2.71
3852 4814 6.918043 GCTTAACTAGCTGTTTTGAACATG 57.082 37.500 0.00 0.0 46.77 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 1.619827 CCAAGCTCCATTTGCCTCAAA 59.380 47.619 0.00 0.0 37.75 2.69
2193 2724 2.031682 GCATGGCATAAAAGCTACTCCG 60.032 50.000 0.00 0.0 34.17 4.63
3705 4666 7.500227 CCTTTATCCTCTCATTGTGCTAAATCA 59.500 37.037 0.00 0.0 0.00 2.57
3762 4723 5.713389 AGATGGCAATCATTCAGAAGTTCAA 59.287 36.000 3.34 0.0 35.97 2.69
3851 4813 1.883638 GCCTCTTGGTGCTCATCAACA 60.884 52.381 0.00 0.0 41.46 3.33
3852 4814 0.807496 GCCTCTTGGTGCTCATCAAC 59.193 55.000 0.00 0.0 35.27 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.