Multiple sequence alignment - TraesCS1B01G043000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G043000 chr1B 100.000 2934 0 0 1 2934 22455677 22452744 0.000000e+00 5419
1 TraesCS1B01G043000 chr1B 99.138 2436 20 1 500 2934 22594153 22591718 0.000000e+00 4381
2 TraesCS1B01G043000 chr1B 99.278 1801 8 2 1 1800 22515361 22513565 0.000000e+00 3249
3 TraesCS1B01G043000 chr1B 98.724 1802 13 2 1 1800 22395662 22393869 0.000000e+00 3192
4 TraesCS1B01G043000 chr1B 95.302 1341 36 6 943 2283 22563708 22562395 0.000000e+00 2102
5 TraesCS1B01G043000 chr1B 99.135 1156 10 0 1779 2934 22393926 22392771 0.000000e+00 2080
6 TraesCS1B01G043000 chr1B 99.048 1156 11 0 1779 2934 22513622 22512467 0.000000e+00 2074
7 TraesCS1B01G043000 chr1B 97.078 1095 32 0 1782 2876 22436262 22435168 0.000000e+00 1845
8 TraesCS1B01G043000 chr1B 97.305 1076 29 0 1800 2875 22376513 22375438 0.000000e+00 1827
9 TraesCS1B01G043000 chr1B 98.704 849 11 0 943 1791 22497039 22496191 0.000000e+00 1507
10 TraesCS1B01G043000 chr1B 97.661 855 20 0 943 1797 22437062 22436208 0.000000e+00 1469
11 TraesCS1B01G043000 chr1B 97.611 837 20 0 943 1779 22377313 22376477 0.000000e+00 1435
12 TraesCS1B01G043000 chr1B 97.733 750 16 1 1788 2536 22496239 22495490 0.000000e+00 1290
13 TraesCS1B01G043000 chr1B 97.990 597 12 0 2280 2876 22558442 22557846 0.000000e+00 1037
14 TraesCS1B01G043000 chr1B 99.604 505 2 0 1 505 22604862 22604358 0.000000e+00 922
15 TraesCS1B01G043000 chr1B 98.397 312 5 0 2565 2876 22495490 22495179 1.540000e-152 549
16 TraesCS1B01G043000 chr1B 98.333 60 1 0 2875 2934 22435140 22435081 4.000000e-19 106
17 TraesCS1B01G043000 chr1B 98.333 60 1 0 2875 2934 22495151 22495092 4.000000e-19 106
18 TraesCS1B01G043000 chr1B 96.667 60 2 0 2875 2934 22375409 22375350 1.860000e-17 100
19 TraesCS1B01G043000 chr1B 96.667 60 2 0 2875 2934 22557818 22557759 1.860000e-17 100
20 TraesCS1B01G043000 chrUn 99.604 505 2 0 1 505 423038467 423037963 0.000000e+00 922
21 TraesCS1B01G043000 chrUn 88.153 498 41 5 2395 2875 293593364 293593860 7.050000e-161 577
22 TraesCS1B01G043000 chrUn 88.000 500 40 6 2395 2875 293578315 293577817 9.120000e-160 573


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G043000 chr1B 22452744 22455677 2933 True 5419.000000 5419 100.000000 1 2934 1 chr1B.!!$R1 2933
1 TraesCS1B01G043000 chr1B 22591718 22594153 2435 True 4381.000000 4381 99.138000 500 2934 1 chr1B.!!$R2 2434
2 TraesCS1B01G043000 chr1B 22512467 22515361 2894 True 2661.500000 3249 99.163000 1 2934 2 chr1B.!!$R8 2933
3 TraesCS1B01G043000 chr1B 22392771 22395662 2891 True 2636.000000 3192 98.929500 1 2934 2 chr1B.!!$R5 2933
4 TraesCS1B01G043000 chr1B 22435081 22437062 1981 True 1140.000000 1845 97.690667 943 2934 3 chr1B.!!$R6 1991
5 TraesCS1B01G043000 chr1B 22375350 22377313 1963 True 1120.666667 1827 97.194333 943 2934 3 chr1B.!!$R4 1991
6 TraesCS1B01G043000 chr1B 22557759 22563708 5949 True 1079.666667 2102 96.653000 943 2934 3 chr1B.!!$R9 1991
7 TraesCS1B01G043000 chr1B 22604358 22604862 504 True 922.000000 922 99.604000 1 505 1 chr1B.!!$R3 504
8 TraesCS1B01G043000 chr1B 22495092 22497039 1947 True 863.000000 1507 98.291750 943 2934 4 chr1B.!!$R7 1991
9 TraesCS1B01G043000 chrUn 423037963 423038467 504 True 922.000000 922 99.604000 1 505 1 chrUn.!!$R2 504

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
320 321 3.321111 TGGAACAACTCCTAGACACAGTC 59.679 47.826 0.0 0.0 45.64 3.51 F
918 925 6.786461 GGACCCTATAAATACCACTCCTACTT 59.214 42.308 0.0 0.0 0.00 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1566 1574 1.331756 GCCATCGCTAGTTCATTGGTG 59.668 52.381 0.00 0.0 0.0 4.17 R
2278 2353 5.584649 CCTGCGAAGTAATTACATGGAAGAA 59.415 40.000 17.65 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
320 321 3.321111 TGGAACAACTCCTAGACACAGTC 59.679 47.826 0.00 0.00 45.64 3.51
918 925 6.786461 GGACCCTATAAATACCACTCCTACTT 59.214 42.308 0.00 0.00 0.00 2.24
1859 1933 2.747396 TTGTCAAAAGATGGCATGCC 57.253 45.000 30.54 30.54 44.65 4.40
2277 2352 7.436118 ACATGTTGGGAATAATATTGTCATGC 58.564 34.615 0.00 0.00 34.33 4.06
2278 2353 7.288389 ACATGTTGGGAATAATATTGTCATGCT 59.712 33.333 0.00 0.00 34.33 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
724 727 8.840321 CCACTAGTAACAGCTGCATTTATTTAT 58.160 33.333 15.27 0.00 0.00 1.40
918 925 0.615331 GGGTTGAGAGACATGCCTCA 59.385 55.000 11.88 9.94 37.61 3.86
1566 1574 1.331756 GCCATCGCTAGTTCATTGGTG 59.668 52.381 0.00 0.00 0.00 4.17
2277 2352 6.238211 CCTGCGAAGTAATTACATGGAAGAAG 60.238 42.308 17.65 6.49 0.00 2.85
2278 2353 5.584649 CCTGCGAAGTAATTACATGGAAGAA 59.415 40.000 17.65 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.