Multiple sequence alignment - TraesCS1B01G042900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G042900 chr1B 100.000 2898 0 0 1 2898 22395668 22392771 0.000000e+00 5352
1 TraesCS1B01G042900 chr1B 98.794 2903 28 3 1 2898 22515367 22512467 0.000000e+00 5160
2 TraesCS1B01G042900 chr1B 98.728 1808 13 2 1 1800 22455683 22453878 0.000000e+00 3203
3 TraesCS1B01G042900 chr1B 96.891 1898 56 1 943 2840 22437062 22435168 0.000000e+00 3175
4 TraesCS1B01G042900 chr1B 96.046 1897 54 1 943 2839 22377313 22375438 0.000000e+00 3068
5 TraesCS1B01G042900 chr1B 97.436 1560 30 2 943 2501 22497039 22495489 0.000000e+00 2651
6 TraesCS1B01G042900 chr1B 98.160 1304 13 3 506 1800 22594153 22592852 0.000000e+00 2265
7 TraesCS1B01G042900 chr1B 96.804 1314 33 1 943 2247 22563708 22562395 0.000000e+00 2185
8 TraesCS1B01G042900 chr1B 99.135 1156 10 0 1743 2898 22453899 22452744 0.000000e+00 2080
9 TraesCS1B01G042900 chr1B 98.789 1156 14 0 1743 2898 22592873 22591718 0.000000e+00 2058
10 TraesCS1B01G042900 chr1B 97.663 599 14 0 2242 2840 22558444 22557846 0.000000e+00 1029
11 TraesCS1B01G042900 chr1B 100.000 511 0 0 1 511 22604868 22604358 0.000000e+00 944
12 TraesCS1B01G042900 chr1B 97.436 312 8 0 2529 2840 22495490 22495179 1.530000e-147 532
13 TraesCS1B01G042900 chr1B 98.333 60 1 0 2839 2898 22435140 22435081 3.950000e-19 106
14 TraesCS1B01G042900 chr1B 98.333 60 1 0 2839 2898 22495151 22495092 3.950000e-19 106
15 TraesCS1B01G042900 chr1B 96.667 60 2 0 2839 2898 22375409 22375350 1.840000e-17 100
16 TraesCS1B01G042900 chr1B 96.667 60 2 0 2839 2898 22557818 22557759 1.840000e-17 100
17 TraesCS1B01G042900 chrUn 100.000 511 0 0 1 511 423038473 423037963 0.000000e+00 944
18 TraesCS1B01G042900 chrUn 87.800 500 39 8 2359 2839 293593364 293593860 1.510000e-157 566
19 TraesCS1B01G042900 chrUn 87.649 502 38 9 2359 2839 293578315 293577817 1.950000e-156 562


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G042900 chr1B 22392771 22395668 2897 True 5352.000000 5352 100.000000 1 2898 1 chr1B.!!$R1 2897
1 TraesCS1B01G042900 chr1B 22512467 22515367 2900 True 5160.000000 5160 98.794000 1 2898 1 chr1B.!!$R2 2897
2 TraesCS1B01G042900 chr1B 22452744 22455683 2939 True 2641.500000 3203 98.931500 1 2898 2 chr1B.!!$R6 2897
3 TraesCS1B01G042900 chr1B 22591718 22594153 2435 True 2161.500000 2265 98.474500 506 2898 2 chr1B.!!$R9 2392
4 TraesCS1B01G042900 chr1B 22435081 22437062 1981 True 1640.500000 3175 97.612000 943 2898 2 chr1B.!!$R5 1955
5 TraesCS1B01G042900 chr1B 22375350 22377313 1963 True 1584.000000 3068 96.356500 943 2898 2 chr1B.!!$R4 1955
6 TraesCS1B01G042900 chr1B 22557759 22563708 5949 True 1104.666667 2185 97.044667 943 2898 3 chr1B.!!$R8 1955
7 TraesCS1B01G042900 chr1B 22495092 22497039 1947 True 1096.333333 2651 97.735000 943 2898 3 chr1B.!!$R7 1955
8 TraesCS1B01G042900 chr1B 22604358 22604868 510 True 944.000000 944 100.000000 1 511 1 chr1B.!!$R3 510
9 TraesCS1B01G042900 chrUn 423037963 423038473 510 True 944.000000 944 100.000000 1 511 1 chrUn.!!$R2 510

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
608 609 1.831106 TCGAGATAAGGTGGTGCATGT 59.169 47.619 0.0 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2481 6532 0.535553 TTGTTCCGCCCCACAAGTAC 60.536 55.0 0.0 0.0 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
608 609 1.831106 TCGAGATAAGGTGGTGCATGT 59.169 47.619 0.00 0.0 0.00 3.21
609 610 1.935873 CGAGATAAGGTGGTGCATGTG 59.064 52.381 0.00 0.0 0.00 3.21
876 885 2.892852 CAAGAAATTGACCAGCCTCCAA 59.107 45.455 0.00 0.0 0.00 3.53
1149 1158 2.754375 GTGTCCGGACCAACCCAT 59.246 61.111 31.19 0.0 34.64 4.00
1180 1190 5.881923 AGTTGTGTTTAAGTCTACTCCCA 57.118 39.130 0.00 0.0 0.00 4.37
1234 1244 8.706322 TGATTATACTCTACTTGATGCACCTA 57.294 34.615 0.00 0.0 0.00 3.08
1463 1473 5.637006 TTATTAAAATGTTGAGTGCCGCT 57.363 34.783 0.00 0.0 0.00 5.52
1503 1513 7.910162 CCAAGTGATTCATGAAATAGGTTTACG 59.090 37.037 13.09 0.0 0.00 3.18
2481 6532 6.092748 CCGACCTTTTGATTTGGATAAACTG 58.907 40.000 0.00 0.0 0.00 3.16
2711 6762 0.525668 CAACGCGCTCCTCTCGTAAT 60.526 55.000 5.73 0.0 35.18 1.89
2712 6763 0.172803 AACGCGCTCCTCTCGTAATT 59.827 50.000 5.73 0.0 35.18 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
608 609 3.689347 AGGATAGTGCATTGTTTGAGCA 58.311 40.909 0.0 0.0 35.63 4.26
609 610 5.415415 CTAGGATAGTGCATTGTTTGAGC 57.585 43.478 0.0 0.0 32.85 4.26
876 885 2.660064 CCAGTAGCCAAGACCCGCT 61.660 63.158 0.0 0.0 39.17 5.52
1149 1158 9.101655 GTAGACTTAAACACAACTTCTTGGTTA 57.898 33.333 0.0 0.0 0.00 2.85
1180 1190 4.864726 ACCGTCCTACCAAACTCTATAGT 58.135 43.478 0.0 0.0 37.65 2.12
1234 1244 1.828979 ATAATTTTGGCGTCCGGTGT 58.171 45.000 0.0 0.0 0.00 4.16
1463 1473 7.831753 TGAATCACTTGGAAGTTAAACAAACA 58.168 30.769 0.0 0.0 40.83 2.83
1503 1513 5.478407 CCCATAACTTGAAATGTTGAACCC 58.522 41.667 0.0 0.0 35.64 4.11
2481 6532 0.535553 TTGTTCCGCCCCACAAGTAC 60.536 55.000 0.0 0.0 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.