Multiple sequence alignment - TraesCS1B01G040000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G040000 chr1B 100.000 3188 0 0 1 3188 19720933 19717746 0.000000e+00 5888
1 TraesCS1B01G040000 chr1B 99.122 3189 13 2 1 3188 19620974 19617800 0.000000e+00 5720
2 TraesCS1B01G040000 chr1B 98.652 3189 28 3 1 3188 19840527 19837353 0.000000e+00 5637
3 TraesCS1B01G040000 chr1B 98.056 3190 45 4 1 3188 19952403 19949229 0.000000e+00 5531
4 TraesCS1B01G040000 chr1B 97.673 3137 46 6 55 3188 19781501 19778389 0.000000e+00 5363
5 TraesCS1B01G040000 chr1B 98.858 2277 26 0 912 3188 19892056 19889780 0.000000e+00 4061
6 TraesCS1B01G040000 chr1B 90.150 2660 191 34 213 2863 20048532 20045935 0.000000e+00 3395
7 TraesCS1B01G040000 chr1B 91.049 2335 163 25 206 2533 20554500 20556795 0.000000e+00 3112
8 TraesCS1B01G040000 chr1B 88.868 530 50 5 2654 3183 20556820 20557340 0.000000e+00 643
9 TraesCS1B01G040000 chr1B 92.473 186 12 2 1 185 20554193 20554377 6.780000e-67 265
10 TraesCS1B01G040000 chr1D 93.295 2461 132 16 412 2863 13729091 13726655 0.000000e+00 3600
11 TraesCS1B01G040000 chr1D 93.558 2375 121 16 497 2863 13818154 13815804 0.000000e+00 3509
12 TraesCS1B01G040000 chr1D 88.598 535 51 6 2654 3188 13810529 13810005 2.680000e-180 641
13 TraesCS1B01G040000 chr1D 88.411 535 52 6 2654 3188 13721770 13721246 1.250000e-178 636
14 TraesCS1B01G040000 chr1D 86.957 276 19 5 6 266 13508744 13508471 8.650000e-76 294
15 TraesCS1B01G040000 chr1D 84.589 292 22 8 1 277 13818907 13818624 5.240000e-68 268
16 TraesCS1B01G040000 chr1D 94.558 147 7 1 1 147 13729237 13729092 3.200000e-55 226
17 TraesCS1B01G040000 chr1D 88.636 176 20 0 250 425 13970866 13970691 6.930000e-52 215
18 TraesCS1B01G040000 chr1A 91.192 2634 161 33 557 3188 14792339 14789775 0.000000e+00 3513
19 TraesCS1B01G040000 chr1A 89.557 2030 167 24 573 2579 14840302 14838295 0.000000e+00 2532
20 TraesCS1B01G040000 chr1A 88.546 227 21 3 206 432 14795266 14795045 1.460000e-68 270
21 TraesCS1B01G040000 chr1A 93.407 91 5 1 472 561 14795040 14794950 2.000000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G040000 chr1B 19717746 19720933 3187 True 5888.000000 5888 100.000000 1 3188 1 chr1B.!!$R2 3187
1 TraesCS1B01G040000 chr1B 19617800 19620974 3174 True 5720.000000 5720 99.122000 1 3188 1 chr1B.!!$R1 3187
2 TraesCS1B01G040000 chr1B 19837353 19840527 3174 True 5637.000000 5637 98.652000 1 3188 1 chr1B.!!$R4 3187
3 TraesCS1B01G040000 chr1B 19949229 19952403 3174 True 5531.000000 5531 98.056000 1 3188 1 chr1B.!!$R6 3187
4 TraesCS1B01G040000 chr1B 19778389 19781501 3112 True 5363.000000 5363 97.673000 55 3188 1 chr1B.!!$R3 3133
5 TraesCS1B01G040000 chr1B 19889780 19892056 2276 True 4061.000000 4061 98.858000 912 3188 1 chr1B.!!$R5 2276
6 TraesCS1B01G040000 chr1B 20045935 20048532 2597 True 3395.000000 3395 90.150000 213 2863 1 chr1B.!!$R7 2650
7 TraesCS1B01G040000 chr1B 20554193 20557340 3147 False 1340.000000 3112 90.796667 1 3183 3 chr1B.!!$F1 3182
8 TraesCS1B01G040000 chr1D 13726655 13729237 2582 True 1913.000000 3600 93.926500 1 2863 2 chr1D.!!$R5 2862
9 TraesCS1B01G040000 chr1D 13815804 13818907 3103 True 1888.500000 3509 89.073500 1 2863 2 chr1D.!!$R6 2862
10 TraesCS1B01G040000 chr1D 13810005 13810529 524 True 641.000000 641 88.598000 2654 3188 1 chr1D.!!$R3 534
11 TraesCS1B01G040000 chr1D 13721246 13721770 524 True 636.000000 636 88.411000 2654 3188 1 chr1D.!!$R2 534
12 TraesCS1B01G040000 chr1A 14838295 14840302 2007 True 2532.000000 2532 89.557000 573 2579 1 chr1A.!!$R1 2006
13 TraesCS1B01G040000 chr1A 14789775 14795266 5491 True 1305.666667 3513 91.048333 206 3188 3 chr1A.!!$R2 2982

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1321 4362 1.515521 CGTGGAGGTGCCCAAACTTC 61.516 60.0 0.0 0.0 38.06 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2286 5327 6.787458 AGTGAAAAACCAGGGATAAAGGAAAT 59.213 34.615 0.0 0.0 0.0 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1321 4362 1.515521 CGTGGAGGTGCCCAAACTTC 61.516 60.000 0.00 0.0 38.06 3.01
2043 5084 1.338200 GCATGTGTCCTCTTCGTCCTT 60.338 52.381 0.00 0.0 0.00 3.36
2203 5244 2.097954 GCATGATCGATCAGCAAACCAA 59.902 45.455 30.11 6.5 40.64 3.67
2286 5327 1.877680 CGGTGTGATGGCTGTTCTGAA 60.878 52.381 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1321 4362 2.510238 CTCTGCCGCCTCTTTCCG 60.510 66.667 0.00 0.00 0.0 4.30
1818 4859 2.040442 TTGGAGATGAGCCCGGGA 59.960 61.111 29.31 2.74 0.0 5.14
2203 5244 9.915629 TGTTGTTGGCGAATAAATAATAAAGTT 57.084 25.926 0.00 0.00 0.0 2.66
2286 5327 6.787458 AGTGAAAAACCAGGGATAAAGGAAAT 59.213 34.615 0.00 0.00 0.0 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.