Multiple sequence alignment - TraesCS1B01G028000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G028000 chr1B 100.000 2243 0 0 1 2243 13500496 13502738 0.000000e+00 4143.0
1 TraesCS1B01G028000 chr1B 97.968 2018 41 0 1 2018 13013085 13015102 0.000000e+00 3500.0
2 TraesCS1B01G028000 chr1B 90.656 1509 120 7 1 1493 12499563 12501066 0.000000e+00 1986.0
3 TraesCS1B01G028000 chr1B 90.656 1509 120 7 1 1493 12569754 12571257 0.000000e+00 1986.0
4 TraesCS1B01G028000 chr1B 88.720 1250 111 16 174 1405 12374541 12373304 0.000000e+00 1500.0
5 TraesCS1B01G028000 chr1B 91.667 228 13 3 2021 2243 13015148 13015374 6.020000e-81 311.0
6 TraesCS1B01G028000 chr1B 87.000 200 14 2 1295 1482 12572405 12572604 4.850000e-52 215.0
7 TraesCS1B01G028000 chr1A 89.119 1158 99 12 368 1505 10708868 10710018 0.000000e+00 1415.0
8 TraesCS1B01G028000 chr1A 87.661 389 32 6 1515 1893 10710219 10710601 2.640000e-119 438.0
9 TraesCS1B01G028000 chr1A 93.585 265 16 1 1 265 10708612 10708875 5.810000e-106 394.0
10 TraesCS1B01G028000 chr1A 95.070 142 6 1 2099 2240 10712809 10712949 2.900000e-54 222.0
11 TraesCS1B01G028000 chr1A 90.000 70 5 1 1950 2017 10712638 10712707 3.070000e-14 89.8
12 TraesCS1B01G028000 chr1A 95.652 46 0 1 2021 2064 10712751 10712796 3.090000e-09 73.1
13 TraesCS1B01G028000 chr1D 86.303 752 71 14 710 1449 9418008 9418739 0.000000e+00 789.0
14 TraesCS1B01G028000 chr1D 85.670 321 18 13 1732 2024 9431913 9432233 1.670000e-81 313.0
15 TraesCS1B01G028000 chr1D 91.667 228 14 2 2021 2243 9432273 9432500 6.020000e-81 311.0
16 TraesCS1B01G028000 chr1D 84.553 246 31 5 413 657 9414626 9414865 1.040000e-58 237.0
17 TraesCS1B01G028000 chr1D 84.921 126 11 2 715 840 9485850 9485967 1.090000e-23 121.0
18 TraesCS1B01G028000 chr5D 85.792 183 23 2 1463 1642 555355220 555355038 8.180000e-45 191.0
19 TraesCS1B01G028000 chr3A 91.304 46 4 0 1624 1669 721543169 721543124 1.860000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G028000 chr1B 13500496 13502738 2242 False 4143.00 4143 100.000000 1 2243 1 chr1B.!!$F2 2242
1 TraesCS1B01G028000 chr1B 12499563 12501066 1503 False 1986.00 1986 90.656000 1 1493 1 chr1B.!!$F1 1492
2 TraesCS1B01G028000 chr1B 13013085 13015374 2289 False 1905.50 3500 94.817500 1 2243 2 chr1B.!!$F4 2242
3 TraesCS1B01G028000 chr1B 12373304 12374541 1237 True 1500.00 1500 88.720000 174 1405 1 chr1B.!!$R1 1231
4 TraesCS1B01G028000 chr1B 12569754 12572604 2850 False 1100.50 1986 88.828000 1 1493 2 chr1B.!!$F3 1492
5 TraesCS1B01G028000 chr1A 10708612 10712949 4337 False 438.65 1415 91.847833 1 2240 6 chr1A.!!$F1 2239
6 TraesCS1B01G028000 chr1D 9414626 9418739 4113 False 513.00 789 85.428000 413 1449 2 chr1D.!!$F2 1036
7 TraesCS1B01G028000 chr1D 9431913 9432500 587 False 312.00 313 88.668500 1732 2243 2 chr1D.!!$F3 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
992 4097 0.532573 GGAGCTGATCACAACGAGGA 59.467 55.0 0.0 0.0 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1972 8122 1.678635 GCACAAGCCAGCCACCATA 60.679 57.895 0.0 0.0 33.58 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
391 393 1.912731 TGGAGATTTCATTCCGGACCA 59.087 47.619 1.83 1.16 36.22 4.02
485 487 4.321899 GCAAATAGCACACAGGAAAATCCA 60.322 41.667 0.00 0.00 44.79 3.41
493 495 6.438425 AGCACACAGGAAAATCCAGAAATAAT 59.562 34.615 0.00 0.00 39.61 1.28
535 537 8.908786 TGTTGATCTATTAGAAAGCTATTGGG 57.091 34.615 0.00 0.00 0.00 4.12
921 4026 7.574021 AGCCCCAAGATCATCTATAAATACA 57.426 36.000 0.00 0.00 0.00 2.29
985 4090 3.165071 TCTACAGTTGGAGCTGATCACA 58.835 45.455 0.00 0.00 39.62 3.58
992 4097 0.532573 GGAGCTGATCACAACGAGGA 59.467 55.000 0.00 0.00 0.00 3.71
1261 4366 0.109723 GGGCTACCACAACCTCAACA 59.890 55.000 0.00 0.00 36.50 3.33
1592 4903 2.279517 GATGCTAGACCGCCGTGG 60.280 66.667 0.00 0.00 46.41 4.94
1961 8111 3.061697 GCGTACATGTGTTAGTGGCTTAC 59.938 47.826 9.11 0.00 0.00 2.34
1972 8122 5.715279 TGTTAGTGGCTTACTGTGTCTAGAT 59.285 40.000 0.00 0.00 40.65 1.98
1973 8123 6.888088 TGTTAGTGGCTTACTGTGTCTAGATA 59.112 38.462 0.00 0.00 40.65 1.98
2019 8169 8.504815 GCGTGAGTCTATGTAAGAGATGTAATA 58.495 37.037 0.00 0.00 33.88 0.98
2072 8267 3.753294 TTCTTCTGTCCACTGTTCCTC 57.247 47.619 0.00 0.00 0.00 3.71
2096 8291 6.016693 TCTGTGAGCTGTGATAGATAGTTAGC 60.017 42.308 0.00 0.00 0.00 3.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 3.433740 CCTTGGAGATAGTTACCTTGGGC 60.434 52.174 0.00 0.00 0.00 5.36
378 380 4.402829 TGATTCTTTTGGTCCGGAATGAA 58.597 39.130 5.23 5.12 0.00 2.57
391 393 4.157246 GGGTGGGTAAGGTTGATTCTTTT 58.843 43.478 0.00 0.00 0.00 2.27
485 487 9.118300 CATTGCTACTCCTTTCAGATTATTTCT 57.882 33.333 0.00 0.00 33.90 2.52
493 495 5.227569 TCAACATTGCTACTCCTTTCAGA 57.772 39.130 0.00 0.00 0.00 3.27
676 2466 6.726490 ATCCTACACATTCGTATGTAAGGT 57.274 37.500 23.45 14.65 43.07 3.50
921 4026 6.485648 GTGTTTAAGCCGTATTATCTGGGATT 59.514 38.462 0.00 0.00 32.22 3.01
970 4075 1.728971 CTCGTTGTGATCAGCTCCAAC 59.271 52.381 14.02 14.02 34.41 3.77
985 4090 2.579201 CATCGCCCTGTCCTCGTT 59.421 61.111 0.00 0.00 0.00 3.85
992 4097 3.036429 GCTCTTCCCATCGCCCTGT 62.036 63.158 0.00 0.00 0.00 4.00
1261 4366 0.179006 GCTAATAAGCTGCCCTGCCT 60.179 55.000 0.00 0.00 45.85 4.75
1427 4546 3.125316 GCCGACGTGAGAAAGATGAAAAT 59.875 43.478 0.00 0.00 0.00 1.82
1592 4903 0.457035 TCACCATACTCGCCGTAACC 59.543 55.000 0.00 0.00 0.00 2.85
1961 8111 3.244009 CCAGCCACCATATCTAGACACAG 60.244 52.174 0.00 0.00 0.00 3.66
1972 8122 1.678635 GCACAAGCCAGCCACCATA 60.679 57.895 0.00 0.00 33.58 2.74
1973 8123 2.993264 GCACAAGCCAGCCACCAT 60.993 61.111 0.00 0.00 33.58 3.55
2072 8267 6.148948 GCTAACTATCTATCACAGCTCACAG 58.851 44.000 0.00 0.00 0.00 3.66
2096 8291 2.124942 GCTGCCTCCCTTCTTCCG 60.125 66.667 0.00 0.00 0.00 4.30
2173 8371 2.018515 ACGCTTCACTTTCCGGAAAAA 58.981 42.857 28.62 19.30 0.00 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.