Multiple sequence alignment - TraesCS1B01G012500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G012500 chr1B 100.000 4412 0 0 1 4412 6068735 6073146 0.000000e+00 8148.0
1 TraesCS1B01G012500 chr1B 100.000 1404 0 0 4862 6265 6073596 6074999 0.000000e+00 2593.0
2 TraesCS1B01G012500 chr4B 95.679 486 19 1 1 484 205154058 205153573 0.000000e+00 780.0
3 TraesCS1B01G012500 chr4B 95.661 484 20 1 1 484 205152873 205152391 0.000000e+00 776.0
4 TraesCS1B01G012500 chr6A 94.628 484 26 0 1 484 187729491 187729974 0.000000e+00 750.0
5 TraesCS1B01G012500 chr6A 93.802 484 21 1 1 484 539420399 539419925 0.000000e+00 719.0
6 TraesCS1B01G012500 chr6A 93.595 484 22 4 1 484 560525019 560525493 0.000000e+00 713.0
7 TraesCS1B01G012500 chr6A 93.595 484 22 4 1 484 560526193 560526667 0.000000e+00 713.0
8 TraesCS1B01G012500 chr6A 93.168 483 33 0 1 483 187728353 187728835 0.000000e+00 710.0
9 TraesCS1B01G012500 chr3A 94.215 484 19 5 1 484 652992852 652992378 0.000000e+00 730.0
10 TraesCS1B01G012500 chr3A 92.418 488 23 9 1 484 652991913 652991436 0.000000e+00 684.0
11 TraesCS1B01G012500 chr3A 78.654 609 120 10 2473 3076 53179359 53179962 4.550000e-106 396.0
12 TraesCS1B01G012500 chr3A 78.197 610 121 11 2473 3076 53037197 53037800 4.580000e-101 379.0
13 TraesCS1B01G012500 chr2B 92.054 516 41 0 483 998 711139224 711138709 0.000000e+00 726.0
14 TraesCS1B01G012500 chr2B 73.544 601 129 22 2473 3061 798359922 798359340 1.060000e-47 202.0
15 TraesCS1B01G012500 chrUn 93.595 484 19 2 1 484 221989683 221990154 0.000000e+00 712.0
16 TraesCS1B01G012500 chrUn 85.075 67 10 0 2474 2540 88582606 88582540 1.130000e-07 69.4
17 TraesCS1B01G012500 chrUn 85.714 56 6 2 5450 5505 48594595 48594542 2.440000e-04 58.4
18 TraesCS1B01G012500 chr7B 90.998 511 45 1 485 995 615894721 615895230 0.000000e+00 688.0
19 TraesCS1B01G012500 chr7B 90.802 511 46 1 485 995 615869739 615870248 0.000000e+00 682.0
20 TraesCS1B01G012500 chr3B 90.802 511 46 1 485 995 818709915 818710424 0.000000e+00 682.0
21 TraesCS1B01G012500 chr3B 87.524 513 63 1 483 995 522866515 522866004 5.410000e-165 592.0
22 TraesCS1B01G012500 chr6D 89.883 514 50 2 483 994 95311594 95312107 0.000000e+00 660.0
23 TraesCS1B01G012500 chr6D 76.962 790 160 19 2474 3249 2323688 2322907 1.250000e-116 431.0
24 TraesCS1B01G012500 chr6D 75.985 787 172 16 2473 3249 2294215 2293436 2.120000e-104 390.0
25 TraesCS1B01G012500 chr6D 84.932 146 20 2 5846 5990 337521266 337521122 5.060000e-31 147.0
26 TraesCS1B01G012500 chr7D 89.515 515 52 2 484 996 609013086 609012572 0.000000e+00 651.0
27 TraesCS1B01G012500 chr5B 87.914 513 59 2 483 993 298874267 298873756 8.990000e-168 601.0
28 TraesCS1B01G012500 chr5B 87.671 73 9 0 5430 5502 704167823 704167751 1.120000e-12 86.1
29 TraesCS1B01G012500 chr4A 87.452 518 63 2 483 999 187902872 187903388 4.180000e-166 595.0
30 TraesCS1B01G012500 chr4A 96.045 177 7 0 307 483 91621622 91621446 7.950000e-74 289.0
31 TraesCS1B01G012500 chr4A 76.692 133 22 7 5379 5508 635959016 635959142 1.460000e-06 65.8
32 TraesCS1B01G012500 chr3D 78.818 609 119 10 2473 3076 41668006 41668609 9.780000e-108 401.0
33 TraesCS1B01G012500 chr3D 77.305 141 22 8 5379 5515 11265751 11265885 2.420000e-09 75.0
34 TraesCS1B01G012500 chr1A 82.915 199 30 4 5792 5987 404540638 404540835 6.450000e-40 176.0
35 TraesCS1B01G012500 chr5D 81.609 174 31 1 5815 5987 40695632 40695459 6.550000e-30 143.0
36 TraesCS1B01G012500 chr5D 82.171 129 23 0 5861 5989 541559778 541559650 1.850000e-20 111.0
37 TraesCS1B01G012500 chr4D 83.916 143 20 3 5846 5987 118723263 118723403 3.940000e-27 134.0
38 TraesCS1B01G012500 chr2A 78.641 206 38 6 5791 5992 261423642 261423845 1.420000e-26 132.0
39 TraesCS1B01G012500 chr2D 83.108 148 20 5 5811 5954 518263868 518264014 5.100000e-26 130.0
40 TraesCS1B01G012500 chr2D 77.473 182 35 6 5791 5967 490808034 490807854 3.090000e-18 104.0
41 TraesCS1B01G012500 chr2D 87.209 86 11 0 5430 5515 497322070 497322155 1.440000e-16 99.0
42 TraesCS1B01G012500 chr1D 81.333 150 16 8 5846 5987 83995420 83995565 1.850000e-20 111.0
43 TraesCS1B01G012500 chr1D 84.000 100 13 3 5890 5987 318573483 318573385 6.690000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G012500 chr1B 6068735 6074999 6264 False 5370.5 8148 100.0000 1 6265 2 chr1B.!!$F1 6264
1 TraesCS1B01G012500 chr4B 205152391 205154058 1667 True 778.0 780 95.6700 1 484 2 chr4B.!!$R1 483
2 TraesCS1B01G012500 chr6A 187728353 187729974 1621 False 730.0 750 93.8980 1 484 2 chr6A.!!$F1 483
3 TraesCS1B01G012500 chr6A 560525019 560526667 1648 False 713.0 713 93.5950 1 484 2 chr6A.!!$F2 483
4 TraesCS1B01G012500 chr3A 652991436 652992852 1416 True 707.0 730 93.3165 1 484 2 chr3A.!!$R1 483
5 TraesCS1B01G012500 chr3A 53179359 53179962 603 False 396.0 396 78.6540 2473 3076 1 chr3A.!!$F2 603
6 TraesCS1B01G012500 chr3A 53037197 53037800 603 False 379.0 379 78.1970 2473 3076 1 chr3A.!!$F1 603
7 TraesCS1B01G012500 chr2B 711138709 711139224 515 True 726.0 726 92.0540 483 998 1 chr2B.!!$R1 515
8 TraesCS1B01G012500 chr2B 798359340 798359922 582 True 202.0 202 73.5440 2473 3061 1 chr2B.!!$R2 588
9 TraesCS1B01G012500 chr7B 615894721 615895230 509 False 688.0 688 90.9980 485 995 1 chr7B.!!$F2 510
10 TraesCS1B01G012500 chr7B 615869739 615870248 509 False 682.0 682 90.8020 485 995 1 chr7B.!!$F1 510
11 TraesCS1B01G012500 chr3B 818709915 818710424 509 False 682.0 682 90.8020 485 995 1 chr3B.!!$F1 510
12 TraesCS1B01G012500 chr3B 522866004 522866515 511 True 592.0 592 87.5240 483 995 1 chr3B.!!$R1 512
13 TraesCS1B01G012500 chr6D 95311594 95312107 513 False 660.0 660 89.8830 483 994 1 chr6D.!!$F1 511
14 TraesCS1B01G012500 chr6D 2322907 2323688 781 True 431.0 431 76.9620 2474 3249 1 chr6D.!!$R2 775
15 TraesCS1B01G012500 chr6D 2293436 2294215 779 True 390.0 390 75.9850 2473 3249 1 chr6D.!!$R1 776
16 TraesCS1B01G012500 chr7D 609012572 609013086 514 True 651.0 651 89.5150 484 996 1 chr7D.!!$R1 512
17 TraesCS1B01G012500 chr5B 298873756 298874267 511 True 601.0 601 87.9140 483 993 1 chr5B.!!$R1 510
18 TraesCS1B01G012500 chr4A 187902872 187903388 516 False 595.0 595 87.4520 483 999 1 chr4A.!!$F1 516
19 TraesCS1B01G012500 chr3D 41668006 41668609 603 False 401.0 401 78.8180 2473 3076 1 chr3D.!!$F2 603


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
917 2177 1.133388 TGGGTACGGGTATGGGTAGAG 60.133 57.143 0.00 0.0 0.00 2.43 F
1360 2620 0.035534 ATGCATGTCGCCCTACACAA 60.036 50.000 0.00 0.0 41.33 3.33 F
2032 3292 0.032678 CTCATCGATGAACTCCGGGG 59.967 60.000 27.09 0.0 36.18 5.73 F
3349 4621 0.034756 TAGCACACCAATGACGCTGT 59.965 50.000 0.00 0.0 38.19 4.40 F
3450 4722 0.036010 ATGTCGGGAGGTTGCTTCAG 60.036 55.000 0.00 0.0 0.00 3.02 F
5082 6354 0.033796 ATCAAGGCATGGGTGGTGAG 60.034 55.000 0.00 0.0 0.00 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2013 3273 0.032678 CCCCGGAGTTCATCGATGAG 59.967 60.0 25.95 15.06 38.19 2.90 R
3292 4564 0.103390 TTGAACGACCTCACTTGCGA 59.897 50.0 0.00 0.00 0.00 5.10 R
3431 4703 0.036010 CTGAAGCAACCTCCCGACAT 60.036 55.0 0.00 0.00 0.00 3.06 R
5063 6335 0.033796 CTCACCACCCATGCCTTGAT 60.034 55.0 0.00 0.00 0.00 2.57 R
5138 6410 0.034198 TCGATCGTGGGACAAGCAAA 59.966 50.0 15.94 0.00 44.16 3.68 R
6033 7305 0.031178 CAAGCTGGCAACACAAGGAC 59.969 55.0 0.00 0.00 46.17 3.85 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 64 3.073062 ACTTCATCGCCTGGCCTTTATAT 59.927 43.478 14.12 0.00 0.00 0.86
66 67 3.072330 TCATCGCCTGGCCTTTATATTCA 59.928 43.478 14.12 0.00 0.00 2.57
93 1344 2.124193 AGCGGCCAAGCATGCATA 60.124 55.556 21.98 0.00 40.15 3.14
103 1354 2.953648 CAAGCATGCATAACTCCCATGA 59.046 45.455 21.98 0.00 38.84 3.07
145 1396 2.660064 CGGCCACTAACTCCAGGCT 61.660 63.158 2.24 0.00 46.23 4.58
400 1655 3.834799 GAACCCGACGAGCCCGAT 61.835 66.667 0.00 0.00 39.50 4.18
463 1718 1.302511 GACGAGCCCAACCACACAT 60.303 57.895 0.00 0.00 0.00 3.21
510 1765 2.026590 CGGATACCGTACCCGCAC 59.973 66.667 0.00 0.00 42.73 5.34
524 1779 4.109675 GCACGGGCAGGGTATGGT 62.110 66.667 3.77 0.00 40.72 3.55
542 1797 7.882179 GGTATGGTCACAATTTTATACCCATC 58.118 38.462 0.00 0.00 35.93 3.51
629 1885 7.957471 TGGATATACTCATACCCTACCCATTA 58.043 38.462 0.00 0.00 0.00 1.90
759 2015 3.652869 TCACACAAAATCCCCTCTTCTCT 59.347 43.478 0.00 0.00 0.00 3.10
793 2053 8.981647 GCTTTTTGTCAAATGTTCTATCAATGT 58.018 29.630 0.00 0.00 0.00 2.71
840 2100 4.360951 ACTTTTTGATCTACCCGTTGGA 57.639 40.909 0.00 0.00 34.81 3.53
917 2177 1.133388 TGGGTACGGGTATGGGTAGAG 60.133 57.143 0.00 0.00 0.00 2.43
947 2207 2.432874 CCATTGACTACACGGGTATGGA 59.567 50.000 10.50 0.00 33.61 3.41
998 2258 2.456577 ACCCATTGCCATCCTTAACAC 58.543 47.619 0.00 0.00 0.00 3.32
1000 2260 1.405105 CCATTGCCATCCTTAACACCG 59.595 52.381 0.00 0.00 0.00 4.94
1001 2261 2.091541 CATTGCCATCCTTAACACCGT 58.908 47.619 0.00 0.00 0.00 4.83
1002 2262 3.275143 CATTGCCATCCTTAACACCGTA 58.725 45.455 0.00 0.00 0.00 4.02
1003 2263 2.389962 TGCCATCCTTAACACCGTAC 57.610 50.000 0.00 0.00 0.00 3.67
1004 2264 1.624312 TGCCATCCTTAACACCGTACA 59.376 47.619 0.00 0.00 0.00 2.90
1005 2265 2.237643 TGCCATCCTTAACACCGTACAT 59.762 45.455 0.00 0.00 0.00 2.29
1006 2266 2.612212 GCCATCCTTAACACCGTACATG 59.388 50.000 0.00 0.00 0.00 3.21
1007 2267 3.680475 GCCATCCTTAACACCGTACATGA 60.680 47.826 0.00 0.00 0.00 3.07
1008 2268 4.703897 CCATCCTTAACACCGTACATGAT 58.296 43.478 0.00 0.00 0.00 2.45
1009 2269 5.740803 GCCATCCTTAACACCGTACATGATA 60.741 44.000 0.00 0.00 0.00 2.15
1010 2270 6.285224 CCATCCTTAACACCGTACATGATAA 58.715 40.000 0.00 0.12 0.00 1.75
1011 2271 6.934645 CCATCCTTAACACCGTACATGATAAT 59.065 38.462 0.00 0.00 0.00 1.28
1012 2272 7.444183 CCATCCTTAACACCGTACATGATAATT 59.556 37.037 0.00 0.00 0.00 1.40
1013 2273 8.836413 CATCCTTAACACCGTACATGATAATTT 58.164 33.333 0.00 0.00 0.00 1.82
1014 2274 8.428186 TCCTTAACACCGTACATGATAATTTC 57.572 34.615 0.00 0.00 0.00 2.17
1015 2275 7.496591 TCCTTAACACCGTACATGATAATTTCC 59.503 37.037 0.00 0.00 0.00 3.13
1016 2276 7.281324 CCTTAACACCGTACATGATAATTTCCA 59.719 37.037 0.00 0.00 0.00 3.53
1017 2277 8.740123 TTAACACCGTACATGATAATTTCCAT 57.260 30.769 0.00 0.00 0.00 3.41
1018 2278 6.618287 ACACCGTACATGATAATTTCCATG 57.382 37.500 14.46 14.46 44.12 3.66
1029 2289 9.426837 CATGATAATTTCCATGTTTTGTCAACT 57.573 29.630 10.06 0.00 36.36 3.16
1031 2291 9.474920 TGATAATTTCCATGTTTTGTCAACTTC 57.525 29.630 0.00 0.00 0.00 3.01
1032 2292 6.826893 AATTTCCATGTTTTGTCAACTTCG 57.173 33.333 0.00 0.00 0.00 3.79
1033 2293 5.568685 TTTCCATGTTTTGTCAACTTCGA 57.431 34.783 0.00 0.00 0.00 3.71
1034 2294 5.766150 TTCCATGTTTTGTCAACTTCGAT 57.234 34.783 0.00 0.00 0.00 3.59
1035 2295 6.869315 TTCCATGTTTTGTCAACTTCGATA 57.131 33.333 0.00 0.00 0.00 2.92
1036 2296 7.447374 TTCCATGTTTTGTCAACTTCGATAT 57.553 32.000 0.00 0.00 0.00 1.63
1037 2297 7.447374 TCCATGTTTTGTCAACTTCGATATT 57.553 32.000 0.00 0.00 0.00 1.28
1038 2298 7.304735 TCCATGTTTTGTCAACTTCGATATTG 58.695 34.615 3.36 3.36 0.00 1.90
1039 2299 6.527722 CCATGTTTTGTCAACTTCGATATTGG 59.472 38.462 8.76 0.00 0.00 3.16
1040 2300 6.627395 TGTTTTGTCAACTTCGATATTGGT 57.373 33.333 8.76 0.00 0.00 3.67
1041 2301 7.731882 TGTTTTGTCAACTTCGATATTGGTA 57.268 32.000 8.76 0.00 0.00 3.25
1042 2302 7.802738 TGTTTTGTCAACTTCGATATTGGTAG 58.197 34.615 8.76 0.00 0.00 3.18
1043 2303 6.417191 TTTGTCAACTTCGATATTGGTAGC 57.583 37.500 8.76 0.00 0.00 3.58
1044 2304 5.339008 TGTCAACTTCGATATTGGTAGCT 57.661 39.130 8.76 0.00 0.00 3.32
1045 2305 6.459670 TGTCAACTTCGATATTGGTAGCTA 57.540 37.500 8.76 0.00 0.00 3.32
1046 2306 6.504398 TGTCAACTTCGATATTGGTAGCTAG 58.496 40.000 0.00 0.00 0.00 3.42
1047 2307 5.402867 GTCAACTTCGATATTGGTAGCTAGC 59.597 44.000 16.08 16.08 0.00 3.42
1048 2308 5.302059 TCAACTTCGATATTGGTAGCTAGCT 59.698 40.000 23.12 23.12 0.00 3.32
1049 2309 6.489022 TCAACTTCGATATTGGTAGCTAGCTA 59.511 38.462 20.67 20.67 0.00 3.32
1050 2310 6.503589 ACTTCGATATTGGTAGCTAGCTAG 57.496 41.667 24.78 16.84 0.00 3.42
1062 2322 2.880963 CTAGCTAGCAGAACCTGGTC 57.119 55.000 18.83 0.00 41.50 4.02
1063 2323 2.103373 CTAGCTAGCAGAACCTGGTCA 58.897 52.381 18.83 0.00 41.50 4.02
1064 2324 1.577736 AGCTAGCAGAACCTGGTCAT 58.422 50.000 18.83 0.00 41.50 3.06
1065 2325 1.484240 AGCTAGCAGAACCTGGTCATC 59.516 52.381 18.83 0.00 41.50 2.92
1066 2326 1.804372 GCTAGCAGAACCTGGTCATCG 60.804 57.143 10.63 0.00 41.50 3.84
1067 2327 1.751351 CTAGCAGAACCTGGTCATCGA 59.249 52.381 0.00 0.00 41.50 3.59
1068 2328 1.198713 AGCAGAACCTGGTCATCGAT 58.801 50.000 0.00 0.00 37.71 3.59
1069 2329 1.137872 AGCAGAACCTGGTCATCGATC 59.862 52.381 0.00 0.00 37.71 3.69
1070 2330 1.137872 GCAGAACCTGGTCATCGATCT 59.862 52.381 0.00 0.00 31.21 2.75
1071 2331 2.819115 CAGAACCTGGTCATCGATCTG 58.181 52.381 0.00 4.61 0.00 2.90
1072 2332 2.167281 CAGAACCTGGTCATCGATCTGT 59.833 50.000 13.39 0.00 0.00 3.41
1073 2333 3.381590 CAGAACCTGGTCATCGATCTGTA 59.618 47.826 13.39 0.00 0.00 2.74
1074 2334 4.023980 AGAACCTGGTCATCGATCTGTAA 58.976 43.478 0.00 0.00 0.00 2.41
1075 2335 4.651503 AGAACCTGGTCATCGATCTGTAAT 59.348 41.667 0.00 0.00 0.00 1.89
1076 2336 4.327982 ACCTGGTCATCGATCTGTAATG 57.672 45.455 0.00 0.00 0.00 1.90
1077 2337 3.706594 ACCTGGTCATCGATCTGTAATGT 59.293 43.478 0.00 0.00 0.00 2.71
1078 2338 4.053983 CCTGGTCATCGATCTGTAATGTG 58.946 47.826 0.00 0.00 0.00 3.21
1079 2339 4.202151 CCTGGTCATCGATCTGTAATGTGA 60.202 45.833 0.00 0.00 0.00 3.58
1080 2340 4.936891 TGGTCATCGATCTGTAATGTGAG 58.063 43.478 0.00 0.00 0.00 3.51
1081 2341 3.738282 GGTCATCGATCTGTAATGTGAGC 59.262 47.826 0.00 0.00 0.00 4.26
1082 2342 3.423536 GTCATCGATCTGTAATGTGAGCG 59.576 47.826 0.00 0.00 42.45 5.03
1083 2343 1.840181 TCGATCTGTAATGTGAGCGC 58.160 50.000 0.00 0.00 41.13 5.92
1084 2344 0.855349 CGATCTGTAATGTGAGCGCC 59.145 55.000 2.29 0.00 35.42 6.53
1085 2345 1.221414 GATCTGTAATGTGAGCGCCC 58.779 55.000 2.29 0.00 0.00 6.13
1086 2346 0.833287 ATCTGTAATGTGAGCGCCCT 59.167 50.000 2.29 0.00 0.00 5.19
1087 2347 0.613260 TCTGTAATGTGAGCGCCCTT 59.387 50.000 2.29 0.00 0.00 3.95
1088 2348 0.729116 CTGTAATGTGAGCGCCCTTG 59.271 55.000 2.29 0.00 0.00 3.61
1089 2349 0.323302 TGTAATGTGAGCGCCCTTGA 59.677 50.000 2.29 0.00 0.00 3.02
1090 2350 1.009829 GTAATGTGAGCGCCCTTGAG 58.990 55.000 2.29 0.00 0.00 3.02
1091 2351 0.107703 TAATGTGAGCGCCCTTGAGG 60.108 55.000 2.29 0.00 39.47 3.86
1102 2362 3.985410 CCTTGAGGGCCTTTGATCA 57.015 52.632 7.89 0.00 0.00 2.92
1103 2363 2.449137 CCTTGAGGGCCTTTGATCAT 57.551 50.000 7.89 0.00 0.00 2.45
1104 2364 2.743553 CCTTGAGGGCCTTTGATCATT 58.256 47.619 7.89 0.00 0.00 2.57
1105 2365 3.102204 CCTTGAGGGCCTTTGATCATTT 58.898 45.455 7.89 0.00 0.00 2.32
1106 2366 3.118884 CCTTGAGGGCCTTTGATCATTTG 60.119 47.826 7.89 0.00 0.00 2.32
1107 2367 2.459644 TGAGGGCCTTTGATCATTTGG 58.540 47.619 7.89 0.28 0.00 3.28
1108 2368 1.758862 GAGGGCCTTTGATCATTTGGG 59.241 52.381 7.89 0.00 0.00 4.12
1109 2369 1.079323 AGGGCCTTTGATCATTTGGGT 59.921 47.619 0.00 0.00 0.00 4.51
1110 2370 1.908619 GGGCCTTTGATCATTTGGGTT 59.091 47.619 0.84 0.00 0.00 4.11
1111 2371 2.355007 GGGCCTTTGATCATTTGGGTTG 60.355 50.000 0.84 0.00 0.00 3.77
1112 2372 2.302733 GGCCTTTGATCATTTGGGTTGT 59.697 45.455 0.00 0.00 0.00 3.32
1113 2373 3.328505 GCCTTTGATCATTTGGGTTGTG 58.671 45.455 0.00 0.00 0.00 3.33
1114 2374 3.244181 GCCTTTGATCATTTGGGTTGTGT 60.244 43.478 0.00 0.00 0.00 3.72
1115 2375 4.021544 GCCTTTGATCATTTGGGTTGTGTA 60.022 41.667 0.00 0.00 0.00 2.90
1116 2376 5.337491 GCCTTTGATCATTTGGGTTGTGTAT 60.337 40.000 0.00 0.00 0.00 2.29
1117 2377 6.127479 GCCTTTGATCATTTGGGTTGTGTATA 60.127 38.462 0.00 0.00 0.00 1.47
1118 2378 7.417797 GCCTTTGATCATTTGGGTTGTGTATAT 60.418 37.037 0.00 0.00 0.00 0.86
1119 2379 9.130661 CCTTTGATCATTTGGGTTGTGTATATA 57.869 33.333 0.00 0.00 0.00 0.86
1122 2382 9.639563 TTGATCATTTGGGTTGTGTATATATGT 57.360 29.630 0.00 0.00 0.00 2.29
1123 2383 9.065798 TGATCATTTGGGTTGTGTATATATGTG 57.934 33.333 0.00 0.00 0.00 3.21
1124 2384 8.995027 ATCATTTGGGTTGTGTATATATGTGT 57.005 30.769 0.00 0.00 0.00 3.72
1125 2385 8.219546 TCATTTGGGTTGTGTATATATGTGTG 57.780 34.615 0.00 0.00 0.00 3.82
1126 2386 7.831690 TCATTTGGGTTGTGTATATATGTGTGT 59.168 33.333 0.00 0.00 0.00 3.72
1127 2387 6.993786 TTGGGTTGTGTATATATGTGTGTG 57.006 37.500 0.00 0.00 0.00 3.82
1128 2388 4.878971 TGGGTTGTGTATATATGTGTGTGC 59.121 41.667 0.00 0.00 0.00 4.57
1129 2389 4.878971 GGGTTGTGTATATATGTGTGTGCA 59.121 41.667 0.00 0.00 0.00 4.57
1130 2390 5.355630 GGGTTGTGTATATATGTGTGTGCAA 59.644 40.000 0.00 0.00 0.00 4.08
1131 2391 6.458206 GGGTTGTGTATATATGTGTGTGCAAG 60.458 42.308 0.00 0.00 0.00 4.01
1132 2392 6.458206 GGTTGTGTATATATGTGTGTGCAAGG 60.458 42.308 0.00 0.00 0.00 3.61
1133 2393 4.574421 TGTGTATATATGTGTGTGCAAGGC 59.426 41.667 0.00 0.00 0.00 4.35
1134 2394 4.574421 GTGTATATATGTGTGTGCAAGGCA 59.426 41.667 0.00 0.00 35.60 4.75
1135 2395 5.065859 GTGTATATATGTGTGTGCAAGGCAA 59.934 40.000 0.00 0.00 41.47 4.52
1136 2396 5.649831 TGTATATATGTGTGTGCAAGGCAAA 59.350 36.000 0.00 0.00 41.47 3.68
1137 2397 5.857471 ATATATGTGTGTGCAAGGCAAAT 57.143 34.783 0.00 0.00 41.47 2.32
1138 2398 2.914695 ATGTGTGTGCAAGGCAAATT 57.085 40.000 0.00 0.00 41.47 1.82
1139 2399 2.222007 TGTGTGTGCAAGGCAAATTC 57.778 45.000 0.00 0.00 41.47 2.17
1140 2400 1.479730 TGTGTGTGCAAGGCAAATTCA 59.520 42.857 0.00 0.00 41.47 2.57
1141 2401 2.129607 GTGTGTGCAAGGCAAATTCAG 58.870 47.619 0.00 0.00 41.47 3.02
1142 2402 1.755959 TGTGTGCAAGGCAAATTCAGT 59.244 42.857 0.00 0.00 41.47 3.41
1143 2403 2.223782 TGTGTGCAAGGCAAATTCAGTC 60.224 45.455 0.00 0.00 41.47 3.51
1144 2404 1.340889 TGTGCAAGGCAAATTCAGTCC 59.659 47.619 0.00 0.00 41.47 3.85
1145 2405 0.968405 TGCAAGGCAAATTCAGTCCC 59.032 50.000 0.00 0.00 34.76 4.46
1146 2406 0.247460 GCAAGGCAAATTCAGTCCCC 59.753 55.000 0.00 0.00 0.00 4.81
1147 2407 1.631405 CAAGGCAAATTCAGTCCCCA 58.369 50.000 0.00 0.00 0.00 4.96
1148 2408 1.273327 CAAGGCAAATTCAGTCCCCAC 59.727 52.381 0.00 0.00 0.00 4.61
1149 2409 0.251787 AGGCAAATTCAGTCCCCACC 60.252 55.000 0.00 0.00 0.00 4.61
1150 2410 0.541764 GGCAAATTCAGTCCCCACCA 60.542 55.000 0.00 0.00 0.00 4.17
1151 2411 1.337118 GCAAATTCAGTCCCCACCAA 58.663 50.000 0.00 0.00 0.00 3.67
1152 2412 1.273327 GCAAATTCAGTCCCCACCAAG 59.727 52.381 0.00 0.00 0.00 3.61
1153 2413 1.273327 CAAATTCAGTCCCCACCAAGC 59.727 52.381 0.00 0.00 0.00 4.01
1154 2414 0.482446 AATTCAGTCCCCACCAAGCA 59.518 50.000 0.00 0.00 0.00 3.91
1155 2415 0.482446 ATTCAGTCCCCACCAAGCAA 59.518 50.000 0.00 0.00 0.00 3.91
1156 2416 0.467290 TTCAGTCCCCACCAAGCAAC 60.467 55.000 0.00 0.00 0.00 4.17
1157 2417 1.152777 CAGTCCCCACCAAGCAACA 60.153 57.895 0.00 0.00 0.00 3.33
1158 2418 0.754957 CAGTCCCCACCAAGCAACAA 60.755 55.000 0.00 0.00 0.00 2.83
1159 2419 0.755327 AGTCCCCACCAAGCAACAAC 60.755 55.000 0.00 0.00 0.00 3.32
1160 2420 1.456705 TCCCCACCAAGCAACAACC 60.457 57.895 0.00 0.00 0.00 3.77
1161 2421 1.760086 CCCCACCAAGCAACAACCA 60.760 57.895 0.00 0.00 0.00 3.67
1162 2422 1.441311 CCCACCAAGCAACAACCAC 59.559 57.895 0.00 0.00 0.00 4.16
1163 2423 1.042559 CCCACCAAGCAACAACCACT 61.043 55.000 0.00 0.00 0.00 4.00
1164 2424 0.385390 CCACCAAGCAACAACCACTC 59.615 55.000 0.00 0.00 0.00 3.51
1165 2425 1.102154 CACCAAGCAACAACCACTCA 58.898 50.000 0.00 0.00 0.00 3.41
1166 2426 1.682854 CACCAAGCAACAACCACTCAT 59.317 47.619 0.00 0.00 0.00 2.90
1167 2427 2.884012 CACCAAGCAACAACCACTCATA 59.116 45.455 0.00 0.00 0.00 2.15
1168 2428 3.507233 CACCAAGCAACAACCACTCATAT 59.493 43.478 0.00 0.00 0.00 1.78
1169 2429 4.699735 CACCAAGCAACAACCACTCATATA 59.300 41.667 0.00 0.00 0.00 0.86
1170 2430 5.357878 CACCAAGCAACAACCACTCATATAT 59.642 40.000 0.00 0.00 0.00 0.86
1171 2431 5.951747 ACCAAGCAACAACCACTCATATATT 59.048 36.000 0.00 0.00 0.00 1.28
1172 2432 6.095440 ACCAAGCAACAACCACTCATATATTC 59.905 38.462 0.00 0.00 0.00 1.75
1173 2433 6.095300 CCAAGCAACAACCACTCATATATTCA 59.905 38.462 0.00 0.00 0.00 2.57
1174 2434 6.683974 AGCAACAACCACTCATATATTCAC 57.316 37.500 0.00 0.00 0.00 3.18
1175 2435 6.179756 AGCAACAACCACTCATATATTCACA 58.820 36.000 0.00 0.00 0.00 3.58
1176 2436 6.094048 AGCAACAACCACTCATATATTCACAC 59.906 38.462 0.00 0.00 0.00 3.82
1177 2437 6.677920 GCAACAACCACTCATATATTCACACC 60.678 42.308 0.00 0.00 0.00 4.16
1178 2438 6.313519 ACAACCACTCATATATTCACACCT 57.686 37.500 0.00 0.00 0.00 4.00
1179 2439 6.349300 ACAACCACTCATATATTCACACCTC 58.651 40.000 0.00 0.00 0.00 3.85
1180 2440 6.156949 ACAACCACTCATATATTCACACCTCT 59.843 38.462 0.00 0.00 0.00 3.69
1181 2441 6.412362 ACCACTCATATATTCACACCTCTC 57.588 41.667 0.00 0.00 0.00 3.20
1182 2442 6.139671 ACCACTCATATATTCACACCTCTCT 58.860 40.000 0.00 0.00 0.00 3.10
1183 2443 6.266558 ACCACTCATATATTCACACCTCTCTC 59.733 42.308 0.00 0.00 0.00 3.20
1184 2444 6.266330 CCACTCATATATTCACACCTCTCTCA 59.734 42.308 0.00 0.00 0.00 3.27
1185 2445 7.201947 CCACTCATATATTCACACCTCTCTCAA 60.202 40.741 0.00 0.00 0.00 3.02
1186 2446 8.200120 CACTCATATATTCACACCTCTCTCAAA 58.800 37.037 0.00 0.00 0.00 2.69
1187 2447 8.932610 ACTCATATATTCACACCTCTCTCAAAT 58.067 33.333 0.00 0.00 0.00 2.32
1188 2448 9.421806 CTCATATATTCACACCTCTCTCAAATC 57.578 37.037 0.00 0.00 0.00 2.17
1189 2449 8.927411 TCATATATTCACACCTCTCTCAAATCA 58.073 33.333 0.00 0.00 0.00 2.57
1190 2450 9.551734 CATATATTCACACCTCTCTCAAATCAA 57.448 33.333 0.00 0.00 0.00 2.57
1191 2451 9.775854 ATATATTCACACCTCTCTCAAATCAAG 57.224 33.333 0.00 0.00 0.00 3.02
1192 2452 4.277515 TCACACCTCTCTCAAATCAAGG 57.722 45.455 0.00 0.00 0.00 3.61
1193 2453 3.903714 TCACACCTCTCTCAAATCAAGGA 59.096 43.478 0.00 0.00 0.00 3.36
1194 2454 4.347876 TCACACCTCTCTCAAATCAAGGAA 59.652 41.667 0.00 0.00 0.00 3.36
1195 2455 5.065914 CACACCTCTCTCAAATCAAGGAAA 58.934 41.667 0.00 0.00 0.00 3.13
1196 2456 5.180868 CACACCTCTCTCAAATCAAGGAAAG 59.819 44.000 0.00 0.00 0.00 2.62
1197 2457 4.699257 CACCTCTCTCAAATCAAGGAAAGG 59.301 45.833 0.00 0.00 0.00 3.11
1198 2458 4.599241 ACCTCTCTCAAATCAAGGAAAGGA 59.401 41.667 0.00 0.00 0.00 3.36
1199 2459 5.073691 ACCTCTCTCAAATCAAGGAAAGGAA 59.926 40.000 0.00 0.00 0.00 3.36
1200 2460 6.006449 CCTCTCTCAAATCAAGGAAAGGAAA 58.994 40.000 0.00 0.00 0.00 3.13
1201 2461 6.150809 CCTCTCTCAAATCAAGGAAAGGAAAG 59.849 42.308 0.00 0.00 0.00 2.62
1202 2462 6.841601 TCTCTCAAATCAAGGAAAGGAAAGA 58.158 36.000 0.00 0.00 0.00 2.52
1203 2463 7.465116 TCTCTCAAATCAAGGAAAGGAAAGAT 58.535 34.615 0.00 0.00 0.00 2.40
1204 2464 7.609532 TCTCTCAAATCAAGGAAAGGAAAGATC 59.390 37.037 0.00 0.00 0.00 2.75
1205 2465 7.233632 TCTCAAATCAAGGAAAGGAAAGATCA 58.766 34.615 0.00 0.00 0.00 2.92
1206 2466 7.725397 TCTCAAATCAAGGAAAGGAAAGATCAA 59.275 33.333 0.00 0.00 0.00 2.57
1207 2467 7.889469 TCAAATCAAGGAAAGGAAAGATCAAG 58.111 34.615 0.00 0.00 0.00 3.02
1208 2468 5.911378 ATCAAGGAAAGGAAAGATCAAGC 57.089 39.130 0.00 0.00 0.00 4.01
1209 2469 3.753272 TCAAGGAAAGGAAAGATCAAGCG 59.247 43.478 0.00 0.00 0.00 4.68
1210 2470 3.703001 AGGAAAGGAAAGATCAAGCGA 57.297 42.857 0.00 0.00 0.00 4.93
1211 2471 4.227864 AGGAAAGGAAAGATCAAGCGAT 57.772 40.909 0.00 0.00 33.31 4.58
1212 2472 4.593956 AGGAAAGGAAAGATCAAGCGATT 58.406 39.130 0.00 0.00 29.66 3.34
1213 2473 4.637977 AGGAAAGGAAAGATCAAGCGATTC 59.362 41.667 0.00 0.00 29.66 2.52
1214 2474 4.396166 GGAAAGGAAAGATCAAGCGATTCA 59.604 41.667 0.00 0.00 29.66 2.57
1215 2475 5.106157 GGAAAGGAAAGATCAAGCGATTCAA 60.106 40.000 0.00 0.00 29.66 2.69
1216 2476 6.405176 GGAAAGGAAAGATCAAGCGATTCAAT 60.405 38.462 0.00 0.00 29.66 2.57
1217 2477 5.496133 AGGAAAGATCAAGCGATTCAATG 57.504 39.130 0.00 0.00 29.66 2.82
1218 2478 4.337555 AGGAAAGATCAAGCGATTCAATGG 59.662 41.667 0.00 0.00 29.66 3.16
1219 2479 4.336433 GGAAAGATCAAGCGATTCAATGGA 59.664 41.667 0.00 0.00 29.66 3.41
1220 2480 5.009410 GGAAAGATCAAGCGATTCAATGGAT 59.991 40.000 0.00 0.00 29.66 3.41
1221 2481 5.686159 AAGATCAAGCGATTCAATGGATC 57.314 39.130 0.00 3.27 29.66 3.36
1222 2482 4.970711 AGATCAAGCGATTCAATGGATCT 58.029 39.130 7.22 7.22 36.20 2.75
1223 2483 4.755629 AGATCAAGCGATTCAATGGATCTG 59.244 41.667 11.12 0.00 38.72 2.90
1224 2484 3.208594 TCAAGCGATTCAATGGATCTGG 58.791 45.455 0.00 0.00 0.00 3.86
1225 2485 1.602311 AGCGATTCAATGGATCTGGC 58.398 50.000 0.00 0.00 0.00 4.85
1226 2486 1.134007 AGCGATTCAATGGATCTGGCA 60.134 47.619 0.00 0.00 0.00 4.92
1227 2487 1.677576 GCGATTCAATGGATCTGGCAA 59.322 47.619 0.00 0.00 0.00 4.52
1228 2488 2.542411 GCGATTCAATGGATCTGGCAAC 60.542 50.000 0.00 0.00 0.00 4.17
1229 2489 2.286595 CGATTCAATGGATCTGGCAACG 60.287 50.000 0.00 0.00 42.51 4.10
1231 2491 0.394216 TCAATGGATCTGGCAACGGG 60.394 55.000 0.00 0.00 45.79 5.28
1232 2492 0.680921 CAATGGATCTGGCAACGGGT 60.681 55.000 0.00 0.00 45.79 5.28
1233 2493 0.680921 AATGGATCTGGCAACGGGTG 60.681 55.000 0.00 0.00 45.79 4.61
1242 2502 2.034066 CAACGGGTGCCATGGTCT 59.966 61.111 14.67 0.00 0.00 3.85
1243 2503 2.040544 CAACGGGTGCCATGGTCTC 61.041 63.158 14.67 6.24 0.00 3.36
1244 2504 3.268103 AACGGGTGCCATGGTCTCC 62.268 63.158 14.67 14.90 0.00 3.71
1245 2505 4.489771 CGGGTGCCATGGTCTCCC 62.490 72.222 24.89 24.89 35.22 4.30
1246 2506 3.017581 GGGTGCCATGGTCTCCCT 61.018 66.667 26.31 0.00 35.63 4.20
1247 2507 2.592308 GGTGCCATGGTCTCCCTC 59.408 66.667 14.67 0.00 0.00 4.30
1248 2508 2.592308 GTGCCATGGTCTCCCTCC 59.408 66.667 14.67 0.00 0.00 4.30
1249 2509 1.997874 GTGCCATGGTCTCCCTCCT 60.998 63.158 14.67 0.00 0.00 3.69
1250 2510 1.690633 TGCCATGGTCTCCCTCCTC 60.691 63.158 14.67 0.00 0.00 3.71
1251 2511 2.447714 GCCATGGTCTCCCTCCTCC 61.448 68.421 14.67 0.00 0.00 4.30
1252 2512 1.768077 CCATGGTCTCCCTCCTCCC 60.768 68.421 2.57 0.00 0.00 4.30
1253 2513 1.768077 CATGGTCTCCCTCCTCCCC 60.768 68.421 0.00 0.00 0.00 4.81
1254 2514 2.264378 ATGGTCTCCCTCCTCCCCA 61.264 63.158 0.00 0.00 0.00 4.96
1255 2515 1.837533 ATGGTCTCCCTCCTCCCCAA 61.838 60.000 0.00 0.00 0.00 4.12
1256 2516 1.690985 GGTCTCCCTCCTCCCCAAG 60.691 68.421 0.00 0.00 0.00 3.61
1257 2517 2.041265 TCTCCCTCCTCCCCAAGC 59.959 66.667 0.00 0.00 0.00 4.01
1258 2518 2.041928 CTCCCTCCTCCCCAAGCT 59.958 66.667 0.00 0.00 0.00 3.74
1259 2519 1.228920 TCTCCCTCCTCCCCAAGCTA 61.229 60.000 0.00 0.00 0.00 3.32
1260 2520 0.326618 CTCCCTCCTCCCCAAGCTAA 60.327 60.000 0.00 0.00 0.00 3.09
1261 2521 0.326618 TCCCTCCTCCCCAAGCTAAG 60.327 60.000 0.00 0.00 0.00 2.18
1262 2522 1.529309 CCTCCTCCCCAAGCTAAGC 59.471 63.158 0.00 0.00 0.00 3.09
1263 2523 1.144936 CTCCTCCCCAAGCTAAGCG 59.855 63.158 0.00 0.00 0.00 4.68
1264 2524 1.305802 TCCTCCCCAAGCTAAGCGA 60.306 57.895 0.00 0.00 0.00 4.93
1265 2525 1.144936 CCTCCCCAAGCTAAGCGAG 59.855 63.158 0.00 0.00 0.00 5.03
1275 2535 3.657956 CTAAGCGAGCTCCTCAAGG 57.342 57.895 8.47 0.00 0.00 3.61
1276 2536 1.107114 CTAAGCGAGCTCCTCAAGGA 58.893 55.000 8.47 0.00 43.08 3.36
1287 2547 2.851798 CTCAAGGAGGAGCACAAGC 58.148 57.895 0.00 0.00 42.56 4.01
1297 2557 3.359002 GCACAAGCTGTCCAAGGG 58.641 61.111 0.00 0.00 37.91 3.95
1298 2558 2.924105 GCACAAGCTGTCCAAGGGC 61.924 63.158 0.00 0.00 37.91 5.19
1299 2559 2.281761 ACAAGCTGTCCAAGGGCG 60.282 61.111 0.00 0.00 0.00 6.13
1300 2560 2.281761 CAAGCTGTCCAAGGGCGT 60.282 61.111 0.00 0.00 0.00 5.68
1301 2561 2.032681 AAGCTGTCCAAGGGCGTC 59.967 61.111 0.00 0.00 0.00 5.19
1302 2562 2.818169 AAGCTGTCCAAGGGCGTCA 61.818 57.895 0.00 0.00 0.00 4.35
1303 2563 2.281484 GCTGTCCAAGGGCGTCAA 60.281 61.111 0.00 0.00 0.00 3.18
1304 2564 2.328099 GCTGTCCAAGGGCGTCAAG 61.328 63.158 0.00 0.00 0.00 3.02
1305 2565 1.371183 CTGTCCAAGGGCGTCAAGA 59.629 57.895 0.00 0.00 0.00 3.02
1306 2566 0.250295 CTGTCCAAGGGCGTCAAGAA 60.250 55.000 0.00 0.00 0.00 2.52
1307 2567 0.181587 TGTCCAAGGGCGTCAAGAAA 59.818 50.000 0.00 0.00 0.00 2.52
1308 2568 0.875059 GTCCAAGGGCGTCAAGAAAG 59.125 55.000 0.00 0.00 0.00 2.62
1309 2569 0.762418 TCCAAGGGCGTCAAGAAAGA 59.238 50.000 0.00 0.00 0.00 2.52
1310 2570 0.875059 CCAAGGGCGTCAAGAAAGAC 59.125 55.000 0.00 0.00 35.19 3.01
1321 2581 5.720261 GTCAAGAAAGACGTTGAGTTTCT 57.280 39.130 9.20 9.20 41.29 2.52
1322 2582 5.729262 GTCAAGAAAGACGTTGAGTTTCTC 58.271 41.667 13.29 0.00 39.15 2.87
1323 2583 5.520649 GTCAAGAAAGACGTTGAGTTTCTCT 59.479 40.000 13.29 5.34 39.15 3.10
1324 2584 5.749109 TCAAGAAAGACGTTGAGTTTCTCTC 59.251 40.000 13.29 0.00 39.15 3.20
1338 2598 4.004348 TCTCACGAGAGCTGACCC 57.996 61.111 4.83 0.00 41.81 4.46
1339 2599 1.074951 TCTCACGAGAGCTGACCCA 59.925 57.895 4.83 0.00 41.81 4.51
1340 2600 1.214062 CTCACGAGAGCTGACCCAC 59.786 63.158 0.00 0.00 34.61 4.61
1341 2601 1.527433 CTCACGAGAGCTGACCCACA 61.527 60.000 0.00 0.00 34.61 4.17
1342 2602 0.900182 TCACGAGAGCTGACCCACAT 60.900 55.000 0.00 0.00 0.00 3.21
1343 2603 0.738762 CACGAGAGCTGACCCACATG 60.739 60.000 0.00 0.00 0.00 3.21
1344 2604 1.812922 CGAGAGCTGACCCACATGC 60.813 63.158 0.00 0.00 0.00 4.06
1345 2605 1.297689 GAGAGCTGACCCACATGCA 59.702 57.895 0.00 0.00 0.00 3.96
1346 2606 0.107312 GAGAGCTGACCCACATGCAT 60.107 55.000 0.00 0.00 0.00 3.96
1347 2607 0.393944 AGAGCTGACCCACATGCATG 60.394 55.000 25.09 25.09 0.00 4.06
1348 2608 0.679002 GAGCTGACCCACATGCATGT 60.679 55.000 26.61 26.61 42.84 3.21
1349 2609 0.679002 AGCTGACCCACATGCATGTC 60.679 55.000 29.23 18.12 39.39 3.06
1350 2610 1.985447 GCTGACCCACATGCATGTCG 61.985 60.000 29.23 22.66 39.39 4.35
1351 2611 1.985447 CTGACCCACATGCATGTCGC 61.985 60.000 29.23 17.73 39.39 5.19
1352 2612 2.751436 ACCCACATGCATGTCGCC 60.751 61.111 29.23 0.00 39.39 5.54
1353 2613 3.520862 CCCACATGCATGTCGCCC 61.521 66.667 29.23 0.00 39.39 6.13
1354 2614 2.438975 CCACATGCATGTCGCCCT 60.439 61.111 29.23 4.20 39.39 5.19
1355 2615 1.153188 CCACATGCATGTCGCCCTA 60.153 57.895 29.23 0.00 39.39 3.53
1356 2616 1.439353 CCACATGCATGTCGCCCTAC 61.439 60.000 29.23 0.00 39.39 3.18
1357 2617 0.744057 CACATGCATGTCGCCCTACA 60.744 55.000 29.23 0.00 39.39 2.74
1358 2618 0.744414 ACATGCATGTCGCCCTACAC 60.744 55.000 26.61 0.00 41.33 2.90
1359 2619 0.744057 CATGCATGTCGCCCTACACA 60.744 55.000 18.91 0.00 41.33 3.72
1360 2620 0.035534 ATGCATGTCGCCCTACACAA 60.036 50.000 0.00 0.00 41.33 3.33
1361 2621 0.673333 TGCATGTCGCCCTACACAAG 60.673 55.000 0.00 0.00 41.33 3.16
1362 2622 1.369091 GCATGTCGCCCTACACAAGG 61.369 60.000 0.00 0.00 46.09 3.61
1363 2623 0.036388 CATGTCGCCCTACACAAGGT 60.036 55.000 0.00 0.00 44.90 3.50
1364 2624 0.249398 ATGTCGCCCTACACAAGGTC 59.751 55.000 0.00 0.00 44.90 3.85
1366 2626 1.904865 TCGCCCTACACAAGGTCGT 60.905 57.895 0.00 0.00 46.84 4.34
1367 2627 1.736645 CGCCCTACACAAGGTCGTG 60.737 63.158 0.00 0.00 41.86 4.35
1368 2628 1.669440 GCCCTACACAAGGTCGTGA 59.331 57.895 0.00 0.00 44.90 4.35
1369 2629 0.389948 GCCCTACACAAGGTCGTGAG 60.390 60.000 0.00 0.00 44.90 3.51
1370 2630 0.246635 CCCTACACAAGGTCGTGAGG 59.753 60.000 0.00 1.22 44.90 3.86
1371 2631 0.246635 CCTACACAAGGTCGTGAGGG 59.753 60.000 0.00 0.00 40.94 4.30
1372 2632 0.966920 CTACACAAGGTCGTGAGGGT 59.033 55.000 0.00 0.00 39.34 4.34
1373 2633 0.677288 TACACAAGGTCGTGAGGGTG 59.323 55.000 0.00 0.00 39.34 4.61
1374 2634 1.961277 CACAAGGTCGTGAGGGTGC 60.961 63.158 0.00 0.00 39.34 5.01
1375 2635 2.358737 CAAGGTCGTGAGGGTGCC 60.359 66.667 0.00 0.00 0.00 5.01
1376 2636 2.847234 AAGGTCGTGAGGGTGCCA 60.847 61.111 0.00 0.00 0.00 4.92
1377 2637 3.178540 AAGGTCGTGAGGGTGCCAC 62.179 63.158 0.00 0.00 0.00 5.01
1378 2638 3.936203 GGTCGTGAGGGTGCCACA 61.936 66.667 0.00 0.00 34.36 4.17
1379 2639 2.347490 GTCGTGAGGGTGCCACAT 59.653 61.111 0.00 0.00 34.36 3.21
1380 2640 2.034879 GTCGTGAGGGTGCCACATG 61.035 63.158 0.00 0.00 33.47 3.21
1381 2641 2.213513 TCGTGAGGGTGCCACATGA 61.214 57.895 0.00 0.00 37.69 3.07
1382 2642 2.034879 CGTGAGGGTGCCACATGAC 61.035 63.158 0.00 0.00 33.91 3.06
1383 2643 1.675641 GTGAGGGTGCCACATGACC 60.676 63.158 0.00 0.00 34.81 4.02
1384 2644 2.152729 TGAGGGTGCCACATGACCA 61.153 57.895 0.00 0.00 33.48 4.02
1385 2645 1.074775 GAGGGTGCCACATGACCAA 59.925 57.895 0.00 0.00 33.48 3.67
1386 2646 0.962356 GAGGGTGCCACATGACCAAG 60.962 60.000 0.00 0.00 33.48 3.61
1387 2647 1.074775 GGGTGCCACATGACCAAGA 59.925 57.895 0.00 0.00 33.48 3.02
1388 2648 0.962356 GGGTGCCACATGACCAAGAG 60.962 60.000 0.00 0.00 33.48 2.85
1389 2649 1.589716 GGTGCCACATGACCAAGAGC 61.590 60.000 0.00 0.00 31.97 4.09
1390 2650 0.607489 GTGCCACATGACCAAGAGCT 60.607 55.000 0.00 0.00 0.00 4.09
1391 2651 0.111061 TGCCACATGACCAAGAGCTT 59.889 50.000 0.00 0.00 0.00 3.74
1392 2652 1.350684 TGCCACATGACCAAGAGCTTA 59.649 47.619 0.00 0.00 0.00 3.09
1393 2653 2.025981 TGCCACATGACCAAGAGCTTAT 60.026 45.455 0.00 0.00 0.00 1.73
1394 2654 2.615912 GCCACATGACCAAGAGCTTATC 59.384 50.000 0.00 0.00 0.00 1.75
1395 2655 2.868583 CCACATGACCAAGAGCTTATCG 59.131 50.000 0.00 0.00 0.00 2.92
1396 2656 2.868583 CACATGACCAAGAGCTTATCGG 59.131 50.000 0.00 0.00 0.00 4.18
1397 2657 2.158900 ACATGACCAAGAGCTTATCGGG 60.159 50.000 0.00 0.00 34.48 5.14
1398 2658 0.830648 TGACCAAGAGCTTATCGGGG 59.169 55.000 0.00 0.00 33.08 5.73
1399 2659 1.120530 GACCAAGAGCTTATCGGGGA 58.879 55.000 0.00 0.00 33.08 4.81
1400 2660 1.069358 GACCAAGAGCTTATCGGGGAG 59.931 57.143 0.00 0.00 33.08 4.30
1401 2661 0.394565 CCAAGAGCTTATCGGGGAGG 59.605 60.000 0.00 0.00 0.00 4.30
1402 2662 1.123928 CAAGAGCTTATCGGGGAGGT 58.876 55.000 0.00 0.00 0.00 3.85
1403 2663 1.069358 CAAGAGCTTATCGGGGAGGTC 59.931 57.143 0.00 0.00 39.92 3.85
1404 2664 0.261991 AGAGCTTATCGGGGAGGTCA 59.738 55.000 12.22 0.00 41.56 4.02
1405 2665 1.120530 GAGCTTATCGGGGAGGTCAA 58.879 55.000 0.00 0.00 39.53 3.18
1406 2666 1.069358 GAGCTTATCGGGGAGGTCAAG 59.931 57.143 0.00 0.00 39.53 3.02
1407 2667 0.533085 GCTTATCGGGGAGGTCAAGC 60.533 60.000 0.00 0.00 32.51 4.01
1408 2668 1.123928 CTTATCGGGGAGGTCAAGCT 58.876 55.000 0.00 0.00 0.00 3.74
1409 2669 1.069358 CTTATCGGGGAGGTCAAGCTC 59.931 57.143 0.54 0.54 0.00 4.09
1410 2670 0.261991 TATCGGGGAGGTCAAGCTCT 59.738 55.000 8.93 0.00 0.00 4.09
1411 2671 1.333636 ATCGGGGAGGTCAAGCTCTG 61.334 60.000 8.93 0.98 0.00 3.35
1412 2672 2.993853 GGGGAGGTCAAGCTCTGG 59.006 66.667 8.93 0.00 0.00 3.86
1413 2673 2.674220 GGGGAGGTCAAGCTCTGGG 61.674 68.421 8.93 0.00 0.00 4.45
1414 2674 2.270527 GGAGGTCAAGCTCTGGGC 59.729 66.667 8.93 0.00 42.19 5.36
1415 2675 2.270527 GAGGTCAAGCTCTGGGCC 59.729 66.667 0.00 0.00 43.05 5.80
1416 2676 3.672295 GAGGTCAAGCTCTGGGCCG 62.672 68.421 0.00 0.00 43.05 6.13
1417 2677 3.706373 GGTCAAGCTCTGGGCCGA 61.706 66.667 0.00 0.00 43.05 5.54
1418 2678 2.435059 GTCAAGCTCTGGGCCGAC 60.435 66.667 0.00 0.00 43.05 4.79
1419 2679 4.069232 TCAAGCTCTGGGCCGACG 62.069 66.667 0.00 0.00 43.05 5.12
1420 2680 4.069232 CAAGCTCTGGGCCGACGA 62.069 66.667 0.00 0.00 43.05 4.20
1421 2681 4.070552 AAGCTCTGGGCCGACGAC 62.071 66.667 0.00 0.00 43.05 4.34
1438 2698 3.066190 CGCCAGGGAGGTGTCGTA 61.066 66.667 0.00 0.00 43.15 3.43
1439 2699 2.423898 CGCCAGGGAGGTGTCGTAT 61.424 63.158 0.00 0.00 43.15 3.06
1440 2700 1.144057 GCCAGGGAGGTGTCGTATG 59.856 63.158 0.00 0.00 40.61 2.39
1441 2701 1.327690 GCCAGGGAGGTGTCGTATGA 61.328 60.000 0.00 0.00 40.61 2.15
1442 2702 0.747255 CCAGGGAGGTGTCGTATGAG 59.253 60.000 0.00 0.00 0.00 2.90
1443 2703 1.685180 CCAGGGAGGTGTCGTATGAGA 60.685 57.143 0.00 0.00 0.00 3.27
1444 2704 2.311463 CAGGGAGGTGTCGTATGAGAT 58.689 52.381 0.00 0.00 0.00 2.75
1445 2705 2.035193 CAGGGAGGTGTCGTATGAGATG 59.965 54.545 0.00 0.00 0.00 2.90
1446 2706 1.341531 GGGAGGTGTCGTATGAGATGG 59.658 57.143 0.00 0.00 0.00 3.51
1447 2707 2.307768 GGAGGTGTCGTATGAGATGGA 58.692 52.381 0.00 0.00 0.00 3.41
1448 2708 2.294791 GGAGGTGTCGTATGAGATGGAG 59.705 54.545 0.00 0.00 0.00 3.86
1449 2709 2.294791 GAGGTGTCGTATGAGATGGAGG 59.705 54.545 0.00 0.00 0.00 4.30
1450 2710 2.091830 AGGTGTCGTATGAGATGGAGGA 60.092 50.000 0.00 0.00 0.00 3.71
1451 2711 2.894126 GGTGTCGTATGAGATGGAGGAT 59.106 50.000 0.00 0.00 0.00 3.24
1452 2712 4.079970 GGTGTCGTATGAGATGGAGGATA 58.920 47.826 0.00 0.00 0.00 2.59
1453 2713 4.707448 GGTGTCGTATGAGATGGAGGATAT 59.293 45.833 0.00 0.00 0.00 1.63
1454 2714 5.163602 GGTGTCGTATGAGATGGAGGATATC 60.164 48.000 0.00 0.00 0.00 1.63
1455 2715 5.416013 GTGTCGTATGAGATGGAGGATATCA 59.584 44.000 4.83 0.00 36.72 2.15
1456 2716 6.096141 GTGTCGTATGAGATGGAGGATATCAT 59.904 42.308 4.83 0.00 43.85 2.45
1457 2717 6.319911 TGTCGTATGAGATGGAGGATATCATC 59.680 42.308 8.89 8.89 41.26 2.92
1458 2718 5.529060 TCGTATGAGATGGAGGATATCATCG 59.471 44.000 11.02 0.00 41.26 3.84
1459 2719 5.529060 CGTATGAGATGGAGGATATCATCGA 59.471 44.000 11.02 7.88 41.26 3.59
1460 2720 6.206438 CGTATGAGATGGAGGATATCATCGAT 59.794 42.308 13.74 13.74 41.26 3.59
1461 2721 7.389053 CGTATGAGATGGAGGATATCATCGATA 59.611 40.741 13.82 1.12 41.26 2.92
1462 2722 7.764141 ATGAGATGGAGGATATCATCGATAG 57.236 40.000 13.82 0.00 38.41 2.08
1463 2723 5.534278 TGAGATGGAGGATATCATCGATAGC 59.466 44.000 13.82 9.86 43.13 2.97
1464 2724 5.704354 AGATGGAGGATATCATCGATAGCT 58.296 41.667 13.82 6.37 43.13 3.32
1465 2725 6.135454 AGATGGAGGATATCATCGATAGCTT 58.865 40.000 13.82 0.00 43.13 3.74
1466 2726 5.843673 TGGAGGATATCATCGATAGCTTC 57.156 43.478 11.02 3.54 36.67 3.86
1467 2727 5.195001 GGAGGATATCATCGATAGCTTCC 57.805 47.826 12.72 12.72 45.06 3.46
1468 2728 4.892934 GGAGGATATCATCGATAGCTTCCT 59.107 45.833 18.08 15.25 46.52 3.36
1469 2729 5.221224 GGAGGATATCATCGATAGCTTCCTG 60.221 48.000 18.08 0.00 46.52 3.86
1470 2730 4.648762 AGGATATCATCGATAGCTTCCTGG 59.351 45.833 14.80 0.00 33.12 4.45
1471 2731 4.404073 GGATATCATCGATAGCTTCCTGGT 59.596 45.833 4.83 0.00 32.33 4.00
1472 2732 3.674528 ATCATCGATAGCTTCCTGGTG 57.325 47.619 0.00 0.00 0.00 4.17
1473 2733 1.069204 TCATCGATAGCTTCCTGGTGC 59.931 52.381 0.00 6.38 0.00 5.01
1474 2734 0.394565 ATCGATAGCTTCCTGGTGCC 59.605 55.000 0.00 0.00 0.00 5.01
1475 2735 0.975556 TCGATAGCTTCCTGGTGCCA 60.976 55.000 0.00 0.00 0.00 4.92
1476 2736 0.811616 CGATAGCTTCCTGGTGCCAC 60.812 60.000 0.00 0.00 0.00 5.01
1477 2737 0.464554 GATAGCTTCCTGGTGCCACC 60.465 60.000 7.01 7.01 39.22 4.61
1478 2738 0.916358 ATAGCTTCCTGGTGCCACCT 60.916 55.000 16.23 0.00 39.58 4.00
1479 2739 1.841302 TAGCTTCCTGGTGCCACCTG 61.841 60.000 16.23 14.73 39.58 4.00
1480 2740 2.839098 CTTCCTGGTGCCACCTGT 59.161 61.111 16.23 0.00 39.58 4.00
1481 2741 1.151450 CTTCCTGGTGCCACCTGTT 59.849 57.895 16.23 0.00 39.58 3.16
1482 2742 1.152777 TTCCTGGTGCCACCTGTTG 60.153 57.895 16.23 3.12 39.58 3.33
1483 2743 1.640593 TTCCTGGTGCCACCTGTTGA 61.641 55.000 16.23 5.57 39.58 3.18
1484 2744 1.898574 CCTGGTGCCACCTGTTGAC 60.899 63.158 16.23 0.00 39.58 3.18
1485 2745 1.152984 CTGGTGCCACCTGTTGACA 60.153 57.895 16.23 0.00 39.58 3.58
1486 2746 1.152984 TGGTGCCACCTGTTGACAG 60.153 57.895 16.23 4.15 39.58 3.51
1487 2747 2.555547 GGTGCCACCTGTTGACAGC 61.556 63.158 6.63 0.00 42.47 4.40
1488 2748 1.526917 GTGCCACCTGTTGACAGCT 60.527 57.895 5.62 0.00 42.47 4.24
1489 2749 1.227943 TGCCACCTGTTGACAGCTC 60.228 57.895 5.62 0.00 42.47 4.09
1490 2750 1.072159 GCCACCTGTTGACAGCTCT 59.928 57.895 5.62 0.00 42.47 4.09
1491 2751 1.233285 GCCACCTGTTGACAGCTCTG 61.233 60.000 5.62 0.00 42.47 3.35
1492 2752 1.233285 CCACCTGTTGACAGCTCTGC 61.233 60.000 5.62 0.00 42.47 4.26
1493 2753 1.301244 ACCTGTTGACAGCTCTGCG 60.301 57.895 5.62 0.00 42.47 5.18
1494 2754 2.675056 CCTGTTGACAGCTCTGCGC 61.675 63.158 0.00 0.00 42.47 6.09
1495 2755 2.666190 TGTTGACAGCTCTGCGCC 60.666 61.111 4.18 0.00 40.39 6.53
1496 2756 3.426568 GTTGACAGCTCTGCGCCC 61.427 66.667 4.18 0.00 40.39 6.13
1504 2764 4.519437 CTCTGCGCCCGCTGATGA 62.519 66.667 19.70 9.44 45.43 2.92
1505 2765 4.819761 TCTGCGCCCGCTGATGAC 62.820 66.667 16.42 0.00 42.61 3.06
1512 2772 4.758251 CCGCTGATGACCCGCACA 62.758 66.667 0.00 0.00 0.00 4.57
1513 2773 3.490759 CGCTGATGACCCGCACAC 61.491 66.667 0.00 0.00 0.00 3.82
1514 2774 2.358615 GCTGATGACCCGCACACA 60.359 61.111 0.00 0.00 0.00 3.72
1515 2775 2.680913 GCTGATGACCCGCACACAC 61.681 63.158 0.00 0.00 0.00 3.82
1516 2776 2.356913 TGATGACCCGCACACACG 60.357 61.111 0.00 0.00 0.00 4.49
1524 2784 2.712539 CGCACACACGGCTCAAAA 59.287 55.556 0.00 0.00 0.00 2.44
1525 2785 1.369209 CGCACACACGGCTCAAAAG 60.369 57.895 0.00 0.00 0.00 2.27
1526 2786 1.008538 GCACACACGGCTCAAAAGG 60.009 57.895 0.00 0.00 0.00 3.11
1527 2787 1.444119 GCACACACGGCTCAAAAGGA 61.444 55.000 0.00 0.00 0.00 3.36
1528 2788 1.238439 CACACACGGCTCAAAAGGAT 58.762 50.000 0.00 0.00 0.00 3.24
1529 2789 1.197721 CACACACGGCTCAAAAGGATC 59.802 52.381 0.00 0.00 0.00 3.36
1530 2790 1.202758 ACACACGGCTCAAAAGGATCA 60.203 47.619 0.00 0.00 0.00 2.92
1531 2791 1.197721 CACACGGCTCAAAAGGATCAC 59.802 52.381 0.00 0.00 0.00 3.06
1532 2792 0.804989 CACGGCTCAAAAGGATCACC 59.195 55.000 0.00 0.00 0.00 4.02
1533 2793 0.400213 ACGGCTCAAAAGGATCACCA 59.600 50.000 0.00 0.00 38.94 4.17
1534 2794 1.202879 ACGGCTCAAAAGGATCACCAA 60.203 47.619 0.00 0.00 38.94 3.67
1535 2795 1.470098 CGGCTCAAAAGGATCACCAAG 59.530 52.381 0.00 0.00 38.94 3.61
1536 2796 2.795329 GGCTCAAAAGGATCACCAAGA 58.205 47.619 0.00 0.00 38.94 3.02
1537 2797 3.157087 GGCTCAAAAGGATCACCAAGAA 58.843 45.455 0.00 0.00 38.94 2.52
1538 2798 3.192212 GGCTCAAAAGGATCACCAAGAAG 59.808 47.826 0.00 0.00 38.94 2.85
1539 2799 4.074970 GCTCAAAAGGATCACCAAGAAGA 58.925 43.478 0.00 0.00 38.94 2.87
1540 2800 4.704057 GCTCAAAAGGATCACCAAGAAGAT 59.296 41.667 0.00 0.00 38.94 2.40
1541 2801 5.392811 GCTCAAAAGGATCACCAAGAAGATG 60.393 44.000 0.00 0.00 38.94 2.90
1542 2802 5.012239 TCAAAAGGATCACCAAGAAGATGG 58.988 41.667 0.00 0.00 46.38 3.51
1543 2803 2.725221 AGGATCACCAAGAAGATGGC 57.275 50.000 0.00 0.00 44.75 4.40
1544 2804 1.213926 AGGATCACCAAGAAGATGGCC 59.786 52.381 0.00 0.00 44.75 5.36
1545 2805 1.064463 GGATCACCAAGAAGATGGCCA 60.064 52.381 8.56 8.56 44.75 5.36
1546 2806 2.621407 GGATCACCAAGAAGATGGCCAA 60.621 50.000 10.96 0.00 44.75 4.52
1547 2807 2.673775 TCACCAAGAAGATGGCCAAA 57.326 45.000 10.96 0.00 44.75 3.28
1548 2808 3.173953 TCACCAAGAAGATGGCCAAAT 57.826 42.857 10.96 0.00 44.75 2.32
1549 2809 3.509442 TCACCAAGAAGATGGCCAAATT 58.491 40.909 10.96 7.68 44.75 1.82
1550 2810 3.258872 TCACCAAGAAGATGGCCAAATTG 59.741 43.478 10.96 10.46 44.75 2.32
1551 2811 3.007182 CACCAAGAAGATGGCCAAATTGT 59.993 43.478 10.96 2.83 44.75 2.71
1552 2812 3.647590 ACCAAGAAGATGGCCAAATTGTT 59.352 39.130 10.96 9.80 44.75 2.83
1553 2813 4.248058 CCAAGAAGATGGCCAAATTGTTC 58.752 43.478 10.96 8.20 32.78 3.18
1554 2814 4.262549 CCAAGAAGATGGCCAAATTGTTCA 60.263 41.667 10.96 0.00 32.78 3.18
1555 2815 5.299148 CAAGAAGATGGCCAAATTGTTCAA 58.701 37.500 10.96 0.00 0.00 2.69
1556 2816 5.143376 AGAAGATGGCCAAATTGTTCAAG 57.857 39.130 10.96 0.00 0.00 3.02
1557 2817 4.834496 AGAAGATGGCCAAATTGTTCAAGA 59.166 37.500 10.96 0.00 0.00 3.02
1558 2818 5.305128 AGAAGATGGCCAAATTGTTCAAGAA 59.695 36.000 10.96 0.00 0.00 2.52
1559 2819 5.549742 AGATGGCCAAATTGTTCAAGAAA 57.450 34.783 10.96 0.00 0.00 2.52
1560 2820 5.544650 AGATGGCCAAATTGTTCAAGAAAG 58.455 37.500 10.96 0.00 0.00 2.62
1561 2821 5.305128 AGATGGCCAAATTGTTCAAGAAAGA 59.695 36.000 10.96 0.00 0.00 2.52
1562 2822 4.692228 TGGCCAAATTGTTCAAGAAAGAC 58.308 39.130 0.61 0.00 0.00 3.01
1563 2823 4.161189 TGGCCAAATTGTTCAAGAAAGACA 59.839 37.500 0.61 0.00 0.00 3.41
1564 2824 5.115480 GGCCAAATTGTTCAAGAAAGACAA 58.885 37.500 0.00 0.00 0.00 3.18
1565 2825 5.234972 GGCCAAATTGTTCAAGAAAGACAAG 59.765 40.000 0.00 0.00 0.00 3.16
1566 2826 6.042143 GCCAAATTGTTCAAGAAAGACAAGA 58.958 36.000 0.00 0.00 0.00 3.02
1567 2827 6.019559 GCCAAATTGTTCAAGAAAGACAAGAC 60.020 38.462 0.00 0.00 0.00 3.01
1568 2828 6.476706 CCAAATTGTTCAAGAAAGACAAGACC 59.523 38.462 0.00 0.00 0.00 3.85
1569 2829 5.774498 ATTGTTCAAGAAAGACAAGACCC 57.226 39.130 0.00 0.00 0.00 4.46
1570 2830 3.202906 TGTTCAAGAAAGACAAGACCCG 58.797 45.455 0.00 0.00 0.00 5.28
1571 2831 3.203716 GTTCAAGAAAGACAAGACCCGT 58.796 45.455 0.00 0.00 0.00 5.28
1572 2832 2.833794 TCAAGAAAGACAAGACCCGTG 58.166 47.619 0.00 0.00 0.00 4.94
1573 2833 2.432874 TCAAGAAAGACAAGACCCGTGA 59.567 45.455 0.00 0.00 0.00 4.35
1574 2834 3.071023 TCAAGAAAGACAAGACCCGTGAT 59.929 43.478 0.00 0.00 0.00 3.06
1575 2835 3.320673 AGAAAGACAAGACCCGTGATC 57.679 47.619 0.00 0.00 0.00 2.92
1576 2836 2.632996 AGAAAGACAAGACCCGTGATCA 59.367 45.455 0.00 0.00 0.00 2.92
1577 2837 2.751166 AAGACAAGACCCGTGATCAG 57.249 50.000 0.00 0.00 0.00 2.90
1578 2838 1.633774 AGACAAGACCCGTGATCAGT 58.366 50.000 0.00 0.00 0.00 3.41
1579 2839 1.971357 AGACAAGACCCGTGATCAGTT 59.029 47.619 0.00 0.00 0.00 3.16
1580 2840 2.069273 GACAAGACCCGTGATCAGTTG 58.931 52.381 0.00 0.00 0.00 3.16
1581 2841 1.270839 ACAAGACCCGTGATCAGTTGG 60.271 52.381 0.00 0.00 0.00 3.77
1582 2842 1.056660 AAGACCCGTGATCAGTTGGT 58.943 50.000 9.82 9.82 0.00 3.67
1583 2843 0.608640 AGACCCGTGATCAGTTGGTC 59.391 55.000 22.13 22.13 44.64 4.02
1584 2844 0.736325 GACCCGTGATCAGTTGGTCG 60.736 60.000 17.70 7.99 36.47 4.79
1585 2845 2.100631 CCCGTGATCAGTTGGTCGC 61.101 63.158 0.00 0.00 0.00 5.19
1586 2846 2.100631 CCGTGATCAGTTGGTCGCC 61.101 63.158 0.00 0.00 0.00 5.54
1587 2847 2.444624 CGTGATCAGTTGGTCGCCG 61.445 63.158 0.00 0.00 0.00 6.46
1588 2848 1.080093 GTGATCAGTTGGTCGCCGA 60.080 57.895 0.00 0.00 0.00 5.54
1589 2849 0.460284 GTGATCAGTTGGTCGCCGAT 60.460 55.000 0.00 0.00 0.00 4.18
1590 2850 0.460109 TGATCAGTTGGTCGCCGATG 60.460 55.000 0.00 0.00 0.00 3.84
1591 2851 1.766143 GATCAGTTGGTCGCCGATGC 61.766 60.000 0.00 0.00 0.00 3.91
1592 2852 3.499737 CAGTTGGTCGCCGATGCC 61.500 66.667 0.00 0.00 0.00 4.40
1593 2853 4.015406 AGTTGGTCGCCGATGCCA 62.015 61.111 0.00 0.00 0.00 4.92
1594 2854 2.824041 GTTGGTCGCCGATGCCAT 60.824 61.111 0.00 0.00 31.71 4.40
1595 2855 2.513666 TTGGTCGCCGATGCCATC 60.514 61.111 0.00 0.00 31.71 3.51
1596 2856 3.322318 TTGGTCGCCGATGCCATCA 62.322 57.895 5.40 0.00 31.71 3.07
1597 2857 2.513666 GGTCGCCGATGCCATCAA 60.514 61.111 5.40 0.00 0.00 2.57
1598 2858 2.112198 GGTCGCCGATGCCATCAAA 61.112 57.895 5.40 0.00 0.00 2.69
1599 2859 1.353103 GTCGCCGATGCCATCAAAG 59.647 57.895 5.40 0.00 0.00 2.77
1600 2860 1.089481 GTCGCCGATGCCATCAAAGA 61.089 55.000 5.40 0.00 0.00 2.52
1601 2861 1.089481 TCGCCGATGCCATCAAAGAC 61.089 55.000 5.40 0.00 0.00 3.01
1602 2862 1.368345 CGCCGATGCCATCAAAGACA 61.368 55.000 5.40 0.00 0.00 3.41
1603 2863 1.027357 GCCGATGCCATCAAAGACAT 58.973 50.000 5.40 0.00 0.00 3.06
1604 2864 1.002033 GCCGATGCCATCAAAGACATC 60.002 52.381 5.40 0.00 36.42 3.06
1605 2865 2.291365 CCGATGCCATCAAAGACATCA 58.709 47.619 5.40 0.00 39.06 3.07
1606 2866 2.684374 CCGATGCCATCAAAGACATCAA 59.316 45.455 5.40 0.00 39.06 2.57
1607 2867 3.242969 CCGATGCCATCAAAGACATCAAG 60.243 47.826 5.40 0.00 39.06 3.02
1608 2868 3.242969 CGATGCCATCAAAGACATCAAGG 60.243 47.826 5.40 0.00 39.06 3.61
1609 2869 3.438216 TGCCATCAAAGACATCAAGGA 57.562 42.857 0.00 0.00 0.00 3.36
1610 2870 3.084039 TGCCATCAAAGACATCAAGGAC 58.916 45.455 0.00 0.00 0.00 3.85
1611 2871 3.084039 GCCATCAAAGACATCAAGGACA 58.916 45.455 0.00 0.00 0.00 4.02
1612 2872 3.507233 GCCATCAAAGACATCAAGGACAA 59.493 43.478 0.00 0.00 0.00 3.18
1613 2873 4.380233 GCCATCAAAGACATCAAGGACAAG 60.380 45.833 0.00 0.00 0.00 3.16
1614 2874 4.157289 CCATCAAAGACATCAAGGACAAGG 59.843 45.833 0.00 0.00 0.00 3.61
1615 2875 4.437682 TCAAAGACATCAAGGACAAGGT 57.562 40.909 0.00 0.00 0.00 3.50
1616 2876 4.389374 TCAAAGACATCAAGGACAAGGTC 58.611 43.478 0.00 0.00 0.00 3.85
1627 2887 2.171341 GACAAGGTCCAGAAGGTGTC 57.829 55.000 0.00 0.00 32.27 3.67
1628 2888 0.765510 ACAAGGTCCAGAAGGTGTCC 59.234 55.000 0.00 0.00 35.89 4.02
1629 2889 0.320771 CAAGGTCCAGAAGGTGTCCG 60.321 60.000 0.00 0.00 35.89 4.79
1630 2890 0.471211 AAGGTCCAGAAGGTGTCCGA 60.471 55.000 0.00 0.00 35.89 4.55
1631 2891 1.186267 AGGTCCAGAAGGTGTCCGAC 61.186 60.000 0.00 0.00 35.89 4.79
1632 2892 1.292541 GTCCAGAAGGTGTCCGACC 59.707 63.158 0.00 0.00 46.58 4.79
1640 2900 2.987547 GTGTCCGACCGACCAGGA 60.988 66.667 0.00 0.00 45.00 3.86
1641 2901 2.203523 TGTCCGACCGACCAGGAA 60.204 61.111 0.00 0.00 45.00 3.36
1642 2902 2.273179 TGTCCGACCGACCAGGAAG 61.273 63.158 0.00 0.00 45.00 3.46
1643 2903 1.975407 GTCCGACCGACCAGGAAGA 60.975 63.158 0.00 0.00 45.00 2.87
1644 2904 1.000019 TCCGACCGACCAGGAAGAT 60.000 57.895 0.00 0.00 45.00 2.40
1645 2905 0.256752 TCCGACCGACCAGGAAGATA 59.743 55.000 0.00 0.00 45.00 1.98
1646 2906 1.133575 TCCGACCGACCAGGAAGATAT 60.134 52.381 0.00 0.00 45.00 1.63
1647 2907 1.000163 CCGACCGACCAGGAAGATATG 60.000 57.143 0.00 0.00 45.00 1.78
1648 2908 1.954382 CGACCGACCAGGAAGATATGA 59.046 52.381 0.00 0.00 45.00 2.15
1649 2909 2.558795 CGACCGACCAGGAAGATATGAT 59.441 50.000 0.00 0.00 45.00 2.45
1650 2910 3.612717 CGACCGACCAGGAAGATATGATG 60.613 52.174 0.00 0.00 45.00 3.07
1651 2911 3.309296 ACCGACCAGGAAGATATGATGT 58.691 45.455 0.00 0.00 45.00 3.06
1652 2912 3.711704 ACCGACCAGGAAGATATGATGTT 59.288 43.478 0.00 0.00 45.00 2.71
1653 2913 4.060900 CCGACCAGGAAGATATGATGTTG 58.939 47.826 0.00 0.00 45.00 3.33
1654 2914 3.496130 CGACCAGGAAGATATGATGTTGC 59.504 47.826 0.00 0.00 0.00 4.17
1655 2915 4.712476 GACCAGGAAGATATGATGTTGCT 58.288 43.478 0.00 0.00 34.59 3.91
1656 2916 4.458397 ACCAGGAAGATATGATGTTGCTG 58.542 43.478 9.88 9.88 46.68 4.41
1657 2917 3.252701 CCAGGAAGATATGATGTTGCTGC 59.747 47.826 10.99 0.00 46.08 5.25
1658 2918 4.135306 CAGGAAGATATGATGTTGCTGCT 58.865 43.478 0.00 0.00 42.96 4.24
1659 2919 5.303165 CAGGAAGATATGATGTTGCTGCTA 58.697 41.667 0.00 0.00 42.96 3.49
1660 2920 5.761726 CAGGAAGATATGATGTTGCTGCTAA 59.238 40.000 0.00 0.00 42.96 3.09
1661 2921 6.430308 CAGGAAGATATGATGTTGCTGCTAAT 59.570 38.462 0.00 0.00 42.96 1.73
1662 2922 7.002879 AGGAAGATATGATGTTGCTGCTAATT 58.997 34.615 0.00 0.00 33.08 1.40
1663 2923 7.504911 AGGAAGATATGATGTTGCTGCTAATTT 59.495 33.333 0.00 0.00 33.08 1.82
1664 2924 8.786898 GGAAGATATGATGTTGCTGCTAATTTA 58.213 33.333 0.00 0.00 0.00 1.40
1665 2925 9.823098 GAAGATATGATGTTGCTGCTAATTTAG 57.177 33.333 0.00 0.00 0.00 1.85
1681 2941 5.751243 AATTTAGCAGTCACGACAAAAGT 57.249 34.783 0.00 0.00 0.00 2.66
1682 2942 5.751243 ATTTAGCAGTCACGACAAAAGTT 57.249 34.783 0.00 0.00 0.00 2.66
1683 2943 4.530094 TTAGCAGTCACGACAAAAGTTG 57.470 40.909 0.00 0.00 0.00 3.16
1684 2944 2.627945 AGCAGTCACGACAAAAGTTGA 58.372 42.857 0.00 0.00 0.00 3.18
1685 2945 2.351726 AGCAGTCACGACAAAAGTTGAC 59.648 45.455 0.00 0.00 0.00 3.18
1686 2946 2.538939 GCAGTCACGACAAAAGTTGACC 60.539 50.000 0.00 0.00 0.00 4.02
1687 2947 2.031683 CAGTCACGACAAAAGTTGACCC 59.968 50.000 0.00 0.00 0.00 4.46
1688 2948 2.093128 AGTCACGACAAAAGTTGACCCT 60.093 45.455 0.00 0.00 0.00 4.34
1689 2949 2.287103 GTCACGACAAAAGTTGACCCTC 59.713 50.000 0.00 0.00 0.00 4.30
1690 2950 1.260561 CACGACAAAAGTTGACCCTCG 59.739 52.381 0.00 0.00 33.38 4.63
1691 2951 1.134610 ACGACAAAAGTTGACCCTCGT 60.135 47.619 0.00 0.00 34.97 4.18
1692 2952 1.525619 CGACAAAAGTTGACCCTCGTC 59.474 52.381 0.00 0.00 39.66 4.20
1693 2953 2.802057 CGACAAAAGTTGACCCTCGTCT 60.802 50.000 0.00 0.00 39.94 4.18
1694 2954 2.544267 GACAAAAGTTGACCCTCGTCTG 59.456 50.000 0.00 0.00 39.94 3.51
1695 2955 2.093128 ACAAAAGTTGACCCTCGTCTGT 60.093 45.455 0.00 0.00 39.94 3.41
1696 2956 2.528041 AAAGTTGACCCTCGTCTGTC 57.472 50.000 0.00 0.00 39.94 3.51
1697 2957 1.410004 AAGTTGACCCTCGTCTGTCA 58.590 50.000 0.00 0.00 39.94 3.58
1698 2958 0.962489 AGTTGACCCTCGTCTGTCAG 59.038 55.000 0.00 0.00 42.05 3.51
1699 2959 0.667792 GTTGACCCTCGTCTGTCAGC 60.668 60.000 0.00 0.00 42.05 4.26
1700 2960 1.816863 TTGACCCTCGTCTGTCAGCC 61.817 60.000 0.00 0.00 42.05 4.85
1701 2961 3.343788 GACCCTCGTCTGTCAGCCG 62.344 68.421 0.00 0.00 35.99 5.52
1702 2962 3.374402 CCCTCGTCTGTCAGCCGT 61.374 66.667 2.87 0.00 0.00 5.68
1703 2963 2.126307 CCTCGTCTGTCAGCCGTG 60.126 66.667 2.87 0.62 0.00 4.94
1704 2964 2.645567 CTCGTCTGTCAGCCGTGT 59.354 61.111 2.87 0.00 0.00 4.49
1705 2965 1.583495 CCTCGTCTGTCAGCCGTGTA 61.583 60.000 2.87 0.00 0.00 2.90
1706 2966 0.454620 CTCGTCTGTCAGCCGTGTAC 60.455 60.000 2.87 0.00 0.00 2.90
1707 2967 1.167781 TCGTCTGTCAGCCGTGTACA 61.168 55.000 2.87 0.00 0.00 2.90
1708 2968 0.318360 CGTCTGTCAGCCGTGTACAA 60.318 55.000 0.00 0.00 0.00 2.41
1709 2969 1.860676 GTCTGTCAGCCGTGTACAAA 58.139 50.000 0.00 0.00 0.00 2.83
1710 2970 1.792949 GTCTGTCAGCCGTGTACAAAG 59.207 52.381 0.00 0.00 0.00 2.77
1711 2971 1.684450 TCTGTCAGCCGTGTACAAAGA 59.316 47.619 0.00 0.00 0.00 2.52
1712 2972 2.299013 TCTGTCAGCCGTGTACAAAGAT 59.701 45.455 0.00 0.00 0.00 2.40
1713 2973 3.508402 TCTGTCAGCCGTGTACAAAGATA 59.492 43.478 0.00 0.00 0.00 1.98
1714 2974 3.581755 TGTCAGCCGTGTACAAAGATAC 58.418 45.455 0.00 0.00 0.00 2.24
1715 2975 2.597305 GTCAGCCGTGTACAAAGATACG 59.403 50.000 0.00 0.00 36.39 3.06
1722 2982 5.621635 CGTGTACAAAGATACGGAGATTG 57.378 43.478 0.00 0.00 33.27 2.67
1723 2983 5.100259 CGTGTACAAAGATACGGAGATTGT 58.900 41.667 0.00 1.72 37.86 2.71
1724 2984 5.575606 CGTGTACAAAGATACGGAGATTGTT 59.424 40.000 0.00 0.00 35.89 2.83
1725 2985 6.453791 CGTGTACAAAGATACGGAGATTGTTG 60.454 42.308 0.00 0.00 35.89 3.33
1726 2986 5.872617 TGTACAAAGATACGGAGATTGTTGG 59.127 40.000 0.00 0.00 35.89 3.77
1727 2987 4.261801 ACAAAGATACGGAGATTGTTGGG 58.738 43.478 0.00 0.00 30.50 4.12
1728 2988 3.560636 AAGATACGGAGATTGTTGGGG 57.439 47.619 0.00 0.00 0.00 4.96
1729 2989 2.478292 AGATACGGAGATTGTTGGGGT 58.522 47.619 0.00 0.00 0.00 4.95
1730 2990 2.170607 AGATACGGAGATTGTTGGGGTG 59.829 50.000 0.00 0.00 0.00 4.61
1731 2991 0.616371 TACGGAGATTGTTGGGGTGG 59.384 55.000 0.00 0.00 0.00 4.61
1732 2992 1.131303 ACGGAGATTGTTGGGGTGGA 61.131 55.000 0.00 0.00 0.00 4.02
1733 2993 0.037590 CGGAGATTGTTGGGGTGGAA 59.962 55.000 0.00 0.00 0.00 3.53
1734 2994 1.839424 GGAGATTGTTGGGGTGGAAG 58.161 55.000 0.00 0.00 0.00 3.46
1735 2995 1.354368 GGAGATTGTTGGGGTGGAAGA 59.646 52.381 0.00 0.00 0.00 2.87
1736 2996 2.225017 GGAGATTGTTGGGGTGGAAGAA 60.225 50.000 0.00 0.00 0.00 2.52
1737 2997 2.820197 GAGATTGTTGGGGTGGAAGAAC 59.180 50.000 0.00 0.00 0.00 3.01
1738 2998 1.893137 GATTGTTGGGGTGGAAGAACC 59.107 52.381 0.00 0.00 39.71 3.62
1746 3006 2.409948 GGTGGAAGAACCCAGAGATG 57.590 55.000 0.00 0.00 36.78 2.90
1747 3007 1.909302 GGTGGAAGAACCCAGAGATGA 59.091 52.381 0.00 0.00 36.78 2.92
1748 3008 2.093235 GGTGGAAGAACCCAGAGATGAG 60.093 54.545 0.00 0.00 36.78 2.90
1749 3009 1.556911 TGGAAGAACCCAGAGATGAGC 59.443 52.381 0.00 0.00 38.00 4.26
1750 3010 1.836802 GGAAGAACCCAGAGATGAGCT 59.163 52.381 0.00 0.00 0.00 4.09
1751 3011 2.419851 GGAAGAACCCAGAGATGAGCTG 60.420 54.545 0.00 0.00 0.00 4.24
1757 3017 2.312722 CCAGAGATGAGCTGGTCAAG 57.687 55.000 14.08 2.27 46.19 3.02
1758 3018 1.829849 CCAGAGATGAGCTGGTCAAGA 59.170 52.381 14.08 0.00 46.19 3.02
1759 3019 2.159071 CCAGAGATGAGCTGGTCAAGAG 60.159 54.545 14.08 2.93 46.19 2.85
1760 3020 2.109774 AGAGATGAGCTGGTCAAGAGG 58.890 52.381 14.08 0.00 39.19 3.69
1761 3021 0.540923 AGATGAGCTGGTCAAGAGGC 59.459 55.000 14.08 1.92 39.19 4.70
1762 3022 0.540923 GATGAGCTGGTCAAGAGGCT 59.459 55.000 14.08 0.00 39.19 4.58
1763 3023 4.930592 GAGCTGGTCAAGAGGCTC 57.069 61.111 6.34 6.34 43.07 4.70
1764 3024 4.222353 AGCTGGTCAAGAGGCTCA 57.778 55.556 18.26 0.00 0.00 4.26
1765 3025 1.676384 AGCTGGTCAAGAGGCTCAC 59.324 57.895 18.26 6.08 0.00 3.51
1766 3026 1.376553 GCTGGTCAAGAGGCTCACC 60.377 63.158 18.26 15.84 0.00 4.02
1767 3027 1.079543 CTGGTCAAGAGGCTCACCG 60.080 63.158 18.26 8.31 42.76 4.94
1768 3028 2.266055 GGTCAAGAGGCTCACCGG 59.734 66.667 18.26 0.00 42.76 5.28
1769 3029 2.584391 GGTCAAGAGGCTCACCGGT 61.584 63.158 18.26 0.00 42.76 5.28
1770 3030 1.374758 GTCAAGAGGCTCACCGGTG 60.375 63.158 29.26 29.26 42.76 4.94
1771 3031 2.046892 CAAGAGGCTCACCGGTGG 60.047 66.667 33.40 23.98 42.76 4.61
1772 3032 2.203788 AAGAGGCTCACCGGTGGA 60.204 61.111 33.40 18.99 42.76 4.02
1773 3033 2.286523 AAGAGGCTCACCGGTGGAG 61.287 63.158 33.40 26.94 42.76 3.86
1774 3034 2.680352 GAGGCTCACCGGTGGAGA 60.680 66.667 33.40 14.53 42.76 3.71
1775 3035 2.681778 AGGCTCACCGGTGGAGAG 60.682 66.667 33.40 23.94 42.05 3.20
1776 3036 3.775654 GGCTCACCGGTGGAGAGG 61.776 72.222 33.40 18.52 40.06 3.69
1777 3037 2.680352 GCTCACCGGTGGAGAGGA 60.680 66.667 33.40 12.97 40.06 3.71
1778 3038 2.060980 GCTCACCGGTGGAGAGGAT 61.061 63.158 33.40 0.00 40.06 3.24
1779 3039 1.819229 CTCACCGGTGGAGAGGATG 59.181 63.158 33.40 5.60 36.90 3.51
1780 3040 1.680522 CTCACCGGTGGAGAGGATGG 61.681 65.000 33.40 4.70 36.90 3.51
1781 3041 1.990060 CACCGGTGGAGAGGATGGT 60.990 63.158 27.57 0.00 0.00 3.55
1782 3042 1.990060 ACCGGTGGAGAGGATGGTG 60.990 63.158 6.12 0.00 0.00 4.17
1783 3043 1.990060 CCGGTGGAGAGGATGGTGT 60.990 63.158 0.00 0.00 0.00 4.16
1784 3044 1.553690 CCGGTGGAGAGGATGGTGTT 61.554 60.000 0.00 0.00 0.00 3.32
1785 3045 0.324943 CGGTGGAGAGGATGGTGTTT 59.675 55.000 0.00 0.00 0.00 2.83
1786 3046 1.676014 CGGTGGAGAGGATGGTGTTTC 60.676 57.143 0.00 0.00 0.00 2.78
1787 3047 1.340114 GGTGGAGAGGATGGTGTTTCC 60.340 57.143 0.00 0.00 0.00 3.13
1797 3057 1.770294 TGGTGTTTCCAAGGACCAAC 58.230 50.000 0.00 0.00 44.12 3.77
1798 3058 1.286553 TGGTGTTTCCAAGGACCAACT 59.713 47.619 0.00 0.00 44.12 3.16
1799 3059 1.954382 GGTGTTTCCAAGGACCAACTC 59.046 52.381 0.00 2.51 35.97 3.01
1800 3060 2.650322 GTGTTTCCAAGGACCAACTCA 58.350 47.619 0.00 0.00 0.00 3.41
1801 3061 3.020984 GTGTTTCCAAGGACCAACTCAA 58.979 45.455 0.00 0.00 0.00 3.02
1802 3062 3.066760 GTGTTTCCAAGGACCAACTCAAG 59.933 47.826 0.00 0.00 0.00 3.02
1803 3063 3.053991 TGTTTCCAAGGACCAACTCAAGA 60.054 43.478 0.00 0.00 0.00 3.02
1804 3064 4.145052 GTTTCCAAGGACCAACTCAAGAT 58.855 43.478 0.00 0.00 0.00 2.40
1805 3065 3.703001 TCCAAGGACCAACTCAAGATC 57.297 47.619 0.00 0.00 0.00 2.75
1806 3066 2.305927 TCCAAGGACCAACTCAAGATCC 59.694 50.000 0.00 0.00 0.00 3.36
1807 3067 2.307098 CCAAGGACCAACTCAAGATCCT 59.693 50.000 0.00 0.00 41.70 3.24
1808 3068 3.604582 CAAGGACCAACTCAAGATCCTC 58.395 50.000 0.00 0.00 38.90 3.71
1809 3069 3.197927 AGGACCAACTCAAGATCCTCT 57.802 47.619 0.00 0.00 34.61 3.69
1810 3070 3.103742 AGGACCAACTCAAGATCCTCTC 58.896 50.000 0.00 0.00 34.61 3.20
1811 3071 2.834549 GGACCAACTCAAGATCCTCTCA 59.165 50.000 0.00 0.00 0.00 3.27
1812 3072 3.261897 GGACCAACTCAAGATCCTCTCAA 59.738 47.826 0.00 0.00 0.00 3.02
1813 3073 4.080638 GGACCAACTCAAGATCCTCTCAAT 60.081 45.833 0.00 0.00 0.00 2.57
1814 3074 5.495640 GACCAACTCAAGATCCTCTCAATT 58.504 41.667 0.00 0.00 0.00 2.32
1815 3075 5.885465 ACCAACTCAAGATCCTCTCAATTT 58.115 37.500 0.00 0.00 0.00 1.82
1816 3076 6.310149 ACCAACTCAAGATCCTCTCAATTTT 58.690 36.000 0.00 0.00 0.00 1.82
1817 3077 6.432472 ACCAACTCAAGATCCTCTCAATTTTC 59.568 38.462 0.00 0.00 0.00 2.29
1818 3078 6.402983 CCAACTCAAGATCCTCTCAATTTTCG 60.403 42.308 0.00 0.00 0.00 3.46
1819 3079 5.181748 ACTCAAGATCCTCTCAATTTTCGG 58.818 41.667 0.00 0.00 0.00 4.30
1820 3080 4.517285 TCAAGATCCTCTCAATTTTCGGG 58.483 43.478 0.00 0.00 0.00 5.14
1821 3081 4.019321 TCAAGATCCTCTCAATTTTCGGGT 60.019 41.667 0.00 0.00 0.00 5.28
1822 3082 4.576330 AGATCCTCTCAATTTTCGGGTT 57.424 40.909 0.00 0.00 0.00 4.11
1823 3083 4.923415 AGATCCTCTCAATTTTCGGGTTT 58.077 39.130 0.00 0.00 0.00 3.27
1824 3084 4.702131 AGATCCTCTCAATTTTCGGGTTTG 59.298 41.667 0.00 0.00 0.00 2.93
1825 3085 3.153919 TCCTCTCAATTTTCGGGTTTGG 58.846 45.455 0.00 0.00 0.00 3.28
1826 3086 3.153919 CCTCTCAATTTTCGGGTTTGGA 58.846 45.455 0.00 0.00 0.00 3.53
1827 3087 3.191371 CCTCTCAATTTTCGGGTTTGGAG 59.809 47.826 0.00 0.00 0.00 3.86
1828 3088 3.153919 TCTCAATTTTCGGGTTTGGAGG 58.846 45.455 0.00 0.00 0.00 4.30
1829 3089 3.153919 CTCAATTTTCGGGTTTGGAGGA 58.846 45.455 0.00 0.00 0.00 3.71
1830 3090 3.763897 CTCAATTTTCGGGTTTGGAGGAT 59.236 43.478 0.00 0.00 0.00 3.24
1831 3091 4.156477 TCAATTTTCGGGTTTGGAGGATT 58.844 39.130 0.00 0.00 0.00 3.01
1832 3092 5.326069 TCAATTTTCGGGTTTGGAGGATTA 58.674 37.500 0.00 0.00 0.00 1.75
1833 3093 5.417580 TCAATTTTCGGGTTTGGAGGATTAG 59.582 40.000 0.00 0.00 0.00 1.73
1834 3094 3.359695 TTTCGGGTTTGGAGGATTAGG 57.640 47.619 0.00 0.00 0.00 2.69
1835 3095 0.544697 TCGGGTTTGGAGGATTAGGC 59.455 55.000 0.00 0.00 0.00 3.93
1836 3096 0.254747 CGGGTTTGGAGGATTAGGCA 59.745 55.000 0.00 0.00 0.00 4.75
1837 3097 1.340600 CGGGTTTGGAGGATTAGGCAA 60.341 52.381 0.00 0.00 0.00 4.52
1838 3098 2.379005 GGGTTTGGAGGATTAGGCAAG 58.621 52.381 0.00 0.00 0.00 4.01
1839 3099 2.025321 GGGTTTGGAGGATTAGGCAAGA 60.025 50.000 0.00 0.00 0.00 3.02
1840 3100 3.017442 GGTTTGGAGGATTAGGCAAGAC 58.983 50.000 0.00 0.00 0.00 3.01
1841 3101 2.678336 GTTTGGAGGATTAGGCAAGACG 59.322 50.000 0.00 0.00 0.00 4.18
1842 3102 1.860641 TGGAGGATTAGGCAAGACGA 58.139 50.000 0.00 0.00 0.00 4.20
1843 3103 1.480954 TGGAGGATTAGGCAAGACGAC 59.519 52.381 0.00 0.00 0.00 4.34
1844 3104 1.757699 GGAGGATTAGGCAAGACGACT 59.242 52.381 0.00 0.00 36.39 4.18
1845 3105 2.223852 GGAGGATTAGGCAAGACGACTC 60.224 54.545 0.00 0.00 32.25 3.36
1846 3106 2.691011 GAGGATTAGGCAAGACGACTCT 59.309 50.000 0.00 0.00 32.25 3.24
1847 3107 3.100671 AGGATTAGGCAAGACGACTCTT 58.899 45.455 0.00 0.00 37.19 2.85
1853 3113 2.832931 CAAGACGACTCTTGCCAGG 58.167 57.895 3.16 0.00 45.43 4.45
1854 3114 0.671781 CAAGACGACTCTTGCCAGGG 60.672 60.000 3.16 0.00 45.43 4.45
1855 3115 2.435059 GACGACTCTTGCCAGGGC 60.435 66.667 2.62 2.62 42.35 5.19
1866 3126 2.521103 GCCAGGGCAGTCTATGAGA 58.479 57.895 5.20 0.00 41.49 3.27
1867 3127 0.392336 GCCAGGGCAGTCTATGAGAG 59.608 60.000 5.20 0.00 41.49 3.20
1868 3128 2.031624 GCCAGGGCAGTCTATGAGAGA 61.032 57.143 5.20 0.00 41.49 3.10
1879 3139 3.713003 TCTATGAGAGACTTCAAGGGCA 58.287 45.455 0.00 0.00 0.00 5.36
1880 3140 4.096681 TCTATGAGAGACTTCAAGGGCAA 58.903 43.478 0.00 0.00 0.00 4.52
1881 3141 4.718774 TCTATGAGAGACTTCAAGGGCAAT 59.281 41.667 0.00 0.00 0.00 3.56
1882 3142 5.899547 TCTATGAGAGACTTCAAGGGCAATA 59.100 40.000 0.00 0.00 0.00 1.90
1883 3143 5.643421 ATGAGAGACTTCAAGGGCAATAT 57.357 39.130 0.00 0.00 0.00 1.28
1884 3144 4.774124 TGAGAGACTTCAAGGGCAATATG 58.226 43.478 0.00 0.00 0.00 1.78
1885 3145 4.225942 TGAGAGACTTCAAGGGCAATATGT 59.774 41.667 0.00 0.00 0.00 2.29
1886 3146 5.184892 AGAGACTTCAAGGGCAATATGTT 57.815 39.130 0.00 0.00 0.00 2.71
1887 3147 5.189180 AGAGACTTCAAGGGCAATATGTTC 58.811 41.667 0.00 0.00 0.00 3.18
1888 3148 3.941483 AGACTTCAAGGGCAATATGTTCG 59.059 43.478 0.00 0.00 0.00 3.95
1889 3149 3.686016 ACTTCAAGGGCAATATGTTCGT 58.314 40.909 0.00 0.00 0.00 3.85
1890 3150 3.440173 ACTTCAAGGGCAATATGTTCGTG 59.560 43.478 0.00 0.00 0.00 4.35
1891 3151 3.342377 TCAAGGGCAATATGTTCGTGA 57.658 42.857 0.00 0.00 0.00 4.35
1892 3152 3.884895 TCAAGGGCAATATGTTCGTGAT 58.115 40.909 0.00 0.00 0.00 3.06
1893 3153 3.627123 TCAAGGGCAATATGTTCGTGATG 59.373 43.478 0.00 0.00 0.00 3.07
1894 3154 1.949525 AGGGCAATATGTTCGTGATGC 59.050 47.619 0.00 0.00 0.00 3.91
1895 3155 1.949525 GGGCAATATGTTCGTGATGCT 59.050 47.619 0.00 0.00 34.37 3.79
1896 3156 2.358898 GGGCAATATGTTCGTGATGCTT 59.641 45.455 0.00 0.00 34.37 3.91
1897 3157 3.181487 GGGCAATATGTTCGTGATGCTTT 60.181 43.478 0.00 0.00 34.37 3.51
1898 3158 4.037690 GGCAATATGTTCGTGATGCTTTC 58.962 43.478 0.00 0.00 34.37 2.62
1899 3159 3.720818 GCAATATGTTCGTGATGCTTTCG 59.279 43.478 0.00 0.00 0.00 3.46
1900 3160 4.727734 GCAATATGTTCGTGATGCTTTCGT 60.728 41.667 0.00 0.00 0.00 3.85
1901 3161 5.323900 CAATATGTTCGTGATGCTTTCGTT 58.676 37.500 0.00 0.00 0.00 3.85
1902 3162 2.661504 TGTTCGTGATGCTTTCGTTG 57.338 45.000 0.00 0.00 0.00 4.10
1903 3163 1.318251 GTTCGTGATGCTTTCGTTGC 58.682 50.000 0.00 0.00 0.00 4.17
1904 3164 0.110867 TTCGTGATGCTTTCGTTGCG 60.111 50.000 0.00 0.00 0.00 4.85
1905 3165 1.509787 CGTGATGCTTTCGTTGCGG 60.510 57.895 0.00 0.00 0.00 5.69
1906 3166 1.574428 GTGATGCTTTCGTTGCGGT 59.426 52.632 0.00 0.00 0.00 5.68
1907 3167 0.725784 GTGATGCTTTCGTTGCGGTG 60.726 55.000 0.00 0.00 0.00 4.94
1908 3168 1.154225 GATGCTTTCGTTGCGGTGG 60.154 57.895 0.00 0.00 0.00 4.61
1909 3169 2.527547 GATGCTTTCGTTGCGGTGGG 62.528 60.000 0.00 0.00 0.00 4.61
1910 3170 3.284449 GCTTTCGTTGCGGTGGGT 61.284 61.111 0.00 0.00 0.00 4.51
1911 3171 2.943653 CTTTCGTTGCGGTGGGTC 59.056 61.111 0.00 0.00 0.00 4.46
1912 3172 2.950172 CTTTCGTTGCGGTGGGTCG 61.950 63.158 0.00 0.00 0.00 4.79
1926 3186 3.998672 GTCGCAACCCTGACCCGA 61.999 66.667 0.00 0.00 0.00 5.14
1927 3187 3.235481 TCGCAACCCTGACCCGAA 61.235 61.111 0.00 0.00 0.00 4.30
1928 3188 2.742372 CGCAACCCTGACCCGAAG 60.742 66.667 0.00 0.00 0.00 3.79
1929 3189 2.747686 GCAACCCTGACCCGAAGA 59.252 61.111 0.00 0.00 0.00 2.87
1930 3190 1.072505 GCAACCCTGACCCGAAGAA 59.927 57.895 0.00 0.00 0.00 2.52
1931 3191 0.536460 GCAACCCTGACCCGAAGAAA 60.536 55.000 0.00 0.00 0.00 2.52
1932 3192 1.523758 CAACCCTGACCCGAAGAAAG 58.476 55.000 0.00 0.00 0.00 2.62
1933 3193 1.137697 AACCCTGACCCGAAGAAAGT 58.862 50.000 0.00 0.00 0.00 2.66
1934 3194 2.019807 ACCCTGACCCGAAGAAAGTA 57.980 50.000 0.00 0.00 0.00 2.24
1935 3195 2.547990 ACCCTGACCCGAAGAAAGTAT 58.452 47.619 0.00 0.00 0.00 2.12
1936 3196 2.910977 ACCCTGACCCGAAGAAAGTATT 59.089 45.455 0.00 0.00 0.00 1.89
1937 3197 3.270877 CCCTGACCCGAAGAAAGTATTG 58.729 50.000 0.00 0.00 0.00 1.90
1938 3198 3.055385 CCCTGACCCGAAGAAAGTATTGA 60.055 47.826 0.00 0.00 0.00 2.57
1939 3199 4.384208 CCCTGACCCGAAGAAAGTATTGAT 60.384 45.833 0.00 0.00 0.00 2.57
1940 3200 4.572389 CCTGACCCGAAGAAAGTATTGATG 59.428 45.833 0.00 0.00 0.00 3.07
1941 3201 4.513442 TGACCCGAAGAAAGTATTGATGG 58.487 43.478 0.00 0.00 0.00 3.51
1942 3202 4.224147 TGACCCGAAGAAAGTATTGATGGA 59.776 41.667 0.00 0.00 0.00 3.41
1943 3203 4.514401 ACCCGAAGAAAGTATTGATGGAC 58.486 43.478 0.00 0.00 0.00 4.02
1944 3204 4.019681 ACCCGAAGAAAGTATTGATGGACA 60.020 41.667 0.00 0.00 0.00 4.02
1945 3205 5.126067 CCCGAAGAAAGTATTGATGGACAT 58.874 41.667 0.00 0.00 0.00 3.06
1946 3206 5.237344 CCCGAAGAAAGTATTGATGGACATC 59.763 44.000 5.37 5.37 38.29 3.06
1947 3207 6.051717 CCGAAGAAAGTATTGATGGACATCT 58.948 40.000 12.97 0.00 38.60 2.90
1948 3208 6.540189 CCGAAGAAAGTATTGATGGACATCTT 59.460 38.462 12.97 4.24 38.60 2.40
1949 3209 7.710907 CCGAAGAAAGTATTGATGGACATCTTA 59.289 37.037 12.97 2.71 38.60 2.10
1950 3210 8.543774 CGAAGAAAGTATTGATGGACATCTTAC 58.456 37.037 12.97 13.22 38.60 2.34
1951 3211 9.606631 GAAGAAAGTATTGATGGACATCTTACT 57.393 33.333 12.97 14.81 38.19 2.24
1952 3212 9.965902 AAGAAAGTATTGATGGACATCTTACTT 57.034 29.630 21.80 21.80 42.38 2.24
1953 3213 9.606631 AGAAAGTATTGATGGACATCTTACTTC 57.393 33.333 24.55 20.23 41.26 3.01
1954 3214 9.383519 GAAAGTATTGATGGACATCTTACTTCA 57.616 33.333 24.55 4.43 41.26 3.02
1955 3215 8.954950 AAGTATTGATGGACATCTTACTTCAG 57.045 34.615 21.80 0.00 39.89 3.02
1956 3216 6.989169 AGTATTGATGGACATCTTACTTCAGC 59.011 38.462 12.97 0.00 35.72 4.26
1957 3217 5.426689 TTGATGGACATCTTACTTCAGCT 57.573 39.130 12.97 0.00 38.60 4.24
1958 3218 5.426689 TGATGGACATCTTACTTCAGCTT 57.573 39.130 12.97 0.00 38.60 3.74
1959 3219 5.181009 TGATGGACATCTTACTTCAGCTTG 58.819 41.667 12.97 0.00 38.60 4.01
1960 3220 4.890158 TGGACATCTTACTTCAGCTTGA 57.110 40.909 0.00 0.00 0.00 3.02
1961 3221 4.569943 TGGACATCTTACTTCAGCTTGAC 58.430 43.478 0.00 0.00 0.00 3.18
1962 3222 4.040339 TGGACATCTTACTTCAGCTTGACA 59.960 41.667 0.00 0.00 0.00 3.58
1963 3223 4.997395 GGACATCTTACTTCAGCTTGACAA 59.003 41.667 0.00 0.00 0.00 3.18
1964 3224 5.121454 GGACATCTTACTTCAGCTTGACAAG 59.879 44.000 11.02 11.02 0.00 3.16
1965 3225 5.858381 ACATCTTACTTCAGCTTGACAAGA 58.142 37.500 19.51 0.00 0.00 3.02
1966 3226 6.291377 ACATCTTACTTCAGCTTGACAAGAA 58.709 36.000 19.51 3.93 28.89 2.52
1967 3227 6.203723 ACATCTTACTTCAGCTTGACAAGAAC 59.796 38.462 19.51 2.04 28.89 3.01
1968 3228 5.670485 TCTTACTTCAGCTTGACAAGAACA 58.330 37.500 19.51 0.00 0.00 3.18
1969 3229 6.112734 TCTTACTTCAGCTTGACAAGAACAA 58.887 36.000 19.51 6.23 0.00 2.83
1970 3230 4.889832 ACTTCAGCTTGACAAGAACAAG 57.110 40.909 19.51 16.32 44.92 3.16
1971 3231 4.517285 ACTTCAGCTTGACAAGAACAAGA 58.483 39.130 19.51 5.54 44.92 3.02
1972 3232 4.943705 ACTTCAGCTTGACAAGAACAAGAA 59.056 37.500 19.51 12.05 44.92 2.52
1973 3233 5.591877 ACTTCAGCTTGACAAGAACAAGAAT 59.408 36.000 19.51 0.00 44.92 2.40
1974 3234 6.096001 ACTTCAGCTTGACAAGAACAAGAATT 59.904 34.615 19.51 6.11 44.92 2.17
1975 3235 7.283127 ACTTCAGCTTGACAAGAACAAGAATTA 59.717 33.333 19.51 0.00 44.92 1.40
1976 3236 7.750229 TCAGCTTGACAAGAACAAGAATTAT 57.250 32.000 19.51 0.00 44.92 1.28
1977 3237 8.846943 TCAGCTTGACAAGAACAAGAATTATA 57.153 30.769 19.51 0.00 44.92 0.98
1978 3238 9.283768 TCAGCTTGACAAGAACAAGAATTATAA 57.716 29.630 19.51 0.00 44.92 0.98
1979 3239 9.552114 CAGCTTGACAAGAACAAGAATTATAAG 57.448 33.333 19.51 0.00 44.92 1.73
1980 3240 8.734386 AGCTTGACAAGAACAAGAATTATAAGG 58.266 33.333 19.51 0.00 44.92 2.69
1981 3241 7.486232 GCTTGACAAGAACAAGAATTATAAGGC 59.514 37.037 19.51 0.00 44.92 4.35
1982 3242 7.994425 TGACAAGAACAAGAATTATAAGGCA 57.006 32.000 0.00 0.00 0.00 4.75
1983 3243 7.816640 TGACAAGAACAAGAATTATAAGGCAC 58.183 34.615 0.00 0.00 0.00 5.01
1984 3244 7.446931 TGACAAGAACAAGAATTATAAGGCACA 59.553 33.333 0.00 0.00 0.00 4.57
1985 3245 7.593825 ACAAGAACAAGAATTATAAGGCACAC 58.406 34.615 0.00 0.00 0.00 3.82
1986 3246 7.230510 ACAAGAACAAGAATTATAAGGCACACA 59.769 33.333 0.00 0.00 0.00 3.72
1987 3247 7.759489 AGAACAAGAATTATAAGGCACACAA 57.241 32.000 0.00 0.00 0.00 3.33
1988 3248 8.353423 AGAACAAGAATTATAAGGCACACAAT 57.647 30.769 0.00 0.00 0.00 2.71
1989 3249 8.806146 AGAACAAGAATTATAAGGCACACAATT 58.194 29.630 0.00 0.00 0.00 2.32
1990 3250 9.423061 GAACAAGAATTATAAGGCACACAATTT 57.577 29.630 0.00 0.00 0.00 1.82
1993 3253 9.023967 CAAGAATTATAAGGCACACAATTTAGC 57.976 33.333 0.00 0.00 0.00 3.09
1999 3259 3.317603 GGCACACAATTTAGCCATGTT 57.682 42.857 0.00 0.00 46.26 2.71
2000 3260 2.995258 GGCACACAATTTAGCCATGTTG 59.005 45.455 0.00 0.00 46.26 3.33
2001 3261 2.995258 GCACACAATTTAGCCATGTTGG 59.005 45.455 0.00 0.00 41.55 3.77
2002 3262 3.305950 GCACACAATTTAGCCATGTTGGA 60.306 43.478 0.00 0.00 40.96 3.53
2003 3263 4.621274 GCACACAATTTAGCCATGTTGGAT 60.621 41.667 0.00 0.00 40.96 3.41
2004 3264 4.865925 CACACAATTTAGCCATGTTGGATG 59.134 41.667 0.00 0.00 40.96 3.51
2005 3265 4.771577 ACACAATTTAGCCATGTTGGATGA 59.228 37.500 0.00 0.00 40.96 2.92
2006 3266 5.245751 ACACAATTTAGCCATGTTGGATGAA 59.754 36.000 0.00 0.00 40.96 2.57
2007 3267 6.164876 CACAATTTAGCCATGTTGGATGAAA 58.835 36.000 0.00 0.00 40.96 2.69
2008 3268 6.819649 CACAATTTAGCCATGTTGGATGAAAT 59.180 34.615 0.00 0.00 40.96 2.17
2009 3269 7.980662 CACAATTTAGCCATGTTGGATGAAATA 59.019 33.333 0.00 0.00 40.96 1.40
2010 3270 7.981225 ACAATTTAGCCATGTTGGATGAAATAC 59.019 33.333 0.00 0.00 40.96 1.89
2011 3271 7.658525 ATTTAGCCATGTTGGATGAAATACA 57.341 32.000 0.00 0.00 40.96 2.29
2012 3272 6.698008 TTAGCCATGTTGGATGAAATACAG 57.302 37.500 0.00 0.00 39.24 2.74
2013 3273 3.382546 AGCCATGTTGGATGAAATACAGC 59.617 43.478 0.00 0.00 39.24 4.40
2014 3274 3.382546 GCCATGTTGGATGAAATACAGCT 59.617 43.478 0.00 0.00 39.24 4.24
2015 3275 4.498682 GCCATGTTGGATGAAATACAGCTC 60.499 45.833 0.00 0.00 39.24 4.09
2016 3276 4.641541 CCATGTTGGATGAAATACAGCTCA 59.358 41.667 0.00 0.00 39.24 4.26
2017 3277 5.301045 CCATGTTGGATGAAATACAGCTCAT 59.699 40.000 0.00 0.00 39.24 2.90
2018 3278 6.436261 CATGTTGGATGAAATACAGCTCATC 58.564 40.000 3.91 3.91 39.24 2.92
2019 3279 4.571984 TGTTGGATGAAATACAGCTCATCG 59.428 41.667 6.09 0.00 45.94 3.84
2020 3280 4.670896 TGGATGAAATACAGCTCATCGA 57.329 40.909 6.09 0.00 45.94 3.59
2021 3281 5.219343 TGGATGAAATACAGCTCATCGAT 57.781 39.130 0.00 0.00 45.94 3.59
2022 3282 4.992951 TGGATGAAATACAGCTCATCGATG 59.007 41.667 19.61 19.61 45.94 3.84
2023 3283 5.221501 TGGATGAAATACAGCTCATCGATGA 60.222 40.000 25.80 25.80 45.94 2.92
2024 3284 5.698089 GGATGAAATACAGCTCATCGATGAA 59.302 40.000 27.09 13.78 45.94 2.57
2025 3285 5.973651 TGAAATACAGCTCATCGATGAAC 57.026 39.130 27.09 22.97 36.18 3.18
2026 3286 5.664457 TGAAATACAGCTCATCGATGAACT 58.336 37.500 27.09 24.77 36.18 3.01
2027 3287 5.750547 TGAAATACAGCTCATCGATGAACTC 59.249 40.000 24.81 17.73 36.18 3.01
2028 3288 2.593346 ACAGCTCATCGATGAACTCC 57.407 50.000 24.81 15.08 36.18 3.85
2029 3289 1.202348 ACAGCTCATCGATGAACTCCG 60.202 52.381 24.81 18.01 36.18 4.63
2030 3290 0.387202 AGCTCATCGATGAACTCCGG 59.613 55.000 27.09 16.03 36.18 5.14
2031 3291 0.598680 GCTCATCGATGAACTCCGGG 60.599 60.000 27.09 15.36 36.18 5.73
2032 3292 0.032678 CTCATCGATGAACTCCGGGG 59.967 60.000 27.09 0.00 36.18 5.73
2033 3293 0.396556 TCATCGATGAACTCCGGGGA 60.397 55.000 25.44 0.00 33.08 4.81
2034 3294 0.249489 CATCGATGAACTCCGGGGAC 60.249 60.000 21.02 1.54 0.00 4.46
2035 3295 0.397254 ATCGATGAACTCCGGGGACT 60.397 55.000 9.33 0.00 0.00 3.85
2036 3296 1.141881 CGATGAACTCCGGGGACTG 59.858 63.158 9.33 0.00 0.00 3.51
2037 3297 1.153349 GATGAACTCCGGGGACTGC 60.153 63.158 9.33 0.00 0.00 4.40
2038 3298 1.613630 ATGAACTCCGGGGACTGCT 60.614 57.895 9.33 0.00 0.00 4.24
2039 3299 1.201429 ATGAACTCCGGGGACTGCTT 61.201 55.000 9.33 0.00 0.00 3.91
2040 3300 1.376037 GAACTCCGGGGACTGCTTG 60.376 63.158 9.33 0.00 0.00 4.01
2041 3301 1.827399 GAACTCCGGGGACTGCTTGA 61.827 60.000 9.33 0.00 0.00 3.02
2042 3302 1.831652 AACTCCGGGGACTGCTTGAG 61.832 60.000 9.33 0.00 0.00 3.02
2043 3303 1.984570 CTCCGGGGACTGCTTGAGA 60.985 63.158 0.00 0.00 0.00 3.27
2044 3304 1.535444 TCCGGGGACTGCTTGAGAA 60.535 57.895 0.00 0.00 0.00 2.87
2045 3305 1.376037 CCGGGGACTGCTTGAGAAC 60.376 63.158 0.00 0.00 0.00 3.01
2046 3306 1.371183 CGGGGACTGCTTGAGAACA 59.629 57.895 0.00 0.00 0.00 3.18
2047 3307 0.250295 CGGGGACTGCTTGAGAACAA 60.250 55.000 0.00 0.00 34.65 2.83
2073 3333 9.610104 AGAGGTATATATACATAAACACCCACA 57.390 33.333 21.56 0.00 34.98 4.17
2076 3336 9.781633 GGTATATATACATAAACACCCACAACA 57.218 33.333 21.56 0.00 34.98 3.33
2082 3342 6.909550 ACATAAACACCCACAACATAATGT 57.090 33.333 0.00 0.00 0.00 2.71
2083 3343 6.919721 ACATAAACACCCACAACATAATGTC 58.080 36.000 0.00 0.00 0.00 3.06
2084 3344 4.864704 AAACACCCACAACATAATGTCC 57.135 40.909 0.00 0.00 0.00 4.02
2085 3345 3.806949 ACACCCACAACATAATGTCCT 57.193 42.857 0.00 0.00 0.00 3.85
2086 3346 4.919774 ACACCCACAACATAATGTCCTA 57.080 40.909 0.00 0.00 0.00 2.94
2087 3347 4.843728 ACACCCACAACATAATGTCCTAG 58.156 43.478 0.00 0.00 0.00 3.02
2088 3348 3.627577 CACCCACAACATAATGTCCTAGC 59.372 47.826 0.00 0.00 0.00 3.42
2089 3349 3.523564 ACCCACAACATAATGTCCTAGCT 59.476 43.478 0.00 0.00 0.00 3.32
2090 3350 4.130118 CCCACAACATAATGTCCTAGCTC 58.870 47.826 0.00 0.00 0.00 4.09
2091 3351 4.384098 CCCACAACATAATGTCCTAGCTCA 60.384 45.833 0.00 0.00 0.00 4.26
2092 3352 5.371526 CCACAACATAATGTCCTAGCTCAT 58.628 41.667 0.00 0.00 0.00 2.90
2093 3353 6.464322 CCCACAACATAATGTCCTAGCTCATA 60.464 42.308 0.00 0.00 0.00 2.15
2094 3354 7.164122 CCACAACATAATGTCCTAGCTCATAT 58.836 38.462 0.00 0.00 0.00 1.78
2095 3355 7.663081 CCACAACATAATGTCCTAGCTCATATT 59.337 37.037 0.00 0.00 0.00 1.28
2096 3356 9.710900 CACAACATAATGTCCTAGCTCATATTA 57.289 33.333 0.00 0.00 0.00 0.98
2104 3364 8.839310 ATGTCCTAGCTCATATTATTGTTCAC 57.161 34.615 0.00 0.00 0.00 3.18
2105 3365 7.791029 TGTCCTAGCTCATATTATTGTTCACA 58.209 34.615 0.00 0.00 0.00 3.58
2106 3366 7.710907 TGTCCTAGCTCATATTATTGTTCACAC 59.289 37.037 0.00 0.00 0.00 3.82
2107 3367 7.710907 GTCCTAGCTCATATTATTGTTCACACA 59.289 37.037 0.00 0.00 0.00 3.72
2109 3369 8.338259 CCTAGCTCATATTATTGTTCACACAAC 58.662 37.037 0.00 0.00 45.88 3.32
2110 3370 7.928307 AGCTCATATTATTGTTCACACAACT 57.072 32.000 0.00 0.00 45.88 3.16
2112 3372 9.448438 AGCTCATATTATTGTTCACACAACTAA 57.552 29.630 0.00 0.00 45.88 2.24
2122 3382 8.684386 TTGTTCACACAACTAATAAATCTGGA 57.316 30.769 0.00 0.00 38.03 3.86
2123 3383 8.684386 TGTTCACACAACTAATAAATCTGGAA 57.316 30.769 0.00 0.00 0.00 3.53
2124 3384 9.126151 TGTTCACACAACTAATAAATCTGGAAA 57.874 29.630 0.00 0.00 0.00 3.13
2138 3398 9.822185 ATAAATCTGGAAATATTTCACTTTGCC 57.178 29.630 25.55 10.79 38.92 4.52
2139 3399 7.486407 AATCTGGAAATATTTCACTTTGCCT 57.514 32.000 25.55 3.72 38.92 4.75
2140 3400 8.593945 AATCTGGAAATATTTCACTTTGCCTA 57.406 30.769 25.55 4.79 38.92 3.93
2141 3401 8.773033 ATCTGGAAATATTTCACTTTGCCTAT 57.227 30.769 25.55 6.51 38.92 2.57
2142 3402 7.999679 TCTGGAAATATTTCACTTTGCCTATG 58.000 34.615 25.55 6.26 38.92 2.23
2143 3403 6.572519 TGGAAATATTTCACTTTGCCTATGC 58.427 36.000 25.55 7.63 38.92 3.14
2144 3404 6.154192 TGGAAATATTTCACTTTGCCTATGCA 59.846 34.615 25.55 9.79 41.51 3.96
2145 3405 7.147689 TGGAAATATTTCACTTTGCCTATGCAT 60.148 33.333 25.55 3.79 42.20 3.96
2146 3406 7.170320 GGAAATATTTCACTTTGCCTATGCATG 59.830 37.037 25.55 0.00 42.20 4.06
2147 3407 7.707893 GAAATATTTCACTTTGCCTATGCATGT 59.292 33.333 20.89 0.00 41.07 3.21
2157 3417 5.664294 TGCCTATGCATGTTCTTGATTTT 57.336 34.783 10.16 0.00 44.23 1.82
2158 3418 6.772360 TGCCTATGCATGTTCTTGATTTTA 57.228 33.333 10.16 0.00 44.23 1.52
2159 3419 6.798482 TGCCTATGCATGTTCTTGATTTTAG 58.202 36.000 10.16 0.00 44.23 1.85
2160 3420 6.183360 TGCCTATGCATGTTCTTGATTTTAGG 60.183 38.462 10.16 4.14 44.23 2.69
2161 3421 6.039717 GCCTATGCATGTTCTTGATTTTAGGA 59.960 38.462 10.16 0.00 37.47 2.94
2162 3422 7.416664 GCCTATGCATGTTCTTGATTTTAGGAA 60.417 37.037 10.16 0.00 37.47 3.36
2163 3423 8.133627 CCTATGCATGTTCTTGATTTTAGGAAG 58.866 37.037 10.16 0.00 0.00 3.46
2164 3424 7.707624 ATGCATGTTCTTGATTTTAGGAAGA 57.292 32.000 0.00 0.00 0.00 2.87
2165 3425 7.707624 TGCATGTTCTTGATTTTAGGAAGAT 57.292 32.000 0.00 0.00 0.00 2.40
2166 3426 7.541162 TGCATGTTCTTGATTTTAGGAAGATG 58.459 34.615 0.00 0.00 40.24 2.90
2167 3427 7.394077 TGCATGTTCTTGATTTTAGGAAGATGA 59.606 33.333 13.26 0.47 39.91 2.92
2168 3428 8.246180 GCATGTTCTTGATTTTAGGAAGATGAA 58.754 33.333 13.26 0.00 39.91 2.57
2222 3482 4.422073 ACAATCTTTGTGGACTCTGACA 57.578 40.909 0.00 0.00 43.48 3.58
2223 3483 4.978099 ACAATCTTTGTGGACTCTGACAT 58.022 39.130 0.00 0.00 43.48 3.06
2224 3484 4.999950 ACAATCTTTGTGGACTCTGACATC 59.000 41.667 0.00 0.00 43.48 3.06
2225 3485 4.897509 ATCTTTGTGGACTCTGACATCA 57.102 40.909 0.00 0.00 0.00 3.07
2226 3486 4.687901 TCTTTGTGGACTCTGACATCAA 57.312 40.909 0.00 0.00 0.00 2.57
2227 3487 5.034852 TCTTTGTGGACTCTGACATCAAA 57.965 39.130 0.00 0.00 0.00 2.69
2228 3488 4.816385 TCTTTGTGGACTCTGACATCAAAC 59.184 41.667 0.00 0.00 0.00 2.93
2229 3489 4.422073 TTGTGGACTCTGACATCAAACT 57.578 40.909 0.00 0.00 0.00 2.66
2230 3490 3.995199 TGTGGACTCTGACATCAAACTC 58.005 45.455 0.00 0.00 0.00 3.01
2231 3491 3.387699 TGTGGACTCTGACATCAAACTCA 59.612 43.478 0.00 0.00 0.00 3.41
2232 3492 4.141733 TGTGGACTCTGACATCAAACTCAA 60.142 41.667 0.00 0.00 0.00 3.02
2233 3493 4.212214 GTGGACTCTGACATCAAACTCAAC 59.788 45.833 0.00 0.00 0.00 3.18
2234 3494 4.101585 TGGACTCTGACATCAAACTCAACT 59.898 41.667 0.00 0.00 0.00 3.16
2235 3495 5.059833 GGACTCTGACATCAAACTCAACTT 58.940 41.667 0.00 0.00 0.00 2.66
2236 3496 6.183360 TGGACTCTGACATCAAACTCAACTTA 60.183 38.462 0.00 0.00 0.00 2.24
2237 3497 6.706270 GGACTCTGACATCAAACTCAACTTAA 59.294 38.462 0.00 0.00 0.00 1.85
2238 3498 7.389053 GGACTCTGACATCAAACTCAACTTAAT 59.611 37.037 0.00 0.00 0.00 1.40
2239 3499 9.424319 GACTCTGACATCAAACTCAACTTAATA 57.576 33.333 0.00 0.00 0.00 0.98
2240 3500 9.950496 ACTCTGACATCAAACTCAACTTAATAT 57.050 29.630 0.00 0.00 0.00 1.28
2300 3560 9.482175 AAGAATTATAACTAGAGGTCAGACAGT 57.518 33.333 2.17 0.00 0.00 3.55
2301 3561 8.908903 AGAATTATAACTAGAGGTCAGACAGTG 58.091 37.037 2.17 0.00 0.00 3.66
2302 3562 8.824756 AATTATAACTAGAGGTCAGACAGTGA 57.175 34.615 2.17 0.00 0.00 3.41
2303 3563 9.427821 AATTATAACTAGAGGTCAGACAGTGAT 57.572 33.333 2.17 0.00 37.56 3.06
2306 3566 6.707440 AACTAGAGGTCAGACAGTGATATG 57.293 41.667 2.17 0.00 37.56 1.78
2307 3567 6.007485 ACTAGAGGTCAGACAGTGATATGA 57.993 41.667 2.17 0.00 37.56 2.15
2308 3568 6.427441 ACTAGAGGTCAGACAGTGATATGAA 58.573 40.000 2.17 0.00 37.56 2.57
2309 3569 6.892456 ACTAGAGGTCAGACAGTGATATGAAA 59.108 38.462 2.17 0.00 37.56 2.69
2310 3570 6.611613 AGAGGTCAGACAGTGATATGAAAA 57.388 37.500 2.17 0.00 37.56 2.29
2311 3571 7.009179 AGAGGTCAGACAGTGATATGAAAAA 57.991 36.000 2.17 0.00 37.56 1.94
2332 3592 5.644977 AAAAGTATGCTTGTCCCTTTAGC 57.355 39.130 0.00 0.00 34.71 3.09
2334 3594 4.301072 AGTATGCTTGTCCCTTTAGCAA 57.699 40.909 0.00 0.00 46.78 3.91
2335 3595 4.010349 AGTATGCTTGTCCCTTTAGCAAC 58.990 43.478 0.00 0.00 46.78 4.17
2336 3596 2.656947 TGCTTGTCCCTTTAGCAACT 57.343 45.000 0.00 0.00 41.57 3.16
2337 3597 2.944129 TGCTTGTCCCTTTAGCAACTT 58.056 42.857 0.00 0.00 41.57 2.66
2338 3598 4.093472 TGCTTGTCCCTTTAGCAACTTA 57.907 40.909 0.00 0.00 41.57 2.24
2339 3599 4.662278 TGCTTGTCCCTTTAGCAACTTAT 58.338 39.130 0.00 0.00 41.57 1.73
2340 3600 5.811190 TGCTTGTCCCTTTAGCAACTTATA 58.189 37.500 0.00 0.00 41.57 0.98
2341 3601 6.423182 TGCTTGTCCCTTTAGCAACTTATAT 58.577 36.000 0.00 0.00 41.57 0.86
2342 3602 6.889722 TGCTTGTCCCTTTAGCAACTTATATT 59.110 34.615 0.00 0.00 41.57 1.28
2343 3603 8.050325 TGCTTGTCCCTTTAGCAACTTATATTA 58.950 33.333 0.00 0.00 41.57 0.98
2344 3604 8.560374 GCTTGTCCCTTTAGCAACTTATATTAG 58.440 37.037 0.00 0.00 35.05 1.73
2345 3605 9.614792 CTTGTCCCTTTAGCAACTTATATTAGT 57.385 33.333 0.00 0.00 0.00 2.24
2346 3606 9.969001 TTGTCCCTTTAGCAACTTATATTAGTT 57.031 29.630 1.26 1.26 38.87 2.24
2347 3607 9.609346 TGTCCCTTTAGCAACTTATATTAGTTC 57.391 33.333 4.15 1.24 36.24 3.01
2348 3608 9.833917 GTCCCTTTAGCAACTTATATTAGTTCT 57.166 33.333 4.15 7.64 36.24 3.01
2386 3646 9.394767 TGTTTCATGTAGCATATATCTTGTTGT 57.605 29.630 0.00 0.00 0.00 3.32
2387 3647 9.655769 GTTTCATGTAGCATATATCTTGTTGTG 57.344 33.333 0.00 0.00 0.00 3.33
2388 3648 7.967890 TCATGTAGCATATATCTTGTTGTGG 57.032 36.000 0.00 0.00 0.00 4.17
2389 3649 7.734942 TCATGTAGCATATATCTTGTTGTGGA 58.265 34.615 0.00 0.00 0.00 4.02
2390 3650 7.657354 TCATGTAGCATATATCTTGTTGTGGAC 59.343 37.037 0.00 0.00 0.00 4.02
2391 3651 6.288294 TGTAGCATATATCTTGTTGTGGACC 58.712 40.000 0.00 0.00 0.00 4.46
2392 3652 5.372343 AGCATATATCTTGTTGTGGACCA 57.628 39.130 0.00 0.00 0.00 4.02
2393 3653 5.126067 AGCATATATCTTGTTGTGGACCAC 58.874 41.667 18.28 18.28 34.56 4.16
2394 3654 4.881273 GCATATATCTTGTTGTGGACCACA 59.119 41.667 23.72 23.72 43.02 4.17
2395 3655 5.532406 GCATATATCTTGTTGTGGACCACAT 59.468 40.000 27.61 14.20 44.16 3.21
2396 3656 6.513884 GCATATATCTTGTTGTGGACCACATG 60.514 42.308 27.61 18.43 44.16 3.21
2397 3657 3.507162 ATCTTGTTGTGGACCACATGA 57.493 42.857 27.61 21.09 44.16 3.07
2398 3658 2.571212 TCTTGTTGTGGACCACATGAC 58.429 47.619 27.61 22.64 44.16 3.06
2399 3659 1.264020 CTTGTTGTGGACCACATGACG 59.736 52.381 27.61 13.04 44.16 4.35
2400 3660 0.533978 TGTTGTGGACCACATGACGG 60.534 55.000 27.61 1.45 44.16 4.79
2401 3661 0.534203 GTTGTGGACCACATGACGGT 60.534 55.000 27.61 10.74 44.16 4.83
2402 3662 1.049402 TTGTGGACCACATGACGGTA 58.951 50.000 27.61 8.49 44.16 4.02
2403 3663 0.606096 TGTGGACCACATGACGGTAG 59.394 55.000 23.72 0.00 39.62 3.18
2404 3664 0.892755 GTGGACCACATGACGGTAGA 59.107 55.000 20.14 0.00 36.69 2.59
2405 3665 1.135083 GTGGACCACATGACGGTAGAG 60.135 57.143 20.14 0.00 36.69 2.43
2406 3666 1.183549 GGACCACATGACGGTAGAGT 58.816 55.000 10.88 0.00 36.69 3.24
2407 3667 1.549170 GGACCACATGACGGTAGAGTT 59.451 52.381 10.88 0.00 36.69 3.01
2408 3668 2.756760 GGACCACATGACGGTAGAGTTA 59.243 50.000 10.88 0.00 36.69 2.24
2409 3669 3.383825 GGACCACATGACGGTAGAGTTAT 59.616 47.826 10.88 0.00 36.69 1.89
2410 3670 4.360563 GACCACATGACGGTAGAGTTATG 58.639 47.826 10.88 1.22 41.88 1.90
2411 3671 3.132289 ACCACATGACGGTAGAGTTATGG 59.868 47.826 9.43 0.00 40.89 2.74
2412 3672 3.132289 CCACATGACGGTAGAGTTATGGT 59.868 47.826 0.00 0.00 40.89 3.55
2413 3673 4.112634 CACATGACGGTAGAGTTATGGTG 58.887 47.826 0.00 0.00 40.89 4.17
2414 3674 2.953466 TGACGGTAGAGTTATGGTGC 57.047 50.000 0.00 0.00 0.00 5.01
2415 3675 2.453521 TGACGGTAGAGTTATGGTGCT 58.546 47.619 0.00 0.00 0.00 4.40
2416 3676 2.829720 TGACGGTAGAGTTATGGTGCTT 59.170 45.455 0.00 0.00 0.00 3.91
2417 3677 3.187700 GACGGTAGAGTTATGGTGCTTG 58.812 50.000 0.00 0.00 0.00 4.01
2418 3678 1.933853 CGGTAGAGTTATGGTGCTTGC 59.066 52.381 0.00 0.00 0.00 4.01
2419 3679 2.289565 GGTAGAGTTATGGTGCTTGCC 58.710 52.381 0.00 0.00 0.00 4.52
2420 3680 2.355716 GGTAGAGTTATGGTGCTTGCCA 60.356 50.000 0.00 0.00 43.48 4.92
2422 3682 3.091633 AGAGTTATGGTGCTTGCCATT 57.908 42.857 11.97 0.00 46.33 3.16
2423 3683 2.756760 AGAGTTATGGTGCTTGCCATTG 59.243 45.455 11.97 0.00 46.33 2.82
2424 3684 1.205417 AGTTATGGTGCTTGCCATTGC 59.795 47.619 11.97 6.97 46.33 3.56
2425 3685 1.205417 GTTATGGTGCTTGCCATTGCT 59.795 47.619 11.97 0.00 46.33 3.91
2426 3686 1.105457 TATGGTGCTTGCCATTGCTC 58.895 50.000 11.97 0.00 46.33 4.26
2427 3687 0.613853 ATGGTGCTTGCCATTGCTCT 60.614 50.000 2.86 0.00 46.33 4.09
2428 3688 0.828762 TGGTGCTTGCCATTGCTCTT 60.829 50.000 0.00 0.00 38.71 2.85
2429 3689 0.108945 GGTGCTTGCCATTGCTCTTC 60.109 55.000 0.00 0.00 38.71 2.87
2430 3690 0.886563 GTGCTTGCCATTGCTCTTCT 59.113 50.000 0.00 0.00 38.71 2.85
2431 3691 2.086869 GTGCTTGCCATTGCTCTTCTA 58.913 47.619 0.00 0.00 38.71 2.10
2432 3692 2.097142 GTGCTTGCCATTGCTCTTCTAG 59.903 50.000 0.00 0.00 38.71 2.43
2433 3693 2.026915 TGCTTGCCATTGCTCTTCTAGA 60.027 45.455 0.00 0.00 38.71 2.43
2434 3694 3.212685 GCTTGCCATTGCTCTTCTAGAT 58.787 45.455 0.00 0.00 38.71 1.98
2435 3695 4.141642 TGCTTGCCATTGCTCTTCTAGATA 60.142 41.667 0.00 0.00 38.71 1.98
2436 3696 4.213059 GCTTGCCATTGCTCTTCTAGATAC 59.787 45.833 0.00 0.00 38.71 2.24
2437 3697 5.609423 CTTGCCATTGCTCTTCTAGATACT 58.391 41.667 0.00 0.00 38.71 2.12
2438 3698 5.207110 TGCCATTGCTCTTCTAGATACTC 57.793 43.478 0.00 0.00 38.71 2.59
2439 3699 4.898265 TGCCATTGCTCTTCTAGATACTCT 59.102 41.667 0.00 0.00 38.71 3.24
2440 3700 6.071320 TGCCATTGCTCTTCTAGATACTCTA 58.929 40.000 0.00 0.00 38.71 2.43
2441 3701 6.208402 TGCCATTGCTCTTCTAGATACTCTAG 59.792 42.308 5.05 5.05 41.99 2.43
2442 3702 6.432783 GCCATTGCTCTTCTAGATACTCTAGA 59.567 42.308 9.31 9.31 42.85 2.43
2443 3703 7.362056 GCCATTGCTCTTCTAGATACTCTAGAG 60.362 44.444 18.49 18.49 43.97 2.43
2469 3729 9.865484 GAATTTTACTAATTCGTAGATCCTTGC 57.135 33.333 0.00 0.00 35.04 4.01
2470 3730 7.781548 TTTTACTAATTCGTAGATCCTTGCC 57.218 36.000 0.00 0.00 35.04 4.52
2471 3731 4.338379 ACTAATTCGTAGATCCTTGCCC 57.662 45.455 0.00 0.00 35.04 5.36
2532 3792 4.660789 AGCATGGGAAATTATCAAGTGC 57.339 40.909 0.00 0.00 33.06 4.40
2600 3860 2.231235 GGATTTTGGAAGTCGCCACAAT 59.769 45.455 0.00 0.00 40.14 2.71
2604 3864 0.396435 TGGAAGTCGCCACAATCACT 59.604 50.000 0.00 0.00 31.66 3.41
2631 3891 5.183140 TGATGTTTACAAGCTAAAAGCCCTC 59.817 40.000 0.00 0.00 43.77 4.30
2640 3900 3.134442 AGCTAAAAGCCCTCTCTCATCAG 59.866 47.826 0.00 0.00 43.77 2.90
2643 3903 4.647564 AAAAGCCCTCTCTCATCAGAAA 57.352 40.909 0.00 0.00 0.00 2.52
2686 3946 4.806640 AGATTATTTGGTGGCAAAGGTG 57.193 40.909 0.00 0.00 0.00 4.00
2701 3961 4.798263 GCAAAGGTGAATGCCCATATGATG 60.798 45.833 3.65 0.00 36.56 3.07
2707 3967 3.181446 TGAATGCCCATATGATGAACCGA 60.181 43.478 3.65 0.00 0.00 4.69
2713 3973 3.070159 CCCATATGATGAACCGACTGAGT 59.930 47.826 3.65 0.00 0.00 3.41
2818 4078 4.024670 GGAGTATTGGTCTGAGGTGTACT 58.975 47.826 0.00 0.00 0.00 2.73
2820 4080 4.417437 AGTATTGGTCTGAGGTGTACTGT 58.583 43.478 0.00 0.00 0.00 3.55
2836 4096 6.263617 GGTGTACTGTTCTATTGGTTTTGGAA 59.736 38.462 0.00 0.00 0.00 3.53
2842 4108 6.991938 TGTTCTATTGGTTTTGGAAATGGAG 58.008 36.000 0.00 0.00 0.00 3.86
2870 4136 3.577649 ACATGTCGAGAACACGAGAAT 57.422 42.857 0.00 0.00 41.75 2.40
2871 4137 4.696899 ACATGTCGAGAACACGAGAATA 57.303 40.909 0.00 0.00 41.75 1.75
2902 4168 7.605309 TGTCATTTAGCTATTATGATCTGCCTG 59.395 37.037 17.26 0.00 31.58 4.85
2904 4170 3.996921 AGCTATTATGATCTGCCTGGG 57.003 47.619 0.00 0.00 0.00 4.45
2924 4190 5.596845 TGGGCATTTAAGAACTTGTTTGTC 58.403 37.500 0.00 0.00 0.00 3.18
2929 4195 7.593644 GGCATTTAAGAACTTGTTTGTCGTATT 59.406 33.333 0.00 0.00 0.00 1.89
2949 4215 7.990886 TCGTATTTAAGCATTTACCCTGAAGAT 59.009 33.333 0.00 0.00 0.00 2.40
2954 4220 8.871629 TTAAGCATTTACCCTGAAGATTACAA 57.128 30.769 0.00 0.00 0.00 2.41
2961 4227 8.561738 TTTACCCTGAAGATTACAAGATCAAC 57.438 34.615 0.00 0.00 0.00 3.18
2986 4252 7.505585 ACAAAGAAACTTTGATATGGAAGTGGA 59.494 33.333 24.48 0.00 36.31 4.02
3013 4279 5.840940 CGAAGGTTTTATTCACGAAGACT 57.159 39.130 0.00 0.00 0.00 3.24
3076 4342 2.799412 GAGCTCGTGAATAGAAGCATGG 59.201 50.000 0.00 0.00 0.00 3.66
3078 4344 2.939103 GCTCGTGAATAGAAGCATGGTT 59.061 45.455 10.50 10.50 0.00 3.67
3091 4357 0.811616 CATGGTTCAGCCGGTAGAGC 60.812 60.000 1.90 3.26 41.21 4.09
3093 4359 1.295423 GGTTCAGCCGGTAGAGCAA 59.705 57.895 1.90 0.00 0.00 3.91
3094 4360 0.741221 GGTTCAGCCGGTAGAGCAAG 60.741 60.000 1.90 0.00 0.00 4.01
3096 4362 1.134670 GTTCAGCCGGTAGAGCAAGAT 60.135 52.381 1.90 0.00 0.00 2.40
3097 4363 0.461548 TCAGCCGGTAGAGCAAGATG 59.538 55.000 1.90 0.00 0.00 2.90
3100 4366 0.811616 GCCGGTAGAGCAAGATGGTG 60.812 60.000 1.90 0.00 0.00 4.17
3101 4367 0.811616 CCGGTAGAGCAAGATGGTGC 60.812 60.000 0.00 0.00 45.28 5.01
3102 4368 0.811616 CGGTAGAGCAAGATGGTGCC 60.812 60.000 0.00 0.00 46.14 5.01
3103 4369 0.253044 GGTAGAGCAAGATGGTGCCA 59.747 55.000 0.00 0.00 46.14 4.92
3104 4370 1.133976 GGTAGAGCAAGATGGTGCCAT 60.134 52.381 2.95 2.95 46.14 4.40
3105 4371 2.104792 GGTAGAGCAAGATGGTGCCATA 59.895 50.000 3.37 0.00 46.14 2.74
3106 4372 3.244700 GGTAGAGCAAGATGGTGCCATAT 60.245 47.826 3.37 0.00 46.14 1.78
3107 4373 4.020218 GGTAGAGCAAGATGGTGCCATATA 60.020 45.833 3.37 0.00 46.14 0.86
3108 4374 4.923516 AGAGCAAGATGGTGCCATATAT 57.076 40.909 3.37 0.00 46.14 0.86
3109 4375 4.586884 AGAGCAAGATGGTGCCATATATG 58.413 43.478 5.68 5.68 46.14 1.78
3110 4376 3.087031 AGCAAGATGGTGCCATATATGC 58.913 45.455 19.18 19.18 46.14 3.14
3112 4378 3.446161 GCAAGATGGTGCCATATATGCAT 59.554 43.478 20.68 3.79 41.46 3.96
3113 4379 4.676986 GCAAGATGGTGCCATATATGCATG 60.677 45.833 20.68 9.12 41.46 4.06
3114 4380 3.021695 AGATGGTGCCATATATGCATGC 58.978 45.455 11.82 11.82 41.46 4.06
3115 4381 2.289592 TGGTGCCATATATGCATGCA 57.710 45.000 25.04 25.04 41.46 3.96
3116 4382 2.810164 TGGTGCCATATATGCATGCAT 58.190 42.857 33.92 33.92 41.46 3.96
3117 4383 3.965694 TGGTGCCATATATGCATGCATA 58.034 40.909 35.71 35.71 41.46 3.14
3118 4384 3.949113 TGGTGCCATATATGCATGCATAG 59.051 43.478 36.05 26.12 41.51 2.23
3135 4407 4.999311 TGCATAGTTCATGATATGGTGCTC 59.001 41.667 15.05 2.75 36.69 4.26
3144 4416 6.510536 TCATGATATGGTGCTCGATATGATC 58.489 40.000 7.86 0.00 0.00 2.92
3145 4417 5.268118 TGATATGGTGCTCGATATGATCC 57.732 43.478 7.86 0.00 0.00 3.36
3153 4425 3.989817 TGCTCGATATGATCCGTTCATTG 59.010 43.478 3.73 0.00 42.62 2.82
3156 4428 4.226761 TCGATATGATCCGTTCATTGTCG 58.773 43.478 17.39 17.39 42.62 4.35
3159 4431 5.346011 CGATATGATCCGTTCATTGTCGAAT 59.654 40.000 18.02 3.29 45.20 3.34
3163 4435 3.586100 TCCGTTCATTGTCGAATGAGA 57.414 42.857 0.41 0.00 46.83 3.27
3168 4440 5.339611 CCGTTCATTGTCGAATGAGAAAAAC 59.660 40.000 0.41 0.00 46.83 2.43
3176 4448 9.965824 ATTGTCGAATGAGAAAAACTTTGTTAT 57.034 25.926 0.00 0.00 30.35 1.89
3204 4476 1.983224 TGGTACAGAGGAAGCAGCC 59.017 57.895 0.00 0.00 0.00 4.85
3205 4477 0.835971 TGGTACAGAGGAAGCAGCCA 60.836 55.000 0.00 0.00 0.00 4.75
3207 4479 0.321671 GTACAGAGGAAGCAGCCACA 59.678 55.000 0.00 0.00 0.00 4.17
3210 4482 0.747283 CAGAGGAAGCAGCCACATCC 60.747 60.000 0.00 0.00 0.00 3.51
3211 4483 0.913451 AGAGGAAGCAGCCACATCCT 60.913 55.000 6.40 6.40 44.85 3.24
3212 4484 1.606531 AGGAAGCAGCCACATCCTC 59.393 57.895 1.70 0.00 37.80 3.71
3213 4485 1.452833 GGAAGCAGCCACATCCTCC 60.453 63.158 0.00 0.00 0.00 4.30
3214 4486 1.452833 GAAGCAGCCACATCCTCCC 60.453 63.158 0.00 0.00 0.00 4.30
3216 4488 4.101448 GCAGCCACATCCTCCCGT 62.101 66.667 0.00 0.00 0.00 5.28
3217 4489 2.731571 GCAGCCACATCCTCCCGTA 61.732 63.158 0.00 0.00 0.00 4.02
3218 4490 2.044806 GCAGCCACATCCTCCCGTAT 62.045 60.000 0.00 0.00 0.00 3.06
3219 4491 1.338107 CAGCCACATCCTCCCGTATA 58.662 55.000 0.00 0.00 0.00 1.47
3225 4497 3.244561 CCACATCCTCCCGTATAAATGCT 60.245 47.826 0.00 0.00 0.00 3.79
3228 4500 2.313317 TCCTCCCGTATAAATGCTCGT 58.687 47.619 0.00 0.00 0.00 4.18
3237 4509 4.620184 CGTATAAATGCTCGTAGGTTAGCC 59.380 45.833 0.00 0.00 37.97 3.93
3238 4510 4.682778 ATAAATGCTCGTAGGTTAGCCA 57.317 40.909 0.00 0.00 37.97 4.75
3249 4521 2.728007 AGGTTAGCCATCCAAAAGAGC 58.272 47.619 0.00 0.00 37.19 4.09
3250 4522 2.041620 AGGTTAGCCATCCAAAAGAGCA 59.958 45.455 0.00 0.00 37.19 4.26
3251 4523 3.026694 GGTTAGCCATCCAAAAGAGCAT 58.973 45.455 0.00 0.00 34.09 3.79
3252 4524 3.067320 GGTTAGCCATCCAAAAGAGCATC 59.933 47.826 0.00 0.00 34.09 3.91
3253 4525 1.386533 AGCCATCCAAAAGAGCATCG 58.613 50.000 0.00 0.00 42.67 3.84
3254 4526 1.098050 GCCATCCAAAAGAGCATCGT 58.902 50.000 0.00 0.00 42.67 3.73
3255 4527 2.092968 AGCCATCCAAAAGAGCATCGTA 60.093 45.455 0.00 0.00 42.67 3.43
3256 4528 2.289002 GCCATCCAAAAGAGCATCGTAG 59.711 50.000 0.00 0.00 42.67 3.51
3257 4529 3.797039 CCATCCAAAAGAGCATCGTAGA 58.203 45.455 0.00 0.00 42.67 2.59
3258 4530 3.806521 CCATCCAAAAGAGCATCGTAGAG 59.193 47.826 0.00 0.00 43.63 2.43
3259 4531 2.893637 TCCAAAAGAGCATCGTAGAGC 58.106 47.619 0.00 0.00 43.63 4.09
3260 4532 1.936547 CCAAAAGAGCATCGTAGAGCC 59.063 52.381 0.00 0.00 43.63 4.70
3261 4533 2.621338 CAAAAGAGCATCGTAGAGCCA 58.379 47.619 0.00 0.00 43.63 4.75
3262 4534 2.301577 AAAGAGCATCGTAGAGCCAC 57.698 50.000 0.00 0.00 43.63 5.01
3263 4535 1.186200 AAGAGCATCGTAGAGCCACA 58.814 50.000 0.00 0.00 43.63 4.17
3264 4536 0.457851 AGAGCATCGTAGAGCCACAC 59.542 55.000 0.00 0.00 43.63 3.82
3265 4537 0.173481 GAGCATCGTAGAGCCACACA 59.827 55.000 0.00 0.00 43.63 3.72
3266 4538 0.826715 AGCATCGTAGAGCCACACAT 59.173 50.000 0.00 0.00 43.63 3.21
3267 4539 1.208052 AGCATCGTAGAGCCACACATT 59.792 47.619 0.00 0.00 43.63 2.71
3268 4540 2.430694 AGCATCGTAGAGCCACACATTA 59.569 45.455 0.00 0.00 43.63 1.90
3269 4541 3.118775 AGCATCGTAGAGCCACACATTAA 60.119 43.478 0.00 0.00 43.63 1.40
3270 4542 3.001330 GCATCGTAGAGCCACACATTAAC 59.999 47.826 0.00 0.00 43.63 2.01
3271 4543 3.241067 TCGTAGAGCCACACATTAACC 57.759 47.619 0.00 0.00 0.00 2.85
3272 4544 2.829720 TCGTAGAGCCACACATTAACCT 59.170 45.455 0.00 0.00 0.00 3.50
3273 4545 3.259876 TCGTAGAGCCACACATTAACCTT 59.740 43.478 0.00 0.00 0.00 3.50
3274 4546 4.000988 CGTAGAGCCACACATTAACCTTT 58.999 43.478 0.00 0.00 0.00 3.11
3275 4547 4.454504 CGTAGAGCCACACATTAACCTTTT 59.545 41.667 0.00 0.00 0.00 2.27
3276 4548 4.853924 AGAGCCACACATTAACCTTTTG 57.146 40.909 0.00 0.00 0.00 2.44
3277 4549 4.215109 AGAGCCACACATTAACCTTTTGT 58.785 39.130 0.00 0.00 0.00 2.83
3278 4550 4.278419 AGAGCCACACATTAACCTTTTGTC 59.722 41.667 0.00 0.00 0.00 3.18
3279 4551 4.215109 AGCCACACATTAACCTTTTGTCT 58.785 39.130 0.00 0.00 0.00 3.41
3280 4552 5.381757 AGCCACACATTAACCTTTTGTCTA 58.618 37.500 0.00 0.00 0.00 2.59
3281 4553 5.830991 AGCCACACATTAACCTTTTGTCTAA 59.169 36.000 0.00 0.00 0.00 2.10
3282 4554 5.918576 GCCACACATTAACCTTTTGTCTAAC 59.081 40.000 0.00 0.00 0.00 2.34
3283 4555 6.460399 GCCACACATTAACCTTTTGTCTAACA 60.460 38.462 0.00 0.00 0.00 2.41
3284 4556 6.915843 CCACACATTAACCTTTTGTCTAACAC 59.084 38.462 0.00 0.00 0.00 3.32
3285 4557 7.415765 CCACACATTAACCTTTTGTCTAACACA 60.416 37.037 0.00 0.00 0.00 3.72
3286 4558 7.431084 CACACATTAACCTTTTGTCTAACACAC 59.569 37.037 0.00 0.00 33.41 3.82
3287 4559 7.121463 ACACATTAACCTTTTGTCTAACACACA 59.879 33.333 0.00 0.00 33.41 3.72
3288 4560 7.431084 CACATTAACCTTTTGTCTAACACACAC 59.569 37.037 0.00 0.00 33.41 3.82
3289 4561 7.338449 ACATTAACCTTTTGTCTAACACACACT 59.662 33.333 0.00 0.00 33.41 3.55
3290 4562 7.690952 TTAACCTTTTGTCTAACACACACTT 57.309 32.000 0.00 0.00 33.41 3.16
3291 4563 5.560966 ACCTTTTGTCTAACACACACTTG 57.439 39.130 0.00 0.00 33.41 3.16
3292 4564 5.007682 ACCTTTTGTCTAACACACACTTGT 58.992 37.500 0.00 0.00 33.41 3.16
3293 4565 5.123344 ACCTTTTGTCTAACACACACTTGTC 59.877 40.000 0.00 0.00 33.41 3.18
3294 4566 4.850859 TTTGTCTAACACACACTTGTCG 57.149 40.909 0.00 0.00 33.41 4.35
3295 4567 2.198406 TGTCTAACACACACTTGTCGC 58.802 47.619 0.00 0.00 31.66 5.19
3296 4568 2.198406 GTCTAACACACACTTGTCGCA 58.802 47.619 0.00 0.00 31.66 5.10
3297 4569 2.605818 GTCTAACACACACTTGTCGCAA 59.394 45.455 0.00 0.00 31.66 4.85
3298 4570 2.863740 TCTAACACACACTTGTCGCAAG 59.136 45.455 15.16 15.16 31.66 4.01
3299 4571 1.448985 AACACACACTTGTCGCAAGT 58.551 45.000 16.24 16.24 31.66 3.16
3305 4577 3.290776 ACTTGTCGCAAGTGAGGTC 57.709 52.632 19.72 0.00 39.48 3.85
3306 4578 0.597637 ACTTGTCGCAAGTGAGGTCG 60.598 55.000 19.72 0.00 39.48 4.79
3307 4579 0.597637 CTTGTCGCAAGTGAGGTCGT 60.598 55.000 10.30 0.00 39.48 4.34
3308 4580 0.179094 TTGTCGCAAGTGAGGTCGTT 60.179 50.000 0.00 0.00 39.48 3.85
3309 4581 0.596600 TGTCGCAAGTGAGGTCGTTC 60.597 55.000 0.00 0.00 39.48 3.95
3310 4582 0.596600 GTCGCAAGTGAGGTCGTTCA 60.597 55.000 0.00 0.00 39.48 3.18
3311 4583 0.103390 TCGCAAGTGAGGTCGTTCAA 59.897 50.000 0.00 0.00 39.48 2.69
3312 4584 0.232303 CGCAAGTGAGGTCGTTCAAC 59.768 55.000 0.00 0.00 0.00 3.18
3313 4585 0.232303 GCAAGTGAGGTCGTTCAACG 59.768 55.000 2.64 2.64 44.19 4.10
3314 4586 0.232303 CAAGTGAGGTCGTTCAACGC 59.768 55.000 4.63 0.00 42.21 4.84
3315 4587 1.213094 AAGTGAGGTCGTTCAACGCG 61.213 55.000 4.63 3.53 42.21 6.01
3316 4588 1.659335 GTGAGGTCGTTCAACGCGA 60.659 57.895 15.93 0.00 42.21 5.87
3321 4593 3.963647 TCGTTCAACGCGACCGGA 61.964 61.111 15.93 0.70 42.21 5.14
3322 4594 2.807895 CGTTCAACGCGACCGGAT 60.808 61.111 15.93 0.00 39.22 4.18
3323 4595 2.776072 GTTCAACGCGACCGGATG 59.224 61.111 15.93 0.00 39.22 3.51
3324 4596 2.025418 GTTCAACGCGACCGGATGT 61.025 57.895 15.93 0.00 39.22 3.06
3325 4597 1.735198 TTCAACGCGACCGGATGTC 60.735 57.895 15.93 0.00 40.81 3.06
3334 4606 1.717194 GACCGGATGTCGTTTTAGCA 58.283 50.000 9.46 0.00 37.11 3.49
3335 4607 1.392510 GACCGGATGTCGTTTTAGCAC 59.607 52.381 9.46 0.00 37.11 4.40
3336 4608 1.270412 ACCGGATGTCGTTTTAGCACA 60.270 47.619 9.46 0.00 37.11 4.57
3337 4609 1.127951 CCGGATGTCGTTTTAGCACAC 59.872 52.381 0.00 0.00 37.11 3.82
3338 4610 1.127951 CGGATGTCGTTTTAGCACACC 59.872 52.381 0.00 0.00 0.00 4.16
3339 4611 2.147958 GGATGTCGTTTTAGCACACCA 58.852 47.619 0.00 0.00 0.00 4.17
3340 4612 2.550606 GGATGTCGTTTTAGCACACCAA 59.449 45.455 0.00 0.00 0.00 3.67
3341 4613 3.190535 GGATGTCGTTTTAGCACACCAAT 59.809 43.478 0.00 0.00 0.00 3.16
3342 4614 3.617540 TGTCGTTTTAGCACACCAATG 57.382 42.857 0.00 0.00 0.00 2.82
3343 4615 3.206964 TGTCGTTTTAGCACACCAATGA 58.793 40.909 0.00 0.00 0.00 2.57
3344 4616 3.002862 TGTCGTTTTAGCACACCAATGAC 59.997 43.478 0.00 0.00 36.22 3.06
3345 4617 2.222213 TCGTTTTAGCACACCAATGACG 59.778 45.455 0.00 0.00 0.00 4.35
3346 4618 2.315901 GTTTTAGCACACCAATGACGC 58.684 47.619 0.00 0.00 0.00 5.19
3347 4619 1.890876 TTTAGCACACCAATGACGCT 58.109 45.000 0.00 0.00 40.00 5.07
3348 4620 1.155889 TTAGCACACCAATGACGCTG 58.844 50.000 0.00 0.00 38.19 5.18
3349 4621 0.034756 TAGCACACCAATGACGCTGT 59.965 50.000 0.00 0.00 38.19 4.40
3350 4622 1.207593 GCACACCAATGACGCTGTC 59.792 57.895 2.32 2.32 0.00 3.51
3351 4623 1.230635 GCACACCAATGACGCTGTCT 61.231 55.000 9.49 0.00 33.15 3.41
3352 4624 0.792640 CACACCAATGACGCTGTCTC 59.207 55.000 9.49 0.00 33.15 3.36
3353 4625 0.681733 ACACCAATGACGCTGTCTCT 59.318 50.000 9.49 0.00 33.15 3.10
3354 4626 1.070758 ACACCAATGACGCTGTCTCTT 59.929 47.619 9.49 2.29 33.15 2.85
3355 4627 2.146342 CACCAATGACGCTGTCTCTTT 58.854 47.619 9.49 0.51 33.15 2.52
3356 4628 2.158449 CACCAATGACGCTGTCTCTTTC 59.842 50.000 9.49 0.00 33.15 2.62
3357 4629 2.224281 ACCAATGACGCTGTCTCTTTCA 60.224 45.455 9.49 0.00 33.15 2.69
3358 4630 2.807967 CCAATGACGCTGTCTCTTTCAA 59.192 45.455 9.49 0.00 33.15 2.69
3359 4631 3.120408 CCAATGACGCTGTCTCTTTCAAG 60.120 47.826 9.49 0.00 33.15 3.02
3360 4632 1.502231 TGACGCTGTCTCTTTCAAGC 58.498 50.000 9.49 0.00 33.15 4.01
3361 4633 1.069204 TGACGCTGTCTCTTTCAAGCT 59.931 47.619 9.49 0.00 33.15 3.74
3362 4634 2.139118 GACGCTGTCTCTTTCAAGCTT 58.861 47.619 0.00 0.00 0.00 3.74
3363 4635 2.545946 GACGCTGTCTCTTTCAAGCTTT 59.454 45.455 0.00 0.00 0.00 3.51
3364 4636 2.945668 ACGCTGTCTCTTTCAAGCTTTT 59.054 40.909 0.00 0.00 0.00 2.27
3365 4637 3.242870 ACGCTGTCTCTTTCAAGCTTTTG 60.243 43.478 0.00 0.00 0.00 2.44
3384 4656 4.808649 GCTTTACGCGTCCTAGCT 57.191 55.556 18.63 0.00 34.40 3.32
3385 4657 3.932459 GCTTTACGCGTCCTAGCTA 57.068 52.632 18.63 0.00 34.40 3.32
3386 4658 2.418983 GCTTTACGCGTCCTAGCTAT 57.581 50.000 18.63 0.00 34.40 2.97
3387 4659 2.052157 GCTTTACGCGTCCTAGCTATG 58.948 52.381 18.63 0.00 34.40 2.23
3388 4660 2.662700 CTTTACGCGTCCTAGCTATGG 58.337 52.381 18.63 0.00 34.40 2.74
3389 4661 1.971481 TTACGCGTCCTAGCTATGGA 58.029 50.000 18.63 7.59 34.40 3.41
3390 4662 1.971481 TACGCGTCCTAGCTATGGAA 58.029 50.000 18.63 0.00 35.10 3.53
3391 4663 1.108776 ACGCGTCCTAGCTATGGAAA 58.891 50.000 5.58 0.00 35.10 3.13
3392 4664 1.067212 ACGCGTCCTAGCTATGGAAAG 59.933 52.381 5.58 10.58 35.10 2.62
3393 4665 1.337071 CGCGTCCTAGCTATGGAAAGA 59.663 52.381 11.94 0.00 35.10 2.52
3394 4666 2.029828 CGCGTCCTAGCTATGGAAAGAT 60.030 50.000 11.94 0.00 35.10 2.40
3395 4667 3.321497 GCGTCCTAGCTATGGAAAGATG 58.679 50.000 11.94 2.61 35.10 2.90
3396 4668 3.321497 CGTCCTAGCTATGGAAAGATGC 58.679 50.000 11.94 1.33 35.10 3.91
3397 4669 3.243873 CGTCCTAGCTATGGAAAGATGCA 60.244 47.826 11.94 0.00 35.10 3.96
3398 4670 4.061596 GTCCTAGCTATGGAAAGATGCAC 58.938 47.826 11.94 0.00 35.10 4.57
3399 4671 3.969976 TCCTAGCTATGGAAAGATGCACT 59.030 43.478 8.87 0.00 0.00 4.40
3400 4672 4.410228 TCCTAGCTATGGAAAGATGCACTT 59.590 41.667 8.87 0.00 40.98 3.16
3409 4681 3.904136 AAAGATGCACTTTCACCGAAG 57.096 42.857 8.03 0.00 44.36 3.79
3410 4682 2.154462 AAGATGCACTTTCACCGAAGG 58.846 47.619 0.00 0.00 46.11 3.46
3411 4683 3.708615 AAGATGCACTTTCACCGAAGGC 61.709 50.000 0.00 0.00 44.91 4.35
3424 4696 1.876156 CCGAAGGCCATCTTTATCAGC 59.124 52.381 5.01 0.00 46.14 4.26
3425 4697 1.876156 CGAAGGCCATCTTTATCAGCC 59.124 52.381 5.01 0.00 44.20 4.85
3426 4698 2.234143 GAAGGCCATCTTTATCAGCCC 58.766 52.381 5.01 0.00 45.00 5.19
3427 4699 0.109342 AGGCCATCTTTATCAGCCCG 59.891 55.000 5.01 0.00 45.00 6.13
3428 4700 0.108585 GGCCATCTTTATCAGCCCGA 59.891 55.000 0.00 0.00 37.66 5.14
3429 4701 1.517242 GCCATCTTTATCAGCCCGAG 58.483 55.000 0.00 0.00 0.00 4.63
3430 4702 1.517242 CCATCTTTATCAGCCCGAGC 58.483 55.000 0.00 0.00 40.32 5.03
3431 4703 1.202687 CCATCTTTATCAGCCCGAGCA 60.203 52.381 0.00 0.00 43.56 4.26
3432 4704 2.551721 CCATCTTTATCAGCCCGAGCAT 60.552 50.000 0.00 0.00 43.56 3.79
3433 4705 2.245159 TCTTTATCAGCCCGAGCATG 57.755 50.000 0.00 0.00 43.56 4.06
3434 4706 1.486310 TCTTTATCAGCCCGAGCATGT 59.514 47.619 0.00 0.00 43.56 3.21
3435 4707 1.869767 CTTTATCAGCCCGAGCATGTC 59.130 52.381 0.00 0.00 43.56 3.06
3443 4715 2.579201 CGAGCATGTCGGGAGGTT 59.421 61.111 9.07 0.00 45.58 3.50
3444 4716 1.811266 CGAGCATGTCGGGAGGTTG 60.811 63.158 9.07 0.00 45.58 3.77
3445 4717 2.045926 AGCATGTCGGGAGGTTGC 60.046 61.111 0.00 0.00 0.00 4.17
3446 4718 2.045926 GCATGTCGGGAGGTTGCT 60.046 61.111 0.00 0.00 0.00 3.91
3447 4719 1.675641 GCATGTCGGGAGGTTGCTT 60.676 57.895 0.00 0.00 0.00 3.91
3448 4720 1.648467 GCATGTCGGGAGGTTGCTTC 61.648 60.000 0.00 0.00 0.00 3.86
3449 4721 0.321564 CATGTCGGGAGGTTGCTTCA 60.322 55.000 0.00 0.00 0.00 3.02
3450 4722 0.036010 ATGTCGGGAGGTTGCTTCAG 60.036 55.000 0.00 0.00 0.00 3.02
3451 4723 1.371558 GTCGGGAGGTTGCTTCAGT 59.628 57.895 0.00 0.00 0.00 3.41
3452 4724 0.250338 GTCGGGAGGTTGCTTCAGTT 60.250 55.000 0.00 0.00 0.00 3.16
3453 4725 0.250295 TCGGGAGGTTGCTTCAGTTG 60.250 55.000 0.00 0.00 0.00 3.16
3454 4726 0.250295 CGGGAGGTTGCTTCAGTTGA 60.250 55.000 0.00 0.00 0.00 3.18
3455 4727 1.528129 GGGAGGTTGCTTCAGTTGAG 58.472 55.000 0.00 0.00 0.00 3.02
3456 4728 1.528129 GGAGGTTGCTTCAGTTGAGG 58.472 55.000 0.00 0.00 0.00 3.86
3457 4729 1.202818 GGAGGTTGCTTCAGTTGAGGT 60.203 52.381 0.00 0.00 0.00 3.85
3458 4730 2.038557 GGAGGTTGCTTCAGTTGAGGTA 59.961 50.000 0.00 0.00 0.00 3.08
3459 4731 3.067833 GAGGTTGCTTCAGTTGAGGTAC 58.932 50.000 0.00 0.00 0.00 3.34
3460 4732 2.152016 GGTTGCTTCAGTTGAGGTACC 58.848 52.381 2.73 2.73 0.00 3.34
3461 4733 2.224548 GGTTGCTTCAGTTGAGGTACCT 60.225 50.000 16.26 16.26 30.92 3.08
3462 4734 3.007614 GGTTGCTTCAGTTGAGGTACCTA 59.992 47.826 16.29 0.00 30.92 3.08
3463 4735 4.246458 GTTGCTTCAGTTGAGGTACCTAG 58.754 47.826 16.29 7.87 0.00 3.02
3464 4736 2.832129 TGCTTCAGTTGAGGTACCTAGG 59.168 50.000 16.29 7.41 0.00 3.02
3465 4737 2.832733 GCTTCAGTTGAGGTACCTAGGT 59.167 50.000 20.57 20.57 0.00 3.08
3466 4738 3.119065 GCTTCAGTTGAGGTACCTAGGTC 60.119 52.174 20.32 10.20 0.00 3.85
3467 4739 4.345854 CTTCAGTTGAGGTACCTAGGTCT 58.654 47.826 20.32 10.67 0.00 3.85
3468 4740 4.399483 TCAGTTGAGGTACCTAGGTCTT 57.601 45.455 20.32 6.69 0.00 3.01
3469 4741 4.748701 TCAGTTGAGGTACCTAGGTCTTT 58.251 43.478 20.32 4.52 0.00 2.52
3470 4742 5.895807 TCAGTTGAGGTACCTAGGTCTTTA 58.104 41.667 20.32 0.00 0.00 1.85
3471 4743 5.713861 TCAGTTGAGGTACCTAGGTCTTTAC 59.286 44.000 20.32 11.08 0.00 2.01
3472 4744 5.479375 CAGTTGAGGTACCTAGGTCTTTACA 59.521 44.000 20.32 10.82 0.00 2.41
3473 4745 5.715753 AGTTGAGGTACCTAGGTCTTTACAG 59.284 44.000 20.32 0.00 0.00 2.74
3474 4746 5.266709 TGAGGTACCTAGGTCTTTACAGT 57.733 43.478 20.32 1.93 0.00 3.55
3475 4747 6.392911 TGAGGTACCTAGGTCTTTACAGTA 57.607 41.667 20.32 0.00 0.00 2.74
3476 4748 6.183347 TGAGGTACCTAGGTCTTTACAGTAC 58.817 44.000 20.32 7.44 0.00 2.73
3477 4749 6.144845 AGGTACCTAGGTCTTTACAGTACA 57.855 41.667 20.32 0.00 32.25 2.90
3478 4750 5.948758 AGGTACCTAGGTCTTTACAGTACAC 59.051 44.000 20.32 6.08 32.25 2.90
3479 4751 5.163713 GGTACCTAGGTCTTTACAGTACACG 60.164 48.000 20.32 0.00 32.25 4.49
3480 4752 4.401925 ACCTAGGTCTTTACAGTACACGT 58.598 43.478 9.21 0.00 0.00 4.49
3481 4753 5.560724 ACCTAGGTCTTTACAGTACACGTA 58.439 41.667 9.21 0.00 0.00 3.57
3482 4754 5.412904 ACCTAGGTCTTTACAGTACACGTAC 59.587 44.000 9.21 0.00 36.35 3.67
3483 4755 5.645497 CCTAGGTCTTTACAGTACACGTACT 59.355 44.000 0.00 3.99 46.52 2.73
3484 4756 5.619625 AGGTCTTTACAGTACACGTACTC 57.380 43.478 6.89 0.00 43.98 2.59
3485 4757 5.312079 AGGTCTTTACAGTACACGTACTCT 58.688 41.667 6.89 0.00 43.98 3.24
3486 4758 5.767168 AGGTCTTTACAGTACACGTACTCTT 59.233 40.000 6.89 0.84 43.98 2.85
3487 4759 5.855395 GGTCTTTACAGTACACGTACTCTTG 59.145 44.000 6.89 0.85 43.98 3.02
3488 4760 6.293626 GGTCTTTACAGTACACGTACTCTTGA 60.294 42.308 6.89 0.40 43.98 3.02
3489 4761 6.796072 GTCTTTACAGTACACGTACTCTTGAG 59.204 42.308 6.89 4.50 43.98 3.02
3490 4762 3.555917 ACAGTACACGTACTCTTGAGC 57.444 47.619 6.89 0.00 43.98 4.26
3491 4763 3.147629 ACAGTACACGTACTCTTGAGCT 58.852 45.455 6.89 0.00 43.98 4.09
3492 4764 3.188873 ACAGTACACGTACTCTTGAGCTC 59.811 47.826 6.82 6.82 43.98 4.09
3493 4765 2.748532 AGTACACGTACTCTTGAGCTCC 59.251 50.000 12.15 0.00 42.30 4.70
3494 4766 0.889306 ACACGTACTCTTGAGCTCCC 59.111 55.000 12.15 0.00 0.00 4.30
3495 4767 1.178276 CACGTACTCTTGAGCTCCCT 58.822 55.000 12.15 0.00 0.00 4.20
3496 4768 1.135257 CACGTACTCTTGAGCTCCCTG 60.135 57.143 12.15 1.12 0.00 4.45
3497 4769 1.271982 ACGTACTCTTGAGCTCCCTGA 60.272 52.381 12.15 5.78 0.00 3.86
3498 4770 1.819288 CGTACTCTTGAGCTCCCTGAA 59.181 52.381 12.15 0.00 0.00 3.02
3499 4771 2.159310 CGTACTCTTGAGCTCCCTGAAG 60.159 54.545 12.15 8.22 34.12 3.02
3500 4772 2.317371 ACTCTTGAGCTCCCTGAAGA 57.683 50.000 12.15 12.21 38.70 2.87
3501 4773 2.614259 ACTCTTGAGCTCCCTGAAGAA 58.386 47.619 12.15 0.00 40.12 2.52
3502 4774 2.975489 ACTCTTGAGCTCCCTGAAGAAA 59.025 45.455 12.15 0.00 40.12 2.52
3503 4775 3.586618 ACTCTTGAGCTCCCTGAAGAAAT 59.413 43.478 12.15 2.18 40.12 2.17
3504 4776 4.780021 ACTCTTGAGCTCCCTGAAGAAATA 59.220 41.667 12.15 0.00 40.12 1.40
3505 4777 5.104982 ACTCTTGAGCTCCCTGAAGAAATAG 60.105 44.000 12.15 4.42 40.12 1.73
3506 4778 4.163078 TCTTGAGCTCCCTGAAGAAATAGG 59.837 45.833 12.15 0.00 38.18 2.57
3515 4787 5.839517 CCTGAAGAAATAGGGGATCTGAT 57.160 43.478 0.00 0.00 0.00 2.90
3516 4788 5.558818 CCTGAAGAAATAGGGGATCTGATG 58.441 45.833 0.00 0.00 0.00 3.07
3517 4789 5.072872 CCTGAAGAAATAGGGGATCTGATGT 59.927 44.000 0.00 0.00 0.00 3.06
3518 4790 6.410157 CCTGAAGAAATAGGGGATCTGATGTT 60.410 42.308 0.00 0.00 0.00 2.71
3519 4791 6.359804 TGAAGAAATAGGGGATCTGATGTTG 58.640 40.000 0.00 0.00 0.00 3.33
3520 4792 5.983333 AGAAATAGGGGATCTGATGTTGT 57.017 39.130 0.00 0.00 0.00 3.32
3521 4793 6.332976 AGAAATAGGGGATCTGATGTTGTT 57.667 37.500 0.00 0.00 0.00 2.83
3522 4794 6.125029 AGAAATAGGGGATCTGATGTTGTTG 58.875 40.000 0.00 0.00 0.00 3.33
3523 4795 2.134789 AGGGGATCTGATGTTGTTGC 57.865 50.000 0.00 0.00 0.00 4.17
3524 4796 1.355381 AGGGGATCTGATGTTGTTGCA 59.645 47.619 0.00 0.00 0.00 4.08
3525 4797 1.747355 GGGGATCTGATGTTGTTGCAG 59.253 52.381 0.00 0.00 0.00 4.41
3526 4798 2.618816 GGGGATCTGATGTTGTTGCAGA 60.619 50.000 0.00 0.00 42.25 4.26
3527 4799 2.421424 GGGATCTGATGTTGTTGCAGAC 59.579 50.000 0.00 0.00 41.02 3.51
3528 4800 3.076621 GGATCTGATGTTGTTGCAGACA 58.923 45.455 0.00 2.71 41.02 3.41
3529 4801 3.120060 GGATCTGATGTTGTTGCAGACAC 60.120 47.826 0.00 0.00 41.02 3.67
3530 4802 2.221169 TCTGATGTTGTTGCAGACACC 58.779 47.619 2.33 0.00 38.18 4.16
3531 4803 0.943673 TGATGTTGTTGCAGACACCG 59.056 50.000 2.33 0.00 38.18 4.94
3532 4804 0.238289 GATGTTGTTGCAGACACCGG 59.762 55.000 0.00 0.00 38.18 5.28
3533 4805 0.179032 ATGTTGTTGCAGACACCGGA 60.179 50.000 9.46 0.00 38.18 5.14
3534 4806 1.092921 TGTTGTTGCAGACACCGGAC 61.093 55.000 9.46 0.00 38.18 4.79
3535 4807 0.814010 GTTGTTGCAGACACCGGACT 60.814 55.000 9.46 0.87 38.18 3.85
3536 4808 0.107410 TTGTTGCAGACACCGGACTT 60.107 50.000 9.46 0.00 38.18 3.01
3537 4809 0.813610 TGTTGCAGACACCGGACTTG 60.814 55.000 9.46 0.00 32.00 3.16
3538 4810 0.531974 GTTGCAGACACCGGACTTGA 60.532 55.000 9.46 0.00 0.00 3.02
3539 4811 0.249868 TTGCAGACACCGGACTTGAG 60.250 55.000 9.46 0.00 0.00 3.02
3540 4812 1.112916 TGCAGACACCGGACTTGAGA 61.113 55.000 9.46 0.00 0.00 3.27
3541 4813 0.247736 GCAGACACCGGACTTGAGAT 59.752 55.000 9.46 0.00 0.00 2.75
3542 4814 1.338200 GCAGACACCGGACTTGAGATT 60.338 52.381 9.46 0.00 0.00 2.40
3543 4815 2.872038 GCAGACACCGGACTTGAGATTT 60.872 50.000 9.46 0.00 0.00 2.17
3544 4816 3.616560 GCAGACACCGGACTTGAGATTTA 60.617 47.826 9.46 0.00 0.00 1.40
3545 4817 4.177026 CAGACACCGGACTTGAGATTTAG 58.823 47.826 9.46 0.00 0.00 1.85
3546 4818 3.833070 AGACACCGGACTTGAGATTTAGT 59.167 43.478 9.46 0.00 0.00 2.24
3547 4819 3.926616 ACACCGGACTTGAGATTTAGTG 58.073 45.455 9.46 0.00 0.00 2.74
3548 4820 3.262420 CACCGGACTTGAGATTTAGTGG 58.738 50.000 9.46 0.00 0.00 4.00
3549 4821 2.236395 ACCGGACTTGAGATTTAGTGGG 59.764 50.000 9.46 0.00 0.00 4.61
3550 4822 2.500098 CCGGACTTGAGATTTAGTGGGA 59.500 50.000 0.00 0.00 0.00 4.37
3551 4823 3.134804 CCGGACTTGAGATTTAGTGGGAT 59.865 47.826 0.00 0.00 0.00 3.85
3552 4824 4.344102 CCGGACTTGAGATTTAGTGGGATA 59.656 45.833 0.00 0.00 0.00 2.59
3553 4825 5.163343 CCGGACTTGAGATTTAGTGGGATAA 60.163 44.000 0.00 0.00 0.00 1.75
3554 4826 6.346096 CGGACTTGAGATTTAGTGGGATAAA 58.654 40.000 0.00 0.00 0.00 1.40
3555 4827 6.821665 CGGACTTGAGATTTAGTGGGATAAAA 59.178 38.462 0.00 0.00 0.00 1.52
3556 4828 7.011482 CGGACTTGAGATTTAGTGGGATAAAAG 59.989 40.741 0.00 0.00 0.00 2.27
3557 4829 8.047310 GGACTTGAGATTTAGTGGGATAAAAGA 58.953 37.037 0.00 0.00 0.00 2.52
3558 4830 9.103861 GACTTGAGATTTAGTGGGATAAAAGAG 57.896 37.037 0.00 0.00 0.00 2.85
3559 4831 8.606830 ACTTGAGATTTAGTGGGATAAAAGAGT 58.393 33.333 0.00 0.00 0.00 3.24
3560 4832 9.454859 CTTGAGATTTAGTGGGATAAAAGAGTT 57.545 33.333 0.00 0.00 0.00 3.01
3561 4833 8.792830 TGAGATTTAGTGGGATAAAAGAGTTG 57.207 34.615 0.00 0.00 0.00 3.16
3562 4834 7.336931 TGAGATTTAGTGGGATAAAAGAGTTGC 59.663 37.037 0.00 0.00 0.00 4.17
3563 4835 6.603599 AGATTTAGTGGGATAAAAGAGTTGCC 59.396 38.462 0.00 0.00 0.00 4.52
3564 4836 3.806949 AGTGGGATAAAAGAGTTGCCA 57.193 42.857 0.00 0.00 0.00 4.92
3565 4837 4.322057 AGTGGGATAAAAGAGTTGCCAT 57.678 40.909 0.00 0.00 33.21 4.40
3566 4838 4.019174 AGTGGGATAAAAGAGTTGCCATG 58.981 43.478 0.00 0.00 33.21 3.66
3567 4839 2.760092 TGGGATAAAAGAGTTGCCATGC 59.240 45.455 0.00 0.00 0.00 4.06
3568 4840 2.760092 GGGATAAAAGAGTTGCCATGCA 59.240 45.455 0.00 0.00 36.47 3.96
3569 4841 3.181483 GGGATAAAAGAGTTGCCATGCAG 60.181 47.826 0.00 0.00 40.61 4.41
3570 4842 3.442100 GATAAAAGAGTTGCCATGCAGC 58.558 45.455 0.00 0.00 40.61 5.25
3571 4843 1.042229 AAAAGAGTTGCCATGCAGCA 58.958 45.000 0.00 0.00 42.09 4.41
3572 4844 1.263356 AAAGAGTTGCCATGCAGCAT 58.737 45.000 0.52 0.52 43.64 3.79
3573 4845 0.815734 AAGAGTTGCCATGCAGCATC 59.184 50.000 4.38 1.40 43.64 3.91
3574 4846 1.063649 GAGTTGCCATGCAGCATCG 59.936 57.895 4.38 0.00 43.64 3.84
3575 4847 2.103538 GTTGCCATGCAGCATCGG 59.896 61.111 4.38 11.79 43.64 4.18
3576 4848 2.361483 TTGCCATGCAGCATCGGT 60.361 55.556 19.22 0.00 43.64 4.69
3577 4849 2.409055 TTGCCATGCAGCATCGGTC 61.409 57.895 19.22 13.97 43.64 4.79
3578 4850 3.945434 GCCATGCAGCATCGGTCG 61.945 66.667 19.22 4.66 0.00 4.79
3579 4851 3.274586 CCATGCAGCATCGGTCGG 61.275 66.667 4.38 0.00 0.00 4.79
3580 4852 3.945434 CATGCAGCATCGGTCGGC 61.945 66.667 4.38 0.00 0.00 5.54
3581 4853 4.166888 ATGCAGCATCGGTCGGCT 62.167 61.111 0.52 0.00 42.06 5.52
3585 4857 3.842923 AGCATCGGTCGGCTGAGG 61.843 66.667 6.06 6.06 39.30 3.86
3587 4859 4.147449 CATCGGTCGGCTGAGGCA 62.147 66.667 4.21 0.00 40.87 4.75
3588 4860 3.390521 ATCGGTCGGCTGAGGCAA 61.391 61.111 4.21 0.00 40.87 4.52
3589 4861 3.665675 ATCGGTCGGCTGAGGCAAC 62.666 63.158 4.21 0.00 40.87 4.17
3603 4875 1.153958 GCAACTCAAATGCCTCCGC 60.154 57.895 0.00 0.00 37.85 5.54
3604 4876 1.135315 CAACTCAAATGCCTCCGCG 59.865 57.895 0.00 0.00 38.08 6.46
3605 4877 2.690778 AACTCAAATGCCTCCGCGC 61.691 57.895 0.00 0.00 38.08 6.86
3606 4878 3.880846 CTCAAATGCCTCCGCGCC 61.881 66.667 0.00 0.00 38.08 6.53
3619 4891 4.814294 GCGCCGACGGTGAATCCT 62.814 66.667 30.80 0.00 40.57 3.24
3620 4892 2.125673 CGCCGACGGTGAATCCTT 60.126 61.111 22.98 0.00 34.74 3.36
3621 4893 1.740296 CGCCGACGGTGAATCCTTT 60.740 57.895 22.98 0.00 34.74 3.11
3622 4894 0.458889 CGCCGACGGTGAATCCTTTA 60.459 55.000 22.98 0.00 34.74 1.85
3623 4895 1.287425 GCCGACGGTGAATCCTTTAG 58.713 55.000 16.73 0.00 0.00 1.85
3624 4896 1.134907 GCCGACGGTGAATCCTTTAGA 60.135 52.381 16.73 0.00 0.00 2.10
3625 4897 2.810650 CCGACGGTGAATCCTTTAGAG 58.189 52.381 5.48 0.00 0.00 2.43
3626 4898 2.165845 CCGACGGTGAATCCTTTAGAGT 59.834 50.000 5.48 0.00 0.00 3.24
3627 4899 3.179830 CGACGGTGAATCCTTTAGAGTG 58.820 50.000 0.00 0.00 0.00 3.51
3628 4900 2.930682 GACGGTGAATCCTTTAGAGTGC 59.069 50.000 0.00 0.00 0.00 4.40
3629 4901 2.280628 CGGTGAATCCTTTAGAGTGCC 58.719 52.381 0.00 0.00 0.00 5.01
3630 4902 2.280628 GGTGAATCCTTTAGAGTGCCG 58.719 52.381 0.00 0.00 0.00 5.69
3631 4903 2.280628 GTGAATCCTTTAGAGTGCCGG 58.719 52.381 0.00 0.00 0.00 6.13
3632 4904 2.093658 GTGAATCCTTTAGAGTGCCGGA 60.094 50.000 5.05 0.00 0.00 5.14
3633 4905 2.771943 TGAATCCTTTAGAGTGCCGGAT 59.228 45.455 5.05 0.00 36.08 4.18
3634 4906 3.199946 TGAATCCTTTAGAGTGCCGGATT 59.800 43.478 5.05 0.00 44.69 3.01
3635 4907 2.691409 TCCTTTAGAGTGCCGGATTG 57.309 50.000 5.05 0.00 0.00 2.67
3636 4908 1.209504 TCCTTTAGAGTGCCGGATTGG 59.790 52.381 5.05 0.00 42.50 3.16
3637 4909 1.209504 CCTTTAGAGTGCCGGATTGGA 59.790 52.381 5.05 0.00 42.00 3.53
3638 4910 2.158755 CCTTTAGAGTGCCGGATTGGAT 60.159 50.000 5.05 0.00 42.00 3.41
3639 4911 2.910688 TTAGAGTGCCGGATTGGATC 57.089 50.000 5.05 0.00 42.00 3.36
3640 4912 0.673985 TAGAGTGCCGGATTGGATCG 59.326 55.000 5.05 0.00 42.00 3.69
3645 4917 3.420943 CCGGATTGGATCGGCAAC 58.579 61.111 0.00 0.00 42.00 4.17
3646 4918 2.186826 CCGGATTGGATCGGCAACC 61.187 63.158 0.00 0.00 42.00 3.77
3647 4919 1.153168 CGGATTGGATCGGCAACCT 60.153 57.895 0.00 0.00 0.00 3.50
3648 4920 1.160329 CGGATTGGATCGGCAACCTC 61.160 60.000 0.00 0.00 0.00 3.85
3649 4921 0.107214 GGATTGGATCGGCAACCTCA 60.107 55.000 0.00 0.00 0.00 3.86
3650 4922 1.017387 GATTGGATCGGCAACCTCAC 58.983 55.000 0.00 0.00 0.00 3.51
3651 4923 0.744414 ATTGGATCGGCAACCTCACG 60.744 55.000 0.00 0.00 0.00 4.35
3652 4924 2.107041 TTGGATCGGCAACCTCACGT 62.107 55.000 0.00 0.00 0.00 4.49
3653 4925 1.810030 GGATCGGCAACCTCACGTC 60.810 63.158 0.00 0.00 0.00 4.34
3654 4926 1.810030 GATCGGCAACCTCACGTCC 60.810 63.158 0.00 0.00 0.00 4.79
3655 4927 3.310860 ATCGGCAACCTCACGTCCC 62.311 63.158 0.00 0.00 0.00 4.46
3656 4928 4.003788 CGGCAACCTCACGTCCCT 62.004 66.667 0.00 0.00 0.00 4.20
3657 4929 2.358737 GGCAACCTCACGTCCCTG 60.359 66.667 0.00 0.00 0.00 4.45
3658 4930 2.358737 GCAACCTCACGTCCCTGG 60.359 66.667 0.00 0.00 0.00 4.45
3659 4931 2.879233 GCAACCTCACGTCCCTGGA 61.879 63.158 0.00 0.00 0.00 3.86
3660 4932 1.752198 CAACCTCACGTCCCTGGAA 59.248 57.895 0.00 0.00 0.00 3.53
3661 4933 0.320771 CAACCTCACGTCCCTGGAAG 60.321 60.000 0.00 0.00 0.00 3.46
3662 4934 0.471211 AACCTCACGTCCCTGGAAGA 60.471 55.000 6.11 0.00 34.07 2.87
3663 4935 0.900647 ACCTCACGTCCCTGGAAGAG 60.901 60.000 6.11 5.55 34.07 2.85
3664 4936 1.216710 CTCACGTCCCTGGAAGAGC 59.783 63.158 6.11 0.00 34.07 4.09
3665 4937 1.228894 TCACGTCCCTGGAAGAGCT 60.229 57.895 6.11 0.00 34.07 4.09
3666 4938 0.039180 TCACGTCCCTGGAAGAGCTA 59.961 55.000 6.11 0.00 34.07 3.32
3667 4939 1.115467 CACGTCCCTGGAAGAGCTAT 58.885 55.000 6.11 0.00 34.07 2.97
3668 4940 1.067821 CACGTCCCTGGAAGAGCTATC 59.932 57.143 6.11 0.00 34.07 2.08
3669 4941 0.676736 CGTCCCTGGAAGAGCTATCC 59.323 60.000 10.47 10.47 34.07 2.59
3670 4942 1.755977 CGTCCCTGGAAGAGCTATCCT 60.756 57.143 16.70 0.00 37.85 3.24
3671 4943 2.403561 GTCCCTGGAAGAGCTATCCTT 58.596 52.381 16.70 2.94 37.85 3.36
3672 4944 2.103941 GTCCCTGGAAGAGCTATCCTTG 59.896 54.545 16.70 10.51 37.85 3.61
3673 4945 1.202746 CCCTGGAAGAGCTATCCTTGC 60.203 57.143 16.70 8.52 37.85 4.01
3674 4946 1.487976 CCTGGAAGAGCTATCCTTGCA 59.512 52.381 16.70 12.18 39.17 4.08
3675 4947 2.559440 CTGGAAGAGCTATCCTTGCAC 58.441 52.381 16.70 0.00 37.12 4.57
3676 4948 1.134699 TGGAAGAGCTATCCTTGCACG 60.135 52.381 16.70 0.00 37.12 5.34
3677 4949 1.137086 GGAAGAGCTATCCTTGCACGA 59.863 52.381 10.18 0.00 33.06 4.35
3678 4950 2.197577 GAAGAGCTATCCTTGCACGAC 58.802 52.381 0.00 0.00 0.00 4.34
3679 4951 0.101399 AGAGCTATCCTTGCACGACG 59.899 55.000 0.00 0.00 0.00 5.12
3680 4952 0.179134 GAGCTATCCTTGCACGACGT 60.179 55.000 0.00 0.00 0.00 4.34
3681 4953 0.246635 AGCTATCCTTGCACGACGTT 59.753 50.000 0.00 0.00 0.00 3.99
3682 4954 0.645868 GCTATCCTTGCACGACGTTC 59.354 55.000 0.00 0.00 0.00 3.95
3683 4955 1.278238 CTATCCTTGCACGACGTTCC 58.722 55.000 0.00 0.00 0.00 3.62
3684 4956 0.604073 TATCCTTGCACGACGTTCCA 59.396 50.000 0.00 0.00 0.00 3.53
3685 4957 0.670546 ATCCTTGCACGACGTTCCAG 60.671 55.000 0.00 0.00 0.00 3.86
3686 4958 2.551270 CTTGCACGACGTTCCAGC 59.449 61.111 0.00 0.00 0.00 4.85
3687 4959 2.202946 TTGCACGACGTTCCAGCA 60.203 55.556 6.63 6.63 0.00 4.41
3688 4960 1.771073 CTTGCACGACGTTCCAGCAA 61.771 55.000 18.65 18.65 42.27 3.91
3689 4961 1.771073 TTGCACGACGTTCCAGCAAG 61.771 55.000 16.61 0.00 39.95 4.01
3690 4962 2.551270 CACGACGTTCCAGCAAGC 59.449 61.111 0.00 0.00 0.00 4.01
3691 4963 1.956170 CACGACGTTCCAGCAAGCT 60.956 57.895 0.00 0.00 0.00 3.74
3692 4964 1.227556 ACGACGTTCCAGCAAGCTT 60.228 52.632 0.00 0.00 0.00 3.74
3693 4965 1.222115 ACGACGTTCCAGCAAGCTTC 61.222 55.000 0.00 0.00 0.00 3.86
3694 4966 1.221466 CGACGTTCCAGCAAGCTTCA 61.221 55.000 0.00 0.00 0.00 3.02
3695 4967 1.160137 GACGTTCCAGCAAGCTTCAT 58.840 50.000 0.00 0.00 0.00 2.57
3696 4968 0.877071 ACGTTCCAGCAAGCTTCATG 59.123 50.000 0.00 0.00 0.00 3.07
3697 4969 0.169672 CGTTCCAGCAAGCTTCATGG 59.830 55.000 17.08 17.08 0.00 3.66
3698 4970 0.529378 GTTCCAGCAAGCTTCATGGG 59.471 55.000 21.05 10.55 33.45 4.00
3699 4971 0.612732 TTCCAGCAAGCTTCATGGGG 60.613 55.000 21.05 9.04 33.45 4.96
3700 4972 2.056223 CCAGCAAGCTTCATGGGGG 61.056 63.158 15.86 1.18 0.00 5.40
3701 4973 1.000521 CAGCAAGCTTCATGGGGGA 60.001 57.895 0.00 0.00 0.00 4.81
3702 4974 1.035932 CAGCAAGCTTCATGGGGGAG 61.036 60.000 0.00 0.00 0.00 4.30
3703 4975 2.421399 GCAAGCTTCATGGGGGAGC 61.421 63.158 0.00 0.00 0.00 4.70
3704 4976 1.305623 CAAGCTTCATGGGGGAGCT 59.694 57.895 0.00 7.64 37.45 4.09
3705 4977 1.035932 CAAGCTTCATGGGGGAGCTG 61.036 60.000 12.33 5.87 35.86 4.24
3706 4978 2.123982 GCTTCATGGGGGAGCTGG 60.124 66.667 0.00 0.00 0.00 4.85
3707 4979 2.599597 CTTCATGGGGGAGCTGGG 59.400 66.667 0.00 0.00 0.00 4.45
3708 4980 2.002977 CTTCATGGGGGAGCTGGGA 61.003 63.158 0.00 0.00 0.00 4.37
3709 4981 1.543642 TTCATGGGGGAGCTGGGAA 60.544 57.895 0.00 0.00 0.00 3.97
3710 4982 1.145900 TTCATGGGGGAGCTGGGAAA 61.146 55.000 0.00 0.00 0.00 3.13
3711 4983 1.076485 CATGGGGGAGCTGGGAAAG 60.076 63.158 0.00 0.00 0.00 2.62
3722 4994 2.557920 CTGGGAAAGCTGACAGAGTT 57.442 50.000 6.65 0.00 32.86 3.01
3723 4995 2.149578 CTGGGAAAGCTGACAGAGTTG 58.850 52.381 6.65 0.00 32.86 3.16
3724 4996 1.768275 TGGGAAAGCTGACAGAGTTGA 59.232 47.619 6.65 0.00 0.00 3.18
3725 4997 2.224378 TGGGAAAGCTGACAGAGTTGAG 60.224 50.000 6.65 0.00 0.00 3.02
3726 4998 2.421619 GGAAAGCTGACAGAGTTGAGG 58.578 52.381 6.65 0.00 0.00 3.86
3727 4999 2.421619 GAAAGCTGACAGAGTTGAGGG 58.578 52.381 6.65 0.00 0.00 4.30
3728 5000 1.722034 AAGCTGACAGAGTTGAGGGA 58.278 50.000 6.65 0.00 0.00 4.20
3729 5001 0.972883 AGCTGACAGAGTTGAGGGAC 59.027 55.000 6.65 0.00 0.00 4.46
3730 5002 0.036858 GCTGACAGAGTTGAGGGACC 60.037 60.000 6.65 0.00 0.00 4.46
3731 5003 1.638529 CTGACAGAGTTGAGGGACCT 58.361 55.000 0.00 0.00 0.00 3.85
3732 5004 1.548269 CTGACAGAGTTGAGGGACCTC 59.452 57.143 11.44 11.44 43.01 3.85
3741 5013 1.952621 TGAGGGACCTCAGGTTTAGG 58.047 55.000 16.79 0.00 46.80 2.69
3742 5014 1.435563 TGAGGGACCTCAGGTTTAGGA 59.564 52.381 16.79 0.00 46.80 2.94
3743 5015 2.045885 TGAGGGACCTCAGGTTTAGGAT 59.954 50.000 16.79 0.00 46.80 3.24
3744 5016 3.116174 GAGGGACCTCAGGTTTAGGATT 58.884 50.000 13.37 0.00 42.31 3.01
3745 5017 3.116174 AGGGACCTCAGGTTTAGGATTC 58.884 50.000 0.00 0.00 35.25 2.52
3746 5018 2.844348 GGGACCTCAGGTTTAGGATTCA 59.156 50.000 0.00 0.00 35.25 2.57
3747 5019 3.118223 GGGACCTCAGGTTTAGGATTCAG 60.118 52.174 0.00 0.00 35.25 3.02
3748 5020 3.775316 GGACCTCAGGTTTAGGATTCAGA 59.225 47.826 0.00 0.00 35.25 3.27
3749 5021 4.141824 GGACCTCAGGTTTAGGATTCAGAG 60.142 50.000 0.00 0.00 35.25 3.35
3750 5022 3.198853 ACCTCAGGTTTAGGATTCAGAGC 59.801 47.826 0.00 0.00 37.57 4.09
3751 5023 3.198635 CCTCAGGTTTAGGATTCAGAGCA 59.801 47.826 0.00 0.00 36.08 4.26
3752 5024 4.141528 CCTCAGGTTTAGGATTCAGAGCAT 60.142 45.833 0.00 0.00 36.08 3.79
3753 5025 5.070981 CCTCAGGTTTAGGATTCAGAGCATA 59.929 44.000 0.00 0.00 36.08 3.14
3754 5026 5.918608 TCAGGTTTAGGATTCAGAGCATAC 58.081 41.667 0.00 0.00 0.00 2.39
3755 5027 5.425217 TCAGGTTTAGGATTCAGAGCATACA 59.575 40.000 0.00 0.00 0.00 2.29
3756 5028 6.100279 TCAGGTTTAGGATTCAGAGCATACAT 59.900 38.462 0.00 0.00 0.00 2.29
3757 5029 6.426328 CAGGTTTAGGATTCAGAGCATACATC 59.574 42.308 0.00 0.00 0.00 3.06
3758 5030 5.703130 GGTTTAGGATTCAGAGCATACATCC 59.297 44.000 0.00 0.00 34.64 3.51
3759 5031 3.674528 AGGATTCAGAGCATACATCCG 57.325 47.619 0.00 0.00 38.81 4.18
3760 5032 3.234353 AGGATTCAGAGCATACATCCGA 58.766 45.455 0.00 0.00 38.81 4.55
3761 5033 3.257873 AGGATTCAGAGCATACATCCGAG 59.742 47.826 0.00 0.00 38.81 4.63
3762 5034 3.006323 GGATTCAGAGCATACATCCGAGT 59.994 47.826 0.00 0.00 0.00 4.18
3763 5035 4.502259 GGATTCAGAGCATACATCCGAGTT 60.502 45.833 0.00 0.00 0.00 3.01
3764 5036 4.471904 TTCAGAGCATACATCCGAGTTT 57.528 40.909 0.00 0.00 0.00 2.66
3765 5037 3.785486 TCAGAGCATACATCCGAGTTTG 58.215 45.455 0.00 0.00 0.00 2.93
3766 5038 3.447229 TCAGAGCATACATCCGAGTTTGA 59.553 43.478 0.00 0.00 0.00 2.69
3767 5039 4.081697 TCAGAGCATACATCCGAGTTTGAA 60.082 41.667 0.00 0.00 0.00 2.69
3768 5040 4.269603 CAGAGCATACATCCGAGTTTGAAG 59.730 45.833 0.00 0.00 0.00 3.02
3769 5041 2.939103 AGCATACATCCGAGTTTGAAGC 59.061 45.455 0.00 0.00 0.00 3.86
3770 5042 2.677836 GCATACATCCGAGTTTGAAGCA 59.322 45.455 0.00 0.00 0.00 3.91
3771 5043 3.126858 GCATACATCCGAGTTTGAAGCAA 59.873 43.478 0.00 0.00 0.00 3.91
3772 5044 4.728882 GCATACATCCGAGTTTGAAGCAAG 60.729 45.833 0.00 0.00 0.00 4.01
3773 5045 2.851195 ACATCCGAGTTTGAAGCAAGT 58.149 42.857 0.00 0.00 0.00 3.16
3774 5046 2.808543 ACATCCGAGTTTGAAGCAAGTC 59.191 45.455 0.00 0.00 0.00 3.01
3775 5047 2.910688 TCCGAGTTTGAAGCAAGTCT 57.089 45.000 0.00 0.00 0.00 3.24
3776 5048 3.194005 TCCGAGTTTGAAGCAAGTCTT 57.806 42.857 0.00 0.00 37.83 3.01
3777 5049 2.872245 TCCGAGTTTGAAGCAAGTCTTG 59.128 45.455 8.31 8.31 34.56 3.02
3778 5050 2.031682 CCGAGTTTGAAGCAAGTCTTGG 60.032 50.000 14.40 0.00 34.56 3.61
3779 5051 2.614057 CGAGTTTGAAGCAAGTCTTGGT 59.386 45.455 11.52 11.52 44.43 3.67
3780 5052 3.546815 CGAGTTTGAAGCAAGTCTTGGTG 60.547 47.826 17.64 0.00 41.89 4.17
3781 5053 2.689983 AGTTTGAAGCAAGTCTTGGTGG 59.310 45.455 17.64 0.00 41.89 4.61
3782 5054 2.687935 GTTTGAAGCAAGTCTTGGTGGA 59.312 45.455 17.64 5.12 41.89 4.02
3783 5055 2.957402 TGAAGCAAGTCTTGGTGGAT 57.043 45.000 17.64 2.63 41.89 3.41
3784 5056 3.228188 TGAAGCAAGTCTTGGTGGATT 57.772 42.857 17.64 2.26 41.89 3.01
3785 5057 3.149196 TGAAGCAAGTCTTGGTGGATTC 58.851 45.455 17.64 11.70 41.89 2.52
3786 5058 2.206576 AGCAAGTCTTGGTGGATTCC 57.793 50.000 16.30 0.00 40.37 3.01
3787 5059 1.177401 GCAAGTCTTGGTGGATTCCC 58.823 55.000 14.40 0.00 0.00 3.97
3788 5060 1.272147 GCAAGTCTTGGTGGATTCCCT 60.272 52.381 14.40 0.00 0.00 4.20
3789 5061 2.440409 CAAGTCTTGGTGGATTCCCTG 58.560 52.381 4.52 0.00 0.00 4.45
3790 5062 1.747444 AGTCTTGGTGGATTCCCTGT 58.253 50.000 0.00 0.00 0.00 4.00
3791 5063 1.352352 AGTCTTGGTGGATTCCCTGTG 59.648 52.381 0.00 0.00 0.00 3.66
3792 5064 0.038166 TCTTGGTGGATTCCCTGTGC 59.962 55.000 0.00 0.00 0.00 4.57
3793 5065 0.251297 CTTGGTGGATTCCCTGTGCA 60.251 55.000 0.00 0.00 0.00 4.57
3794 5066 0.187117 TTGGTGGATTCCCTGTGCAA 59.813 50.000 0.00 0.00 0.00 4.08
3795 5067 0.539438 TGGTGGATTCCCTGTGCAAC 60.539 55.000 0.00 0.00 37.35 4.17
3796 5068 1.250840 GGTGGATTCCCTGTGCAACC 61.251 60.000 0.00 0.00 34.36 3.77
3797 5069 0.251341 GTGGATTCCCTGTGCAACCT 60.251 55.000 0.00 0.00 34.36 3.50
3798 5070 0.251297 TGGATTCCCTGTGCAACCTG 60.251 55.000 0.00 0.00 34.36 4.00
3799 5071 0.038166 GGATTCCCTGTGCAACCTGA 59.962 55.000 0.00 0.00 34.36 3.86
3800 5072 1.547675 GGATTCCCTGTGCAACCTGAA 60.548 52.381 0.00 0.00 34.36 3.02
3801 5073 1.815003 GATTCCCTGTGCAACCTGAAG 59.185 52.381 0.00 0.00 34.36 3.02
3802 5074 0.843309 TTCCCTGTGCAACCTGAAGA 59.157 50.000 0.00 0.00 34.36 2.87
3803 5075 0.843309 TCCCTGTGCAACCTGAAGAA 59.157 50.000 0.00 0.00 34.36 2.52
3804 5076 1.202806 TCCCTGTGCAACCTGAAGAAG 60.203 52.381 0.00 0.00 34.36 2.85
3805 5077 1.202806 CCCTGTGCAACCTGAAGAAGA 60.203 52.381 0.00 0.00 34.36 2.87
3806 5078 2.553904 CCCTGTGCAACCTGAAGAAGAT 60.554 50.000 0.00 0.00 34.36 2.40
3807 5079 3.307691 CCCTGTGCAACCTGAAGAAGATA 60.308 47.826 0.00 0.00 34.36 1.98
3808 5080 3.686726 CCTGTGCAACCTGAAGAAGATAC 59.313 47.826 0.00 0.00 34.36 2.24
3809 5081 4.318332 CTGTGCAACCTGAAGAAGATACA 58.682 43.478 0.00 0.00 34.36 2.29
3810 5082 4.713553 TGTGCAACCTGAAGAAGATACAA 58.286 39.130 0.00 0.00 34.36 2.41
3811 5083 4.756642 TGTGCAACCTGAAGAAGATACAAG 59.243 41.667 0.00 0.00 34.36 3.16
3812 5084 4.757149 GTGCAACCTGAAGAAGATACAAGT 59.243 41.667 0.00 0.00 0.00 3.16
3813 5085 4.997395 TGCAACCTGAAGAAGATACAAGTC 59.003 41.667 0.00 0.00 0.00 3.01
3814 5086 4.393371 GCAACCTGAAGAAGATACAAGTCC 59.607 45.833 0.00 0.00 0.00 3.85
3815 5087 5.799213 CAACCTGAAGAAGATACAAGTCCT 58.201 41.667 0.00 0.00 0.00 3.85
3816 5088 5.413309 ACCTGAAGAAGATACAAGTCCTG 57.587 43.478 0.00 0.00 0.00 3.86
3817 5089 4.187694 CCTGAAGAAGATACAAGTCCTGC 58.812 47.826 0.00 0.00 0.00 4.85
3818 5090 4.323028 CCTGAAGAAGATACAAGTCCTGCA 60.323 45.833 0.00 0.00 0.00 4.41
3819 5091 4.825422 TGAAGAAGATACAAGTCCTGCAG 58.175 43.478 6.78 6.78 0.00 4.41
3820 5092 4.528206 TGAAGAAGATACAAGTCCTGCAGA 59.472 41.667 17.39 0.00 0.00 4.26
3821 5093 5.188555 TGAAGAAGATACAAGTCCTGCAGAT 59.811 40.000 17.39 0.00 0.00 2.90
3822 5094 5.021033 AGAAGATACAAGTCCTGCAGATG 57.979 43.478 17.39 10.96 0.00 2.90
3823 5095 4.713814 AGAAGATACAAGTCCTGCAGATGA 59.286 41.667 17.39 1.07 0.00 2.92
3824 5096 5.188555 AGAAGATACAAGTCCTGCAGATGAA 59.811 40.000 17.39 0.00 0.00 2.57
3825 5097 5.627182 AGATACAAGTCCTGCAGATGAAT 57.373 39.130 17.39 0.37 0.00 2.57
3826 5098 5.366460 AGATACAAGTCCTGCAGATGAATG 58.634 41.667 17.39 9.88 0.00 2.67
3827 5099 2.719739 ACAAGTCCTGCAGATGAATGG 58.280 47.619 17.39 4.15 0.00 3.16
3828 5100 2.040813 ACAAGTCCTGCAGATGAATGGT 59.959 45.455 17.39 4.87 0.00 3.55
3829 5101 2.681848 CAAGTCCTGCAGATGAATGGTC 59.318 50.000 17.39 0.00 0.00 4.02
3830 5102 1.211457 AGTCCTGCAGATGAATGGTCC 59.789 52.381 17.39 0.00 0.00 4.46
3831 5103 0.548031 TCCTGCAGATGAATGGTCCC 59.452 55.000 17.39 0.00 0.00 4.46
3832 5104 0.549950 CCTGCAGATGAATGGTCCCT 59.450 55.000 17.39 0.00 0.00 4.20
3833 5105 1.676746 CTGCAGATGAATGGTCCCTG 58.323 55.000 8.42 0.00 0.00 4.45
3834 5106 0.256752 TGCAGATGAATGGTCCCTGG 59.743 55.000 0.00 0.00 0.00 4.45
3835 5107 0.257039 GCAGATGAATGGTCCCTGGT 59.743 55.000 0.00 0.00 0.00 4.00
3836 5108 1.341383 GCAGATGAATGGTCCCTGGTT 60.341 52.381 0.00 0.00 0.00 3.67
3837 5109 2.648059 CAGATGAATGGTCCCTGGTTC 58.352 52.381 0.00 0.00 0.00 3.62
3838 5110 2.025981 CAGATGAATGGTCCCTGGTTCA 60.026 50.000 0.00 0.00 35.33 3.18
3839 5111 2.649312 AGATGAATGGTCCCTGGTTCAA 59.351 45.455 1.43 0.00 34.62 2.69
3840 5112 2.286365 TGAATGGTCCCTGGTTCAAC 57.714 50.000 0.00 0.00 0.00 3.18
3841 5113 1.165270 GAATGGTCCCTGGTTCAACG 58.835 55.000 0.00 0.00 0.00 4.10
3842 5114 0.768622 AATGGTCCCTGGTTCAACGA 59.231 50.000 0.00 0.00 0.00 3.85
3843 5115 0.036306 ATGGTCCCTGGTTCAACGAC 59.964 55.000 0.00 0.00 0.00 4.34
3844 5116 1.666872 GGTCCCTGGTTCAACGACG 60.667 63.158 0.00 0.00 0.00 5.12
3845 5117 1.364901 GTCCCTGGTTCAACGACGA 59.635 57.895 0.00 0.00 0.00 4.20
3846 5118 0.942884 GTCCCTGGTTCAACGACGAC 60.943 60.000 0.00 0.00 0.00 4.34
3847 5119 1.666872 CCCTGGTTCAACGACGACC 60.667 63.158 0.00 0.00 0.00 4.79
3848 5120 1.666872 CCTGGTTCAACGACGACCC 60.667 63.158 0.00 0.00 32.39 4.46
3849 5121 1.666872 CTGGTTCAACGACGACCCC 60.667 63.158 0.00 0.00 32.39 4.95
3850 5122 2.372040 CTGGTTCAACGACGACCCCA 62.372 60.000 0.00 0.00 32.39 4.96
3851 5123 1.227615 GGTTCAACGACGACCCCAA 60.228 57.895 0.00 0.00 0.00 4.12
3852 5124 1.501337 GGTTCAACGACGACCCCAAC 61.501 60.000 0.00 0.00 0.00 3.77
3853 5125 0.531311 GTTCAACGACGACCCCAACT 60.531 55.000 0.00 0.00 0.00 3.16
3854 5126 0.531090 TTCAACGACGACCCCAACTG 60.531 55.000 0.00 0.00 0.00 3.16
3855 5127 1.959226 CAACGACGACCCCAACTGG 60.959 63.158 0.00 0.00 0.00 4.00
3865 5137 4.617875 CCAACTGGGAAGCCTACG 57.382 61.111 0.00 0.00 40.01 3.51
3866 5138 1.677552 CCAACTGGGAAGCCTACGT 59.322 57.895 0.00 0.00 40.01 3.57
3867 5139 0.673644 CCAACTGGGAAGCCTACGTG 60.674 60.000 0.00 0.00 40.01 4.49
3868 5140 1.003718 AACTGGGAAGCCTACGTGC 60.004 57.895 0.00 0.00 0.00 5.34
3869 5141 2.125106 CTGGGAAGCCTACGTGCC 60.125 66.667 0.00 0.00 36.30 5.01
3870 5142 3.682292 CTGGGAAGCCTACGTGCCC 62.682 68.421 0.00 0.00 34.84 5.36
3871 5143 3.712907 GGGAAGCCTACGTGCCCA 61.713 66.667 0.00 0.00 38.68 5.36
3872 5144 2.436115 GGAAGCCTACGTGCCCAC 60.436 66.667 0.00 0.00 0.00 4.61
3873 5145 2.663196 GAAGCCTACGTGCCCACT 59.337 61.111 0.00 0.00 0.00 4.00
3874 5146 1.448013 GAAGCCTACGTGCCCACTC 60.448 63.158 0.00 0.00 0.00 3.51
3875 5147 2.854187 GAAGCCTACGTGCCCACTCC 62.854 65.000 0.00 0.00 0.00 3.85
3876 5148 4.814294 GCCTACGTGCCCACTCCG 62.814 72.222 0.00 0.00 0.00 4.63
3877 5149 4.814294 CCTACGTGCCCACTCCGC 62.814 72.222 0.00 0.00 0.00 5.54
3878 5150 4.063967 CTACGTGCCCACTCCGCA 62.064 66.667 0.00 0.00 0.00 5.69
3879 5151 3.989698 CTACGTGCCCACTCCGCAG 62.990 68.421 0.00 0.00 36.78 5.18
3902 5174 2.281761 CCGCCTTGTGCTCTGGTT 60.282 61.111 0.00 0.00 38.05 3.67
3903 5175 2.328099 CCGCCTTGTGCTCTGGTTC 61.328 63.158 0.00 0.00 38.05 3.62
3904 5176 1.597854 CGCCTTGTGCTCTGGTTCA 60.598 57.895 0.00 0.00 38.05 3.18
3905 5177 1.572085 CGCCTTGTGCTCTGGTTCAG 61.572 60.000 0.00 0.00 38.05 3.02
3906 5178 1.239968 GCCTTGTGCTCTGGTTCAGG 61.240 60.000 0.00 0.00 36.87 3.86
3907 5179 0.109342 CCTTGTGCTCTGGTTCAGGT 59.891 55.000 0.00 0.00 31.51 4.00
3908 5180 1.477558 CCTTGTGCTCTGGTTCAGGTT 60.478 52.381 0.00 0.00 31.51 3.50
3909 5181 2.301346 CTTGTGCTCTGGTTCAGGTTT 58.699 47.619 0.00 0.00 31.51 3.27
3910 5182 1.967319 TGTGCTCTGGTTCAGGTTTC 58.033 50.000 0.00 0.00 31.51 2.78
3911 5183 1.211703 TGTGCTCTGGTTCAGGTTTCA 59.788 47.619 0.00 0.00 31.51 2.69
3912 5184 1.876156 GTGCTCTGGTTCAGGTTTCAG 59.124 52.381 0.00 0.00 31.51 3.02
3913 5185 1.768275 TGCTCTGGTTCAGGTTTCAGA 59.232 47.619 0.00 0.00 35.32 3.27
3915 5187 3.051081 CTCTGGTTCAGGTTTCAGAGG 57.949 52.381 10.36 0.00 45.50 3.69
3916 5188 1.072331 TCTGGTTCAGGTTTCAGAGGC 59.928 52.381 0.00 0.00 33.07 4.70
3917 5189 1.072965 CTGGTTCAGGTTTCAGAGGCT 59.927 52.381 0.00 0.00 0.00 4.58
3918 5190 1.202806 TGGTTCAGGTTTCAGAGGCTG 60.203 52.381 0.00 0.00 0.00 4.85
3919 5191 0.877743 GTTCAGGTTTCAGAGGCTGC 59.122 55.000 0.00 0.00 0.00 5.25
3920 5192 0.250901 TTCAGGTTTCAGAGGCTGCC 60.251 55.000 11.65 11.65 0.00 4.85
3921 5193 2.037136 CAGGTTTCAGAGGCTGCCG 61.037 63.158 13.96 0.00 0.00 5.69
3922 5194 2.747855 GGTTTCAGAGGCTGCCGG 60.748 66.667 13.96 7.37 0.00 6.13
3923 5195 2.347490 GTTTCAGAGGCTGCCGGA 59.653 61.111 13.96 9.77 0.00 5.14
3924 5196 1.743252 GTTTCAGAGGCTGCCGGAG 60.743 63.158 13.96 6.99 0.00 4.63
3925 5197 2.217038 TTTCAGAGGCTGCCGGAGT 61.217 57.895 13.96 0.00 0.00 3.85
3926 5198 2.454832 TTTCAGAGGCTGCCGGAGTG 62.455 60.000 13.96 9.44 0.00 3.51
3927 5199 4.463879 CAGAGGCTGCCGGAGTGG 62.464 72.222 13.96 0.00 42.50 4.00
3928 5200 4.704103 AGAGGCTGCCGGAGTGGA 62.704 66.667 13.96 0.00 42.00 4.02
3929 5201 3.474570 GAGGCTGCCGGAGTGGAT 61.475 66.667 13.96 0.00 42.00 3.41
3930 5202 3.453070 GAGGCTGCCGGAGTGGATC 62.453 68.421 13.96 0.00 42.00 3.36
3931 5203 3.785859 GGCTGCCGGAGTGGATCA 61.786 66.667 5.05 0.00 42.00 2.92
3932 5204 2.512515 GCTGCCGGAGTGGATCAC 60.513 66.667 5.05 0.00 42.00 3.06
3933 5205 2.187946 CTGCCGGAGTGGATCACC 59.812 66.667 5.05 0.00 42.00 4.02
3934 5206 3.391665 CTGCCGGAGTGGATCACCC 62.392 68.421 5.05 0.00 42.00 4.61
3935 5207 4.176752 GCCGGAGTGGATCACCCC 62.177 72.222 5.05 0.00 42.00 4.95
3938 5210 4.176752 GGAGTGGATCACCCCGGC 62.177 72.222 0.00 0.00 34.49 6.13
3939 5211 4.530857 GAGTGGATCACCCCGGCG 62.531 72.222 0.00 0.00 34.49 6.46
3941 5213 4.832608 GTGGATCACCCCGGCGTC 62.833 72.222 6.01 0.00 34.81 5.19
3943 5215 4.222847 GGATCACCCCGGCGTCTC 62.223 72.222 6.01 0.00 0.00 3.36
3944 5216 3.148279 GATCACCCCGGCGTCTCT 61.148 66.667 6.01 0.00 0.00 3.10
3945 5217 3.140225 GATCACCCCGGCGTCTCTC 62.140 68.421 6.01 0.00 0.00 3.20
3950 5222 3.702048 CCCGGCGTCTCTCCCAAA 61.702 66.667 6.01 0.00 0.00 3.28
3951 5223 2.434359 CCGGCGTCTCTCCCAAAC 60.434 66.667 6.01 0.00 0.00 2.93
3952 5224 2.434359 CGGCGTCTCTCCCAAACC 60.434 66.667 0.00 0.00 0.00 3.27
3953 5225 2.943978 CGGCGTCTCTCCCAAACCT 61.944 63.158 0.00 0.00 0.00 3.50
3954 5226 1.079057 GGCGTCTCTCCCAAACCTC 60.079 63.158 0.00 0.00 0.00 3.85
3955 5227 1.545706 GGCGTCTCTCCCAAACCTCT 61.546 60.000 0.00 0.00 0.00 3.69
3956 5228 0.108567 GCGTCTCTCCCAAACCTCTC 60.109 60.000 0.00 0.00 0.00 3.20
3957 5229 0.171455 CGTCTCTCCCAAACCTCTCG 59.829 60.000 0.00 0.00 0.00 4.04
3958 5230 0.108567 GTCTCTCCCAAACCTCTCGC 60.109 60.000 0.00 0.00 0.00 5.03
3959 5231 0.541998 TCTCTCCCAAACCTCTCGCA 60.542 55.000 0.00 0.00 0.00 5.10
3960 5232 0.390472 CTCTCCCAAACCTCTCGCAC 60.390 60.000 0.00 0.00 0.00 5.34
3961 5233 1.376037 CTCCCAAACCTCTCGCACC 60.376 63.158 0.00 0.00 0.00 5.01
3962 5234 1.831652 CTCCCAAACCTCTCGCACCT 61.832 60.000 0.00 0.00 0.00 4.00
3963 5235 1.672356 CCCAAACCTCTCGCACCTG 60.672 63.158 0.00 0.00 0.00 4.00
3964 5236 1.371183 CCAAACCTCTCGCACCTGA 59.629 57.895 0.00 0.00 0.00 3.86
3965 5237 0.951040 CCAAACCTCTCGCACCTGAC 60.951 60.000 0.00 0.00 0.00 3.51
3966 5238 0.951040 CAAACCTCTCGCACCTGACC 60.951 60.000 0.00 0.00 0.00 4.02
3967 5239 2.436087 AAACCTCTCGCACCTGACCG 62.436 60.000 0.00 0.00 0.00 4.79
3968 5240 3.374402 CCTCTCGCACCTGACCGT 61.374 66.667 0.00 0.00 0.00 4.83
3969 5241 2.126307 CTCTCGCACCTGACCGTG 60.126 66.667 0.00 0.00 36.80 4.94
3970 5242 3.633094 CTCTCGCACCTGACCGTGG 62.633 68.421 0.00 0.00 34.16 4.94
3971 5243 3.680786 CTCGCACCTGACCGTGGA 61.681 66.667 0.00 0.00 34.16 4.02
3972 5244 3.633094 CTCGCACCTGACCGTGGAG 62.633 68.421 0.00 0.00 34.16 3.86
4004 5276 3.188786 GGCGCACGATGTGGAGAC 61.189 66.667 10.83 0.00 33.64 3.36
4005 5277 2.125912 GCGCACGATGTGGAGACT 60.126 61.111 0.30 0.00 33.64 3.24
4006 5278 2.161486 GCGCACGATGTGGAGACTC 61.161 63.158 0.30 0.00 33.64 3.36
4007 5279 1.508545 CGCACGATGTGGAGACTCT 59.491 57.895 1.74 0.00 33.64 3.24
4008 5280 0.524392 CGCACGATGTGGAGACTCTC 60.524 60.000 1.74 0.00 33.64 3.20
4009 5281 0.524392 GCACGATGTGGAGACTCTCG 60.524 60.000 9.56 9.56 33.64 4.04
4010 5282 0.099613 CACGATGTGGAGACTCTCGG 59.900 60.000 14.18 2.77 32.61 4.63
4011 5283 1.032657 ACGATGTGGAGACTCTCGGG 61.033 60.000 14.18 0.00 32.61 5.14
4012 5284 0.748367 CGATGTGGAGACTCTCGGGA 60.748 60.000 1.74 0.00 0.00 5.14
4013 5285 1.028905 GATGTGGAGACTCTCGGGAG 58.971 60.000 11.78 11.78 44.62 4.30
4014 5286 0.396417 ATGTGGAGACTCTCGGGAGG 60.396 60.000 18.47 0.00 43.46 4.30
4015 5287 1.000646 GTGGAGACTCTCGGGAGGT 60.001 63.158 18.47 2.66 43.46 3.85
4016 5288 0.612453 GTGGAGACTCTCGGGAGGTT 60.612 60.000 18.47 3.56 43.46 3.50
4017 5289 0.612174 TGGAGACTCTCGGGAGGTTG 60.612 60.000 18.47 0.00 43.46 3.77
4018 5290 1.513622 GAGACTCTCGGGAGGTTGC 59.486 63.158 18.47 2.88 43.46 4.17
4019 5291 1.950973 GAGACTCTCGGGAGGTTGCC 61.951 65.000 18.47 0.07 43.46 4.52
4020 5292 3.003763 ACTCTCGGGAGGTTGCCC 61.004 66.667 18.47 0.00 43.46 5.36
4021 5293 3.787001 CTCTCGGGAGGTTGCCCC 61.787 72.222 3.69 0.00 45.84 5.80
4022 5294 4.649705 TCTCGGGAGGTTGCCCCA 62.650 66.667 0.00 0.00 45.84 4.96
4023 5295 4.101448 CTCGGGAGGTTGCCCCAG 62.101 72.222 0.00 0.00 45.84 4.45
4026 5298 4.432741 GGGAGGTTGCCCCAGCTC 62.433 72.222 0.00 0.00 42.62 4.09
4027 5299 4.785453 GGAGGTTGCCCCAGCTCG 62.785 72.222 0.00 0.00 41.45 5.03
4028 5300 4.021925 GAGGTTGCCCCAGCTCGT 62.022 66.667 0.00 0.00 40.80 4.18
4029 5301 4.335647 AGGTTGCCCCAGCTCGTG 62.336 66.667 0.00 0.00 40.80 4.35
4030 5302 4.329545 GGTTGCCCCAGCTCGTGA 62.330 66.667 0.00 0.00 40.80 4.35
4031 5303 2.743928 GTTGCCCCAGCTCGTGAG 60.744 66.667 0.00 0.00 40.80 3.51
4042 5314 2.730626 CTCGTGAGCCTCGACTTTG 58.269 57.895 0.00 0.00 33.71 2.77
4043 5315 1.347817 CTCGTGAGCCTCGACTTTGC 61.348 60.000 0.00 0.00 33.71 3.68
4044 5316 1.373497 CGTGAGCCTCGACTTTGCT 60.373 57.895 0.00 0.00 38.24 3.91
4045 5317 0.109272 CGTGAGCCTCGACTTTGCTA 60.109 55.000 0.00 0.00 34.99 3.49
4046 5318 1.351153 GTGAGCCTCGACTTTGCTAC 58.649 55.000 0.00 0.00 34.99 3.58
4047 5319 0.109272 TGAGCCTCGACTTTGCTACG 60.109 55.000 0.00 0.00 34.99 3.51
4048 5320 1.414527 GAGCCTCGACTTTGCTACGC 61.415 60.000 0.00 0.00 34.99 4.42
4049 5321 2.453638 GCCTCGACTTTGCTACGCC 61.454 63.158 0.00 0.00 0.00 5.68
4050 5322 2.158959 CCTCGACTTTGCTACGCCG 61.159 63.158 0.00 0.00 0.00 6.46
4051 5323 1.443872 CTCGACTTTGCTACGCCGT 60.444 57.895 0.00 0.00 0.00 5.68
4052 5324 0.179181 CTCGACTTTGCTACGCCGTA 60.179 55.000 0.00 0.00 0.00 4.02
4053 5325 0.454957 TCGACTTTGCTACGCCGTAC 60.455 55.000 0.00 0.00 0.00 3.67
4066 5338 1.488527 GCCGTACGACATGATCTTCC 58.511 55.000 18.76 0.00 0.00 3.46
4067 5339 1.868519 GCCGTACGACATGATCTTCCC 60.869 57.143 18.76 0.00 0.00 3.97
4068 5340 1.681793 CCGTACGACATGATCTTCCCT 59.318 52.381 18.76 0.00 0.00 4.20
4069 5341 2.543861 CCGTACGACATGATCTTCCCTG 60.544 54.545 18.76 0.00 0.00 4.45
4070 5342 2.474816 GTACGACATGATCTTCCCTGC 58.525 52.381 0.00 0.00 0.00 4.85
4071 5343 0.904649 ACGACATGATCTTCCCTGCA 59.095 50.000 0.00 0.00 0.00 4.41
4072 5344 1.134580 ACGACATGATCTTCCCTGCAG 60.135 52.381 6.78 6.78 0.00 4.41
4073 5345 1.134580 CGACATGATCTTCCCTGCAGT 60.135 52.381 13.81 0.00 0.00 4.40
4074 5346 2.679059 CGACATGATCTTCCCTGCAGTT 60.679 50.000 13.81 0.00 0.00 3.16
4075 5347 2.681848 GACATGATCTTCCCTGCAGTTG 59.318 50.000 13.81 3.36 0.00 3.16
4076 5348 2.022195 CATGATCTTCCCTGCAGTTGG 58.978 52.381 13.81 7.88 0.00 3.77
4077 5349 1.067295 TGATCTTCCCTGCAGTTGGT 58.933 50.000 13.81 0.00 0.00 3.67
4078 5350 1.271543 TGATCTTCCCTGCAGTTGGTG 60.272 52.381 13.81 5.83 0.00 4.17
4079 5351 0.038744 ATCTTCCCTGCAGTTGGTGG 59.961 55.000 13.81 6.28 0.00 4.61
4080 5352 2.203480 TTCCCTGCAGTTGGTGGC 60.203 61.111 13.81 0.00 0.00 5.01
4081 5353 4.641645 TCCCTGCAGTTGGTGGCG 62.642 66.667 13.81 0.00 0.00 5.69
4094 5366 4.776322 TGGCGCCATGTTCCCGAG 62.776 66.667 29.03 0.00 0.00 4.63
4096 5368 4.778143 GCGCCATGTTCCCGAGGT 62.778 66.667 0.00 0.00 0.00 3.85
4097 5369 2.046314 CGCCATGTTCCCGAGGTT 60.046 61.111 0.00 0.00 0.00 3.50
4098 5370 2.398554 CGCCATGTTCCCGAGGTTG 61.399 63.158 0.00 0.00 0.00 3.77
4099 5371 2.046285 GCCATGTTCCCGAGGTTGG 61.046 63.158 0.00 0.00 0.00 3.77
4100 5372 1.378762 CCATGTTCCCGAGGTTGGT 59.621 57.895 0.00 0.00 0.00 3.67
4101 5373 0.960364 CCATGTTCCCGAGGTTGGTG 60.960 60.000 0.00 0.00 0.00 4.17
4102 5374 0.250727 CATGTTCCCGAGGTTGGTGT 60.251 55.000 0.00 0.00 0.00 4.16
4103 5375 0.036306 ATGTTCCCGAGGTTGGTGTC 59.964 55.000 0.00 0.00 0.00 3.67
4104 5376 1.666872 GTTCCCGAGGTTGGTGTCG 60.667 63.158 0.00 0.00 35.91 4.35
4105 5377 2.135581 TTCCCGAGGTTGGTGTCGT 61.136 57.895 0.00 0.00 34.27 4.34
4106 5378 2.357034 CCCGAGGTTGGTGTCGTG 60.357 66.667 0.00 0.00 34.27 4.35
4107 5379 3.041940 CCGAGGTTGGTGTCGTGC 61.042 66.667 0.00 0.00 34.27 5.34
4108 5380 3.403057 CGAGGTTGGTGTCGTGCG 61.403 66.667 0.00 0.00 0.00 5.34
4109 5381 3.041940 GAGGTTGGTGTCGTGCGG 61.042 66.667 0.00 0.00 0.00 5.69
4110 5382 4.619227 AGGTTGGTGTCGTGCGGG 62.619 66.667 0.00 0.00 0.00 6.13
4111 5383 4.612412 GGTTGGTGTCGTGCGGGA 62.612 66.667 0.00 0.00 0.00 5.14
4112 5384 3.343421 GTTGGTGTCGTGCGGGAC 61.343 66.667 0.32 0.32 37.45 4.46
4126 5398 3.047280 GGACGCATGTGCCGTTGA 61.047 61.111 6.08 0.00 37.91 3.18
4127 5399 2.476051 GACGCATGTGCCGTTGAG 59.524 61.111 6.08 0.00 37.91 3.02
4128 5400 3.027170 GACGCATGTGCCGTTGAGG 62.027 63.158 6.08 0.00 44.97 3.86
4129 5401 3.049674 CGCATGTGCCGTTGAGGT 61.050 61.111 0.00 0.00 43.70 3.85
4130 5402 2.616330 CGCATGTGCCGTTGAGGTT 61.616 57.895 0.00 0.00 43.70 3.50
4131 5403 1.659794 GCATGTGCCGTTGAGGTTT 59.340 52.632 0.00 0.00 43.70 3.27
4132 5404 0.387239 GCATGTGCCGTTGAGGTTTC 60.387 55.000 0.00 0.00 43.70 2.78
4133 5405 1.238439 CATGTGCCGTTGAGGTTTCT 58.762 50.000 0.00 0.00 43.70 2.52
4134 5406 1.069022 CATGTGCCGTTGAGGTTTCTG 60.069 52.381 0.00 0.00 43.70 3.02
4135 5407 1.282875 GTGCCGTTGAGGTTTCTGC 59.717 57.895 0.00 0.00 43.70 4.26
4136 5408 1.896660 TGCCGTTGAGGTTTCTGCC 60.897 57.895 0.00 0.00 43.70 4.85
4137 5409 2.966309 GCCGTTGAGGTTTCTGCCG 61.966 63.158 0.00 0.00 43.70 5.69
4138 5410 2.325082 CCGTTGAGGTTTCTGCCGG 61.325 63.158 0.00 0.00 34.51 6.13
4139 5411 2.325082 CGTTGAGGTTTCTGCCGGG 61.325 63.158 2.18 0.00 0.00 5.73
4140 5412 1.072505 GTTGAGGTTTCTGCCGGGA 59.927 57.895 2.18 0.00 0.00 5.14
4141 5413 0.955919 GTTGAGGTTTCTGCCGGGAG 60.956 60.000 18.34 18.34 0.00 4.30
4142 5414 2.436824 GAGGTTTCTGCCGGGAGC 60.437 66.667 19.71 4.09 44.14 4.70
4143 5415 3.978571 GAGGTTTCTGCCGGGAGCC 62.979 68.421 19.71 14.09 42.71 4.70
4144 5416 4.344865 GGTTTCTGCCGGGAGCCA 62.345 66.667 19.71 4.10 42.71 4.75
4145 5417 2.044946 GTTTCTGCCGGGAGCCAT 60.045 61.111 19.71 0.00 42.71 4.40
4146 5418 2.045045 TTTCTGCCGGGAGCCATG 60.045 61.111 19.71 0.00 42.71 3.66
4147 5419 2.905996 TTTCTGCCGGGAGCCATGT 61.906 57.895 19.71 0.00 42.71 3.21
4148 5420 2.424842 TTTCTGCCGGGAGCCATGTT 62.425 55.000 19.71 0.00 42.71 2.71
4149 5421 3.136123 CTGCCGGGAGCCATGTTG 61.136 66.667 11.10 0.00 42.71 3.33
4150 5422 4.738998 TGCCGGGAGCCATGTTGG 62.739 66.667 2.18 0.00 42.71 3.77
4152 5424 4.820744 CCGGGAGCCATGTTGGGG 62.821 72.222 0.00 0.00 38.19 4.96
4159 5431 4.850193 CCATGTTGGGGCTTGAGT 57.150 55.556 0.00 0.00 32.67 3.41
4160 5432 2.571548 CCATGTTGGGGCTTGAGTC 58.428 57.895 0.00 0.00 32.67 3.36
4161 5433 0.967380 CCATGTTGGGGCTTGAGTCC 60.967 60.000 0.00 0.00 39.63 3.85
4162 5434 1.002134 ATGTTGGGGCTTGAGTCCG 60.002 57.895 0.00 0.00 41.79 4.79
4163 5435 1.779061 ATGTTGGGGCTTGAGTCCGT 61.779 55.000 0.00 0.00 41.79 4.69
4164 5436 1.228154 GTTGGGGCTTGAGTCCGTT 60.228 57.895 0.00 0.00 41.79 4.44
4165 5437 1.228124 TTGGGGCTTGAGTCCGTTG 60.228 57.895 0.00 0.00 41.79 4.10
4166 5438 2.359975 GGGGCTTGAGTCCGTTGG 60.360 66.667 0.00 0.00 41.79 3.77
4167 5439 2.430367 GGGCTTGAGTCCGTTGGT 59.570 61.111 0.00 0.00 0.00 3.67
4168 5440 1.228154 GGGCTTGAGTCCGTTGGTT 60.228 57.895 0.00 0.00 0.00 3.67
4169 5441 1.515521 GGGCTTGAGTCCGTTGGTTG 61.516 60.000 0.00 0.00 0.00 3.77
4170 5442 1.282875 GCTTGAGTCCGTTGGTTGC 59.717 57.895 0.00 0.00 0.00 4.17
4171 5443 1.444119 GCTTGAGTCCGTTGGTTGCA 61.444 55.000 0.00 0.00 0.00 4.08
4172 5444 0.588252 CTTGAGTCCGTTGGTTGCAG 59.412 55.000 0.00 0.00 0.00 4.41
4173 5445 1.444119 TTGAGTCCGTTGGTTGCAGC 61.444 55.000 0.00 0.00 0.00 5.25
4174 5446 2.954753 GAGTCCGTTGGTTGCAGCG 61.955 63.158 0.00 0.00 0.00 5.18
4175 5447 3.276846 GTCCGTTGGTTGCAGCGT 61.277 61.111 0.00 0.00 0.00 5.07
4176 5448 2.970324 TCCGTTGGTTGCAGCGTC 60.970 61.111 0.00 0.00 0.00 5.19
4177 5449 3.276091 CCGTTGGTTGCAGCGTCA 61.276 61.111 0.00 0.00 0.00 4.35
4178 5450 2.712539 CGTTGGTTGCAGCGTCAA 59.287 55.556 0.00 0.00 0.00 3.18
4179 5451 1.369209 CGTTGGTTGCAGCGTCAAG 60.369 57.895 0.00 0.00 0.00 3.02
4180 5452 1.008538 GTTGGTTGCAGCGTCAAGG 60.009 57.895 0.00 0.00 0.00 3.61
4181 5453 1.453015 TTGGTTGCAGCGTCAAGGT 60.453 52.632 0.00 0.00 0.00 3.50
4182 5454 0.179043 TTGGTTGCAGCGTCAAGGTA 60.179 50.000 0.00 0.00 0.00 3.08
4183 5455 0.882927 TGGTTGCAGCGTCAAGGTAC 60.883 55.000 0.00 0.00 0.00 3.34
4184 5456 1.491563 GTTGCAGCGTCAAGGTACG 59.508 57.895 0.00 0.00 45.58 3.67
4185 5457 1.666553 TTGCAGCGTCAAGGTACGG 60.667 57.895 0.00 0.00 43.06 4.02
4186 5458 3.488090 GCAGCGTCAAGGTACGGC 61.488 66.667 0.00 0.00 43.06 5.68
4187 5459 2.048597 CAGCGTCAAGGTACGGCA 60.049 61.111 0.00 0.00 43.06 5.69
4188 5460 2.048503 AGCGTCAAGGTACGGCAC 60.049 61.111 0.00 0.00 43.06 5.01
4196 5468 3.384348 GGTACGGCACCTCAAGGA 58.616 61.111 2.30 0.00 44.79 3.36
4197 5469 1.079336 GGTACGGCACCTCAAGGAC 60.079 63.158 2.30 0.00 44.79 3.85
4198 5470 1.445582 GTACGGCACCTCAAGGACG 60.446 63.158 2.30 6.99 38.94 4.79
4199 5471 3.291101 TACGGCACCTCAAGGACGC 62.291 63.158 2.30 4.96 38.94 5.19
4200 5472 4.379243 CGGCACCTCAAGGACGCT 62.379 66.667 2.30 0.00 38.94 5.07
4201 5473 2.435059 GGCACCTCAAGGACGCTC 60.435 66.667 2.30 0.00 38.94 5.03
4202 5474 2.343758 GCACCTCAAGGACGCTCA 59.656 61.111 2.30 0.00 38.94 4.26
4203 5475 2.029844 GCACCTCAAGGACGCTCAC 61.030 63.158 2.30 0.00 38.94 3.51
4204 5476 1.367471 CACCTCAAGGACGCTCACA 59.633 57.895 2.30 0.00 38.94 3.58
4205 5477 0.036952 CACCTCAAGGACGCTCACAT 60.037 55.000 2.30 0.00 38.94 3.21
4206 5478 0.036952 ACCTCAAGGACGCTCACATG 60.037 55.000 2.30 0.00 38.94 3.21
4207 5479 0.742281 CCTCAAGGACGCTCACATGG 60.742 60.000 0.00 0.00 37.39 3.66
4208 5480 0.247460 CTCAAGGACGCTCACATGGA 59.753 55.000 0.00 0.00 0.00 3.41
4209 5481 0.037326 TCAAGGACGCTCACATGGAC 60.037 55.000 0.00 0.00 0.00 4.02
4210 5482 0.036952 CAAGGACGCTCACATGGACT 60.037 55.000 0.00 0.00 0.00 3.85
4211 5483 0.687354 AAGGACGCTCACATGGACTT 59.313 50.000 0.00 0.00 0.00 3.01
4212 5484 1.557099 AGGACGCTCACATGGACTTA 58.443 50.000 0.00 0.00 0.00 2.24
4213 5485 1.899814 AGGACGCTCACATGGACTTAA 59.100 47.619 0.00 0.00 0.00 1.85
4214 5486 2.301870 AGGACGCTCACATGGACTTAAA 59.698 45.455 0.00 0.00 0.00 1.52
4215 5487 2.415512 GGACGCTCACATGGACTTAAAC 59.584 50.000 0.00 0.00 0.00 2.01
4216 5488 2.415512 GACGCTCACATGGACTTAAACC 59.584 50.000 0.00 0.00 0.00 3.27
4217 5489 2.038557 ACGCTCACATGGACTTAAACCT 59.961 45.455 0.00 0.00 0.00 3.50
4218 5490 3.074412 CGCTCACATGGACTTAAACCTT 58.926 45.455 0.00 0.00 0.00 3.50
4219 5491 3.120199 CGCTCACATGGACTTAAACCTTG 60.120 47.826 0.00 10.57 38.16 3.61
4220 5492 3.366374 GCTCACATGGACTTAAACCTTGC 60.366 47.826 0.00 0.00 36.46 4.01
4221 5493 2.811431 TCACATGGACTTAAACCTTGCG 59.189 45.455 0.00 5.57 36.46 4.85
4222 5494 2.552315 CACATGGACTTAAACCTTGCGT 59.448 45.455 0.00 0.00 36.46 5.24
4223 5495 3.004315 CACATGGACTTAAACCTTGCGTT 59.996 43.478 0.00 0.00 36.46 4.84
4224 5496 3.004315 ACATGGACTTAAACCTTGCGTTG 59.996 43.478 0.00 0.00 36.46 4.10
4225 5497 1.950909 TGGACTTAAACCTTGCGTTGG 59.049 47.619 0.00 0.00 33.93 3.77
4226 5498 1.268625 GGACTTAAACCTTGCGTTGGG 59.731 52.381 0.00 0.00 33.93 4.12
4227 5499 0.671796 ACTTAAACCTTGCGTTGGGC 59.328 50.000 0.00 0.00 43.96 5.36
4236 5508 2.740826 GCGTTGGGCAGCTTACGA 60.741 61.111 15.42 0.00 42.87 3.43
4237 5509 2.322081 GCGTTGGGCAGCTTACGAA 61.322 57.895 15.42 0.00 42.87 3.85
4238 5510 1.847890 GCGTTGGGCAGCTTACGAAA 61.848 55.000 15.42 0.00 42.87 3.46
4239 5511 0.802494 CGTTGGGCAGCTTACGAAAT 59.198 50.000 8.24 0.00 36.16 2.17
4240 5512 1.202031 CGTTGGGCAGCTTACGAAATC 60.202 52.381 8.24 0.00 36.16 2.17
4241 5513 2.084546 GTTGGGCAGCTTACGAAATCT 58.915 47.619 0.00 0.00 0.00 2.40
4242 5514 2.024176 TGGGCAGCTTACGAAATCTC 57.976 50.000 0.00 0.00 0.00 2.75
4243 5515 1.300481 GGGCAGCTTACGAAATCTCC 58.700 55.000 0.00 0.00 0.00 3.71
4244 5516 1.300481 GGCAGCTTACGAAATCTCCC 58.700 55.000 0.00 0.00 0.00 4.30
4245 5517 1.134371 GGCAGCTTACGAAATCTCCCT 60.134 52.381 0.00 0.00 0.00 4.20
4246 5518 2.633488 GCAGCTTACGAAATCTCCCTT 58.367 47.619 0.00 0.00 0.00 3.95
4247 5519 2.609916 GCAGCTTACGAAATCTCCCTTC 59.390 50.000 0.00 0.00 0.00 3.46
4253 5525 2.010145 CGAAATCTCCCTTCGCTTCA 57.990 50.000 0.00 0.00 39.22 3.02
4254 5526 1.929836 CGAAATCTCCCTTCGCTTCAG 59.070 52.381 0.00 0.00 39.22 3.02
4255 5527 2.417379 CGAAATCTCCCTTCGCTTCAGA 60.417 50.000 0.00 0.00 39.22 3.27
4256 5528 2.977772 AATCTCCCTTCGCTTCAGAG 57.022 50.000 0.00 0.00 0.00 3.35
4257 5529 1.118838 ATCTCCCTTCGCTTCAGAGG 58.881 55.000 0.00 0.00 0.00 3.69
4258 5530 0.972983 TCTCCCTTCGCTTCAGAGGG 60.973 60.000 1.14 1.14 41.03 4.30
4259 5531 1.229209 TCCCTTCGCTTCAGAGGGT 60.229 57.895 7.49 0.00 40.55 4.34
4260 5532 1.078848 CCCTTCGCTTCAGAGGGTG 60.079 63.158 0.00 0.00 35.82 4.61
4261 5533 1.544825 CCCTTCGCTTCAGAGGGTGA 61.545 60.000 0.00 0.00 35.82 4.02
4262 5534 0.321671 CCTTCGCTTCAGAGGGTGAA 59.678 55.000 0.00 0.00 43.26 3.18
4263 5535 1.270839 CCTTCGCTTCAGAGGGTGAAA 60.271 52.381 0.00 0.00 44.83 2.69
4264 5536 2.072298 CTTCGCTTCAGAGGGTGAAAG 58.928 52.381 0.00 0.00 44.83 2.62
4265 5537 1.048601 TCGCTTCAGAGGGTGAAAGT 58.951 50.000 0.00 0.00 44.83 2.66
4266 5538 1.416401 TCGCTTCAGAGGGTGAAAGTT 59.584 47.619 0.00 0.00 44.83 2.66
4267 5539 1.532868 CGCTTCAGAGGGTGAAAGTTG 59.467 52.381 0.00 0.00 44.83 3.16
4268 5540 2.806745 CGCTTCAGAGGGTGAAAGTTGA 60.807 50.000 0.00 0.00 44.83 3.18
4269 5541 3.214328 GCTTCAGAGGGTGAAAGTTGAA 58.786 45.455 0.00 0.00 44.83 2.69
4270 5542 3.632145 GCTTCAGAGGGTGAAAGTTGAAA 59.368 43.478 0.00 0.00 44.83 2.69
4271 5543 4.279420 GCTTCAGAGGGTGAAAGTTGAAAT 59.721 41.667 0.00 0.00 44.83 2.17
4272 5544 5.563671 GCTTCAGAGGGTGAAAGTTGAAATC 60.564 44.000 0.00 0.00 44.83 2.17
4273 5545 4.398319 TCAGAGGGTGAAAGTTGAAATCC 58.602 43.478 0.00 0.00 29.64 3.01
4274 5546 3.189287 CAGAGGGTGAAAGTTGAAATCCG 59.811 47.826 0.00 0.00 0.00 4.18
4275 5547 1.886542 AGGGTGAAAGTTGAAATCCGC 59.113 47.619 0.00 0.00 0.00 5.54
4276 5548 1.611491 GGGTGAAAGTTGAAATCCGCA 59.389 47.619 0.00 0.00 0.00 5.69
4277 5549 2.351738 GGGTGAAAGTTGAAATCCGCAG 60.352 50.000 0.00 0.00 0.00 5.18
4278 5550 2.319472 GTGAAAGTTGAAATCCGCAGC 58.681 47.619 0.00 0.00 0.00 5.25
4279 5551 2.030805 GTGAAAGTTGAAATCCGCAGCT 60.031 45.455 0.00 0.00 0.00 4.24
4280 5552 2.622942 TGAAAGTTGAAATCCGCAGCTT 59.377 40.909 0.00 0.00 38.24 3.74
4281 5553 3.068024 TGAAAGTTGAAATCCGCAGCTTT 59.932 39.130 0.00 0.00 45.36 3.51
4282 5554 2.712057 AGTTGAAATCCGCAGCTTTG 57.288 45.000 0.00 0.00 0.00 2.77
4283 5555 1.270550 AGTTGAAATCCGCAGCTTTGG 59.729 47.619 0.00 0.00 0.00 3.28
4284 5556 1.000274 GTTGAAATCCGCAGCTTTGGT 60.000 47.619 1.08 0.00 0.00 3.67
4285 5557 0.597568 TGAAATCCGCAGCTTTGGTG 59.402 50.000 1.08 0.00 0.00 4.17
4292 5564 4.162592 CAGCTTTGGTGCCACTGA 57.837 55.556 0.00 0.00 0.00 3.41
4293 5565 1.656441 CAGCTTTGGTGCCACTGAC 59.344 57.895 0.00 0.00 0.00 3.51
4294 5566 1.893808 AGCTTTGGTGCCACTGACG 60.894 57.895 0.00 0.00 0.00 4.35
4295 5567 2.639286 CTTTGGTGCCACTGACGC 59.361 61.111 0.00 0.00 0.00 5.19
4296 5568 3.240606 CTTTGGTGCCACTGACGCG 62.241 63.158 3.53 3.53 0.00 6.01
4303 5575 4.742201 CCACTGACGCGGAGGTGG 62.742 72.222 24.07 24.07 42.29 4.61
4304 5576 3.680786 CACTGACGCGGAGGTGGA 61.681 66.667 12.47 0.00 0.00 4.02
4305 5577 3.374402 ACTGACGCGGAGGTGGAG 61.374 66.667 12.47 0.00 0.00 3.86
4306 5578 4.135153 CTGACGCGGAGGTGGAGG 62.135 72.222 12.47 0.00 0.00 4.30
4307 5579 4.671590 TGACGCGGAGGTGGAGGA 62.672 66.667 12.47 0.00 0.00 3.71
4308 5580 3.827898 GACGCGGAGGTGGAGGAG 61.828 72.222 12.47 0.00 0.00 3.69
4309 5581 4.361971 ACGCGGAGGTGGAGGAGA 62.362 66.667 12.47 0.00 0.00 3.71
4310 5582 3.827898 CGCGGAGGTGGAGGAGAC 61.828 72.222 0.00 0.00 0.00 3.36
4311 5583 3.827898 GCGGAGGTGGAGGAGACG 61.828 72.222 0.00 0.00 0.00 4.18
4312 5584 3.141488 CGGAGGTGGAGGAGACGG 61.141 72.222 0.00 0.00 0.00 4.79
4313 5585 2.359404 GGAGGTGGAGGAGACGGA 59.641 66.667 0.00 0.00 0.00 4.69
4314 5586 1.755008 GGAGGTGGAGGAGACGGAG 60.755 68.421 0.00 0.00 0.00 4.63
4315 5587 1.755008 GAGGTGGAGGAGACGGAGG 60.755 68.421 0.00 0.00 0.00 4.30
4316 5588 3.462678 GGTGGAGGAGACGGAGGC 61.463 72.222 0.00 0.00 0.00 4.70
4317 5589 3.462678 GTGGAGGAGACGGAGGCC 61.463 72.222 0.00 0.00 0.00 5.19
4336 5608 4.056125 TGCTGAGGCACGAGGTCG 62.056 66.667 0.00 0.00 44.28 4.79
4337 5609 3.749064 GCTGAGGCACGAGGTCGA 61.749 66.667 6.35 0.00 43.39 4.20
4338 5610 2.179517 CTGAGGCACGAGGTCGAC 59.820 66.667 7.13 7.13 43.02 4.20
4339 5611 2.596338 TGAGGCACGAGGTCGACA 60.596 61.111 18.91 0.00 43.02 4.35
4340 5612 1.938657 CTGAGGCACGAGGTCGACAT 61.939 60.000 18.91 11.04 43.02 3.06
4341 5613 1.226717 GAGGCACGAGGTCGACATC 60.227 63.158 19.83 19.83 43.02 3.06
4342 5614 2.202756 GGCACGAGGTCGACATCC 60.203 66.667 23.20 10.18 43.02 3.51
4343 5615 2.571757 GCACGAGGTCGACATCCA 59.428 61.111 23.20 0.00 43.02 3.41
4344 5616 1.141881 GCACGAGGTCGACATCCAT 59.858 57.895 23.20 10.01 43.02 3.41
4345 5617 0.872021 GCACGAGGTCGACATCCATC 60.872 60.000 23.20 9.19 43.02 3.51
4346 5618 0.249073 CACGAGGTCGACATCCATCC 60.249 60.000 23.20 0.92 43.02 3.51
4347 5619 1.364171 CGAGGTCGACATCCATCCC 59.636 63.158 23.20 0.12 43.02 3.85
4348 5620 1.391933 CGAGGTCGACATCCATCCCA 61.392 60.000 23.20 0.00 43.02 4.37
4349 5621 0.830648 GAGGTCGACATCCATCCCAA 59.169 55.000 19.13 0.00 0.00 4.12
4350 5622 0.541863 AGGTCGACATCCATCCCAAC 59.458 55.000 18.91 0.00 0.00 3.77
4351 5623 0.463833 GGTCGACATCCATCCCAACC 60.464 60.000 18.91 0.00 0.00 3.77
4352 5624 0.251916 GTCGACATCCATCCCAACCA 59.748 55.000 11.55 0.00 0.00 3.67
4353 5625 1.134098 GTCGACATCCATCCCAACCAT 60.134 52.381 11.55 0.00 0.00 3.55
4354 5626 1.140852 TCGACATCCATCCCAACCATC 59.859 52.381 0.00 0.00 0.00 3.51
4355 5627 1.815408 CGACATCCATCCCAACCATCC 60.815 57.143 0.00 0.00 0.00 3.51
4356 5628 0.183492 ACATCCATCCCAACCATCCG 59.817 55.000 0.00 0.00 0.00 4.18
4357 5629 0.538057 CATCCATCCCAACCATCCGG 60.538 60.000 0.00 0.00 38.77 5.14
4366 5638 3.295800 ACCATCCGGTCCTTCGTC 58.704 61.111 0.00 0.00 44.71 4.20
4367 5639 1.305046 ACCATCCGGTCCTTCGTCT 60.305 57.895 0.00 0.00 44.71 4.18
4368 5640 1.141881 CCATCCGGTCCTTCGTCTG 59.858 63.158 0.00 0.00 0.00 3.51
4369 5641 1.605058 CCATCCGGTCCTTCGTCTGT 61.605 60.000 0.00 0.00 0.00 3.41
4370 5642 0.179134 CATCCGGTCCTTCGTCTGTC 60.179 60.000 0.00 0.00 0.00 3.51
4371 5643 0.323542 ATCCGGTCCTTCGTCTGTCT 60.324 55.000 0.00 0.00 0.00 3.41
4372 5644 0.959372 TCCGGTCCTTCGTCTGTCTC 60.959 60.000 0.00 0.00 0.00 3.36
4373 5645 0.961358 CCGGTCCTTCGTCTGTCTCT 60.961 60.000 0.00 0.00 0.00 3.10
4374 5646 0.169230 CGGTCCTTCGTCTGTCTCTG 59.831 60.000 0.00 0.00 0.00 3.35
4375 5647 0.109039 GGTCCTTCGTCTGTCTCTGC 60.109 60.000 0.00 0.00 0.00 4.26
4376 5648 0.598562 GTCCTTCGTCTGTCTCTGCA 59.401 55.000 0.00 0.00 0.00 4.41
4377 5649 1.000163 GTCCTTCGTCTGTCTCTGCAA 60.000 52.381 0.00 0.00 0.00 4.08
4378 5650 1.686587 TCCTTCGTCTGTCTCTGCAAA 59.313 47.619 0.00 0.00 0.00 3.68
4379 5651 2.102420 TCCTTCGTCTGTCTCTGCAAAA 59.898 45.455 0.00 0.00 0.00 2.44
4380 5652 2.872245 CCTTCGTCTGTCTCTGCAAAAA 59.128 45.455 0.00 0.00 0.00 1.94
4381 5653 3.499918 CCTTCGTCTGTCTCTGCAAAAAT 59.500 43.478 0.00 0.00 0.00 1.82
4382 5654 4.461405 CTTCGTCTGTCTCTGCAAAAATG 58.539 43.478 0.00 0.00 0.00 2.32
4383 5655 3.466836 TCGTCTGTCTCTGCAAAAATGT 58.533 40.909 0.00 0.00 0.00 2.71
4384 5656 3.876914 TCGTCTGTCTCTGCAAAAATGTT 59.123 39.130 0.00 0.00 0.00 2.71
4385 5657 5.053811 TCGTCTGTCTCTGCAAAAATGTTA 58.946 37.500 0.00 0.00 0.00 2.41
4386 5658 5.525745 TCGTCTGTCTCTGCAAAAATGTTAA 59.474 36.000 0.00 0.00 0.00 2.01
4387 5659 6.037720 TCGTCTGTCTCTGCAAAAATGTTAAA 59.962 34.615 0.00 0.00 0.00 1.52
4388 5660 6.690957 CGTCTGTCTCTGCAAAAATGTTAAAA 59.309 34.615 0.00 0.00 0.00 1.52
4389 5661 7.379529 CGTCTGTCTCTGCAAAAATGTTAAAAT 59.620 33.333 0.00 0.00 0.00 1.82
4390 5662 8.694394 GTCTGTCTCTGCAAAAATGTTAAAATC 58.306 33.333 0.00 0.00 0.00 2.17
4391 5663 8.412456 TCTGTCTCTGCAAAAATGTTAAAATCA 58.588 29.630 0.00 0.00 0.00 2.57
4392 5664 8.939201 TGTCTCTGCAAAAATGTTAAAATCAA 57.061 26.923 0.00 0.00 0.00 2.57
4393 5665 9.033481 TGTCTCTGCAAAAATGTTAAAATCAAG 57.967 29.630 0.00 0.00 0.00 3.02
4394 5666 8.006027 GTCTCTGCAAAAATGTTAAAATCAAGC 58.994 33.333 0.00 0.00 0.00 4.01
4395 5667 7.710044 TCTCTGCAAAAATGTTAAAATCAAGCA 59.290 29.630 0.00 0.00 0.00 3.91
4396 5668 8.206325 TCTGCAAAAATGTTAAAATCAAGCAA 57.794 26.923 0.00 0.00 0.00 3.91
4397 5669 8.838365 TCTGCAAAAATGTTAAAATCAAGCAAT 58.162 25.926 0.00 0.00 0.00 3.56
4400 5672 9.545611 GCAAAAATGTTAAAATCAAGCAATAGG 57.454 29.630 0.00 0.00 0.00 2.57
4406 5678 9.686683 ATGTTAAAATCAAGCAATAGGTACTCT 57.313 29.630 0.00 0.00 41.75 3.24
4407 5679 9.162764 TGTTAAAATCAAGCAATAGGTACTCTC 57.837 33.333 0.00 0.00 41.75 3.20
4408 5680 9.384764 GTTAAAATCAAGCAATAGGTACTCTCT 57.615 33.333 0.00 0.00 41.75 3.10
4409 5681 9.601217 TTAAAATCAAGCAATAGGTACTCTCTC 57.399 33.333 0.00 0.00 41.75 3.20
4410 5682 7.430760 AAATCAAGCAATAGGTACTCTCTCT 57.569 36.000 0.00 0.00 41.75 3.10
4411 5683 6.648879 ATCAAGCAATAGGTACTCTCTCTC 57.351 41.667 0.00 0.00 41.75 3.20
4879 6151 3.925453 TCTGTGTGTGTGTGTGTGT 57.075 47.368 0.00 0.00 0.00 3.72
4880 6152 1.437625 TCTGTGTGTGTGTGTGTGTG 58.562 50.000 0.00 0.00 0.00 3.82
4881 6153 1.155889 CTGTGTGTGTGTGTGTGTGT 58.844 50.000 0.00 0.00 0.00 3.72
4882 6154 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
4883 6155 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
4884 6156 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
4885 6157 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
4886 6158 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
4887 6159 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
4888 6160 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
4889 6161 0.454285 GTGTGTGTGTGTGTGTGTGC 60.454 55.000 0.00 0.00 0.00 4.57
4890 6162 1.225991 GTGTGTGTGTGTGTGTGCG 60.226 57.895 0.00 0.00 0.00 5.34
4891 6163 2.277247 GTGTGTGTGTGTGTGCGC 60.277 61.111 0.00 0.00 0.00 6.09
4892 6164 3.858989 TGTGTGTGTGTGTGCGCG 61.859 61.111 0.00 0.00 0.00 6.86
4909 6181 3.860125 GCGTGTGCGTGTGTGTGT 61.860 61.111 0.00 0.00 40.81 3.72
4910 6182 2.021243 CGTGTGCGTGTGTGTGTG 59.979 61.111 0.00 0.00 0.00 3.82
4911 6183 2.735677 CGTGTGCGTGTGTGTGTGT 61.736 57.895 0.00 0.00 0.00 3.72
4912 6184 1.225991 GTGTGCGTGTGTGTGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
4913 6185 2.277247 GTGCGTGTGTGTGTGTGC 60.277 61.111 0.00 0.00 0.00 4.57
4914 6186 2.743928 TGCGTGTGTGTGTGTGCA 60.744 55.556 0.00 0.00 0.00 4.57
4915 6187 2.277247 GCGTGTGTGTGTGTGCAC 60.277 61.111 10.75 10.75 45.44 4.57
4916 6188 2.403186 CGTGTGTGTGTGTGCACC 59.597 61.111 15.69 6.37 44.65 5.01
4917 6189 2.798009 GTGTGTGTGTGTGCACCC 59.202 61.111 15.69 2.52 44.65 4.61
4918 6190 2.439338 TGTGTGTGTGTGCACCCC 60.439 61.111 15.69 5.46 44.65 4.95
4919 6191 2.124320 GTGTGTGTGTGCACCCCT 60.124 61.111 15.69 0.00 44.65 4.79
4920 6192 1.147376 GTGTGTGTGTGCACCCCTA 59.853 57.895 15.69 0.00 44.65 3.53
4921 6193 0.464735 GTGTGTGTGTGCACCCCTAA 60.465 55.000 15.69 0.00 44.65 2.69
4922 6194 0.476338 TGTGTGTGTGCACCCCTAAT 59.524 50.000 15.69 0.00 44.65 1.73
4923 6195 1.165270 GTGTGTGTGCACCCCTAATC 58.835 55.000 15.69 0.00 44.65 1.75
4924 6196 0.037590 TGTGTGTGCACCCCTAATCC 59.962 55.000 15.69 0.00 44.65 3.01
4925 6197 0.679960 GTGTGTGCACCCCTAATCCC 60.680 60.000 15.69 0.00 39.61 3.85
4926 6198 1.136961 TGTGTGCACCCCTAATCCCA 61.137 55.000 15.69 0.00 0.00 4.37
4927 6199 0.039035 GTGTGCACCCCTAATCCCAA 59.961 55.000 15.69 0.00 0.00 4.12
4928 6200 0.331278 TGTGCACCCCTAATCCCAAG 59.669 55.000 15.69 0.00 0.00 3.61
4929 6201 0.331616 GTGCACCCCTAATCCCAAGT 59.668 55.000 5.22 0.00 0.00 3.16
4930 6202 1.562475 GTGCACCCCTAATCCCAAGTA 59.438 52.381 5.22 0.00 0.00 2.24
4931 6203 2.174854 GTGCACCCCTAATCCCAAGTAT 59.825 50.000 5.22 0.00 0.00 2.12
4932 6204 2.856231 TGCACCCCTAATCCCAAGTATT 59.144 45.455 0.00 0.00 0.00 1.89
4933 6205 3.270960 TGCACCCCTAATCCCAAGTATTT 59.729 43.478 0.00 0.00 0.00 1.40
4934 6206 4.479056 TGCACCCCTAATCCCAAGTATTTA 59.521 41.667 0.00 0.00 0.00 1.40
4935 6207 4.825634 GCACCCCTAATCCCAAGTATTTAC 59.174 45.833 0.00 0.00 0.00 2.01
4936 6208 5.398695 GCACCCCTAATCCCAAGTATTTACT 60.399 44.000 0.00 0.00 38.39 2.24
4937 6209 6.183361 GCACCCCTAATCCCAAGTATTTACTA 60.183 42.308 0.00 0.00 34.99 1.82
4938 6210 7.475798 GCACCCCTAATCCCAAGTATTTACTAT 60.476 40.741 0.00 0.00 34.99 2.12
4939 6211 8.101419 CACCCCTAATCCCAAGTATTTACTATC 58.899 40.741 0.00 0.00 34.99 2.08
4940 6212 7.038516 ACCCCTAATCCCAAGTATTTACTATCG 60.039 40.741 0.00 0.00 34.99 2.92
4941 6213 6.817140 CCCTAATCCCAAGTATTTACTATCGC 59.183 42.308 0.00 0.00 34.99 4.58
4942 6214 7.383687 CCTAATCCCAAGTATTTACTATCGCA 58.616 38.462 0.00 0.00 34.99 5.10
4943 6215 7.545965 CCTAATCCCAAGTATTTACTATCGCAG 59.454 40.741 0.00 0.00 34.99 5.18
4944 6216 5.209818 TCCCAAGTATTTACTATCGCAGG 57.790 43.478 0.00 0.00 34.99 4.85
4945 6217 4.039973 TCCCAAGTATTTACTATCGCAGGG 59.960 45.833 0.00 0.00 34.99 4.45
4946 6218 4.315803 CCAAGTATTTACTATCGCAGGGG 58.684 47.826 0.00 0.00 34.99 4.79
4947 6219 4.315803 CAAGTATTTACTATCGCAGGGGG 58.684 47.826 0.00 0.00 34.99 5.40
4948 6220 3.853207 AGTATTTACTATCGCAGGGGGA 58.147 45.455 0.00 0.00 34.13 4.81
4949 6221 4.426704 AGTATTTACTATCGCAGGGGGAT 58.573 43.478 1.40 1.40 38.69 3.85
4950 6222 4.844655 AGTATTTACTATCGCAGGGGGATT 59.155 41.667 1.02 0.00 36.61 3.01
4951 6223 3.764237 TTTACTATCGCAGGGGGATTC 57.236 47.619 1.02 0.00 36.61 2.52
4952 6224 2.696526 TACTATCGCAGGGGGATTCT 57.303 50.000 1.02 0.00 36.61 2.40
4953 6225 2.696526 ACTATCGCAGGGGGATTCTA 57.303 50.000 1.02 0.00 36.61 2.10
4954 6226 2.972348 ACTATCGCAGGGGGATTCTAA 58.028 47.619 1.02 0.00 36.61 2.10
4955 6227 3.314693 ACTATCGCAGGGGGATTCTAAA 58.685 45.455 1.02 0.00 36.61 1.85
4956 6228 3.714798 ACTATCGCAGGGGGATTCTAAAA 59.285 43.478 1.02 0.00 36.61 1.52
4957 6229 2.710096 TCGCAGGGGGATTCTAAAAG 57.290 50.000 0.00 0.00 0.00 2.27
4958 6230 1.025041 CGCAGGGGGATTCTAAAAGC 58.975 55.000 0.00 0.00 0.00 3.51
4959 6231 1.408822 CGCAGGGGGATTCTAAAAGCT 60.409 52.381 0.00 0.00 0.00 3.74
4960 6232 2.739943 GCAGGGGGATTCTAAAAGCTT 58.260 47.619 0.00 0.00 0.00 3.74
4961 6233 3.684413 CGCAGGGGGATTCTAAAAGCTTA 60.684 47.826 0.00 0.00 0.00 3.09
4962 6234 4.474394 GCAGGGGGATTCTAAAAGCTTAT 58.526 43.478 0.00 0.00 0.00 1.73
4963 6235 4.279420 GCAGGGGGATTCTAAAAGCTTATG 59.721 45.833 0.00 0.00 0.00 1.90
4964 6236 5.449553 CAGGGGGATTCTAAAAGCTTATGT 58.550 41.667 0.00 0.00 0.00 2.29
4965 6237 5.893824 CAGGGGGATTCTAAAAGCTTATGTT 59.106 40.000 0.00 0.00 0.00 2.71
4966 6238 5.893824 AGGGGGATTCTAAAAGCTTATGTTG 59.106 40.000 0.00 0.00 0.00 3.33
4967 6239 5.891551 GGGGGATTCTAAAAGCTTATGTTGA 59.108 40.000 0.00 0.00 0.00 3.18
4968 6240 6.551227 GGGGGATTCTAAAAGCTTATGTTGAT 59.449 38.462 0.00 0.00 0.00 2.57
4969 6241 7.428826 GGGGATTCTAAAAGCTTATGTTGATG 58.571 38.462 0.00 0.00 0.00 3.07
4970 6242 7.285401 GGGGATTCTAAAAGCTTATGTTGATGA 59.715 37.037 0.00 0.00 0.00 2.92
4971 6243 8.854117 GGGATTCTAAAAGCTTATGTTGATGAT 58.146 33.333 0.00 0.00 0.00 2.45
4980 6252 9.976511 AAAGCTTATGTTGATGATAATCCATTG 57.023 29.630 0.00 0.00 0.00 2.82
4981 6253 8.929260 AGCTTATGTTGATGATAATCCATTGA 57.071 30.769 0.00 0.00 0.00 2.57
4982 6254 9.358406 AGCTTATGTTGATGATAATCCATTGAA 57.642 29.630 0.00 0.00 0.00 2.69
4983 6255 9.622004 GCTTATGTTGATGATAATCCATTGAAG 57.378 33.333 0.00 0.00 0.00 3.02
4985 6257 6.395426 TGTTGATGATAATCCATTGAAGGC 57.605 37.500 0.00 0.00 0.00 4.35
4986 6258 5.892686 TGTTGATGATAATCCATTGAAGGCA 59.107 36.000 0.00 0.00 0.00 4.75
4987 6259 6.040054 TGTTGATGATAATCCATTGAAGGCAG 59.960 38.462 0.00 0.00 0.00 4.85
4988 6260 5.074804 TGATGATAATCCATTGAAGGCAGG 58.925 41.667 0.00 0.00 0.00 4.85
4989 6261 4.794311 TGATAATCCATTGAAGGCAGGA 57.206 40.909 0.00 0.00 34.12 3.86
4990 6262 4.722220 TGATAATCCATTGAAGGCAGGAG 58.278 43.478 0.00 0.00 32.91 3.69
4991 6263 4.413189 TGATAATCCATTGAAGGCAGGAGA 59.587 41.667 0.00 0.00 32.91 3.71
4992 6264 3.744940 AATCCATTGAAGGCAGGAGAA 57.255 42.857 0.00 0.00 32.91 2.87
4993 6265 3.744940 ATCCATTGAAGGCAGGAGAAA 57.255 42.857 0.00 0.00 32.91 2.52
4994 6266 3.524095 TCCATTGAAGGCAGGAGAAAA 57.476 42.857 0.00 0.00 0.00 2.29
4995 6267 3.843422 TCCATTGAAGGCAGGAGAAAAA 58.157 40.909 0.00 0.00 0.00 1.94
4996 6268 3.828451 TCCATTGAAGGCAGGAGAAAAAG 59.172 43.478 0.00 0.00 0.00 2.27
4997 6269 3.828451 CCATTGAAGGCAGGAGAAAAAGA 59.172 43.478 0.00 0.00 0.00 2.52
4998 6270 4.281688 CCATTGAAGGCAGGAGAAAAAGAA 59.718 41.667 0.00 0.00 0.00 2.52
4999 6271 5.467705 CATTGAAGGCAGGAGAAAAAGAAG 58.532 41.667 0.00 0.00 0.00 2.85
5000 6272 3.490348 TGAAGGCAGGAGAAAAAGAAGG 58.510 45.455 0.00 0.00 0.00 3.46
5001 6273 1.916506 AGGCAGGAGAAAAAGAAGGC 58.083 50.000 0.00 0.00 0.00 4.35
5002 6274 0.891373 GGCAGGAGAAAAAGAAGGCC 59.109 55.000 0.00 0.00 0.00 5.19
5003 6275 1.620822 GCAGGAGAAAAAGAAGGCCA 58.379 50.000 5.01 0.00 0.00 5.36
5004 6276 1.963515 GCAGGAGAAAAAGAAGGCCAA 59.036 47.619 5.01 0.00 0.00 4.52
5005 6277 2.365293 GCAGGAGAAAAAGAAGGCCAAA 59.635 45.455 5.01 0.00 0.00 3.28
5006 6278 3.181466 GCAGGAGAAAAAGAAGGCCAAAA 60.181 43.478 5.01 0.00 0.00 2.44
5007 6279 4.503817 GCAGGAGAAAAAGAAGGCCAAAAT 60.504 41.667 5.01 0.00 0.00 1.82
5008 6280 4.992951 CAGGAGAAAAAGAAGGCCAAAATG 59.007 41.667 5.01 0.00 0.00 2.32
5009 6281 4.901250 AGGAGAAAAAGAAGGCCAAAATGA 59.099 37.500 5.01 0.00 0.00 2.57
5010 6282 5.545335 AGGAGAAAAAGAAGGCCAAAATGAT 59.455 36.000 5.01 0.00 0.00 2.45
5011 6283 5.640783 GGAGAAAAAGAAGGCCAAAATGATG 59.359 40.000 5.01 0.00 0.00 3.07
5012 6284 6.423776 AGAAAAAGAAGGCCAAAATGATGA 57.576 33.333 5.01 0.00 0.00 2.92
5013 6285 6.829849 AGAAAAAGAAGGCCAAAATGATGAA 58.170 32.000 5.01 0.00 0.00 2.57
5014 6286 6.932960 AGAAAAAGAAGGCCAAAATGATGAAG 59.067 34.615 5.01 0.00 0.00 3.02
5015 6287 6.423776 AAAAGAAGGCCAAAATGATGAAGA 57.576 33.333 5.01 0.00 0.00 2.87
5016 6288 6.616237 AAAGAAGGCCAAAATGATGAAGAT 57.384 33.333 5.01 0.00 0.00 2.40
5017 6289 5.593679 AGAAGGCCAAAATGATGAAGATG 57.406 39.130 5.01 0.00 0.00 2.90
5018 6290 3.814005 AGGCCAAAATGATGAAGATGC 57.186 42.857 5.01 0.00 0.00 3.91
5019 6291 2.433239 AGGCCAAAATGATGAAGATGCC 59.567 45.455 5.01 0.00 36.62 4.40
5020 6292 2.168936 GGCCAAAATGATGAAGATGCCA 59.831 45.455 0.00 0.00 36.40 4.92
5021 6293 3.454375 GCCAAAATGATGAAGATGCCAG 58.546 45.455 0.00 0.00 0.00 4.85
5022 6294 3.454375 CCAAAATGATGAAGATGCCAGC 58.546 45.455 0.00 0.00 0.00 4.85
5023 6295 3.454375 CAAAATGATGAAGATGCCAGCC 58.546 45.455 0.00 0.00 0.00 4.85
5024 6296 2.447408 AATGATGAAGATGCCAGCCA 57.553 45.000 0.00 0.00 0.00 4.75
5025 6297 2.447408 ATGATGAAGATGCCAGCCAA 57.553 45.000 0.00 0.00 0.00 4.52
5026 6298 1.758936 TGATGAAGATGCCAGCCAAG 58.241 50.000 0.00 0.00 0.00 3.61
5027 6299 1.005097 TGATGAAGATGCCAGCCAAGT 59.995 47.619 0.00 0.00 0.00 3.16
5028 6300 1.404391 GATGAAGATGCCAGCCAAGTG 59.596 52.381 0.00 0.00 0.00 3.16
5029 6301 0.401356 TGAAGATGCCAGCCAAGTGA 59.599 50.000 0.00 0.00 0.00 3.41
5030 6302 1.005097 TGAAGATGCCAGCCAAGTGAT 59.995 47.619 0.00 0.00 0.00 3.06
5031 6303 1.674962 GAAGATGCCAGCCAAGTGATC 59.325 52.381 0.00 0.00 0.00 2.92
5032 6304 0.622136 AGATGCCAGCCAAGTGATCA 59.378 50.000 0.00 0.00 0.00 2.92
5033 6305 1.214673 AGATGCCAGCCAAGTGATCAT 59.785 47.619 0.00 0.00 0.00 2.45
5034 6306 2.029623 GATGCCAGCCAAGTGATCATT 58.970 47.619 0.00 0.00 0.00 2.57
5035 6307 1.466856 TGCCAGCCAAGTGATCATTC 58.533 50.000 0.00 0.00 0.00 2.67
5036 6308 1.272037 TGCCAGCCAAGTGATCATTCA 60.272 47.619 0.00 0.00 0.00 2.57
5037 6309 1.820519 GCCAGCCAAGTGATCATTCAA 59.179 47.619 0.00 0.00 32.48 2.69
5038 6310 2.159282 GCCAGCCAAGTGATCATTCAAG 60.159 50.000 0.00 0.00 32.48 3.02
5039 6311 2.159282 CCAGCCAAGTGATCATTCAAGC 60.159 50.000 0.00 0.00 32.48 4.01
5040 6312 2.097825 AGCCAAGTGATCATTCAAGCC 58.902 47.619 0.00 0.00 32.48 4.35
5041 6313 1.202222 GCCAAGTGATCATTCAAGCCG 60.202 52.381 0.00 0.00 32.48 5.52
5042 6314 1.402968 CCAAGTGATCATTCAAGCCGG 59.597 52.381 0.00 0.00 32.48 6.13
5043 6315 1.402968 CAAGTGATCATTCAAGCCGGG 59.597 52.381 2.18 0.00 32.48 5.73
5044 6316 0.749454 AGTGATCATTCAAGCCGGGC 60.749 55.000 12.11 12.11 32.48 6.13
5045 6317 1.031571 GTGATCATTCAAGCCGGGCA 61.032 55.000 23.09 0.00 32.48 5.36
5046 6318 1.031571 TGATCATTCAAGCCGGGCAC 61.032 55.000 23.09 0.00 0.00 5.01
5047 6319 2.051804 GATCATTCAAGCCGGGCACG 62.052 60.000 23.09 11.69 40.55 5.34
5048 6320 2.819984 ATCATTCAAGCCGGGCACGT 62.820 55.000 23.09 2.53 38.78 4.49
5049 6321 2.282180 ATTCAAGCCGGGCACGTT 60.282 55.556 23.09 3.66 38.78 3.99
5050 6322 2.625823 ATTCAAGCCGGGCACGTTG 61.626 57.895 23.09 16.79 38.78 4.10
5061 6333 2.470156 GCACGTTGCCATCTGATGA 58.530 52.632 18.92 0.00 37.42 2.92
5062 6334 0.097674 GCACGTTGCCATCTGATGAC 59.902 55.000 18.92 8.16 37.42 3.06
5063 6335 1.441738 CACGTTGCCATCTGATGACA 58.558 50.000 18.92 10.96 0.00 3.58
5064 6336 2.011947 CACGTTGCCATCTGATGACAT 58.988 47.619 18.92 0.00 0.00 3.06
5065 6337 2.031314 CACGTTGCCATCTGATGACATC 59.969 50.000 18.92 11.38 0.00 3.06
5066 6338 2.282407 CGTTGCCATCTGATGACATCA 58.718 47.619 18.92 17.09 37.76 3.07
5067 6339 2.679336 CGTTGCCATCTGATGACATCAA 59.321 45.455 18.49 12.93 39.11 2.57
5068 6340 3.242641 CGTTGCCATCTGATGACATCAAG 60.243 47.826 18.49 12.56 39.11 3.02
5069 6341 2.927028 TGCCATCTGATGACATCAAGG 58.073 47.619 18.49 19.10 39.11 3.61
5070 6342 1.607628 GCCATCTGATGACATCAAGGC 59.392 52.381 26.97 26.97 41.39 4.35
5071 6343 2.927028 CCATCTGATGACATCAAGGCA 58.073 47.619 18.49 4.39 41.62 4.75
5077 6349 1.771565 ATGACATCAAGGCATGGGTG 58.228 50.000 0.00 0.00 46.85 4.61
5078 6350 0.323633 TGACATCAAGGCATGGGTGG 60.324 55.000 0.00 0.00 0.00 4.61
5079 6351 0.323725 GACATCAAGGCATGGGTGGT 60.324 55.000 0.00 0.00 0.00 4.16
5080 6352 0.612732 ACATCAAGGCATGGGTGGTG 60.613 55.000 0.00 0.00 0.00 4.17
5081 6353 0.323633 CATCAAGGCATGGGTGGTGA 60.324 55.000 0.00 0.00 0.00 4.02
5082 6354 0.033796 ATCAAGGCATGGGTGGTGAG 60.034 55.000 0.00 0.00 0.00 3.51
5083 6355 1.075482 CAAGGCATGGGTGGTGAGT 59.925 57.895 0.00 0.00 0.00 3.41
5084 6356 1.075482 AAGGCATGGGTGGTGAGTG 59.925 57.895 0.00 0.00 0.00 3.51
5085 6357 1.426251 AAGGCATGGGTGGTGAGTGA 61.426 55.000 0.00 0.00 0.00 3.41
5086 6358 1.210204 AGGCATGGGTGGTGAGTGAT 61.210 55.000 0.00 0.00 0.00 3.06
5087 6359 0.323725 GGCATGGGTGGTGAGTGATT 60.324 55.000 0.00 0.00 0.00 2.57
5088 6360 1.064758 GGCATGGGTGGTGAGTGATTA 60.065 52.381 0.00 0.00 0.00 1.75
5089 6361 2.292267 GCATGGGTGGTGAGTGATTAG 58.708 52.381 0.00 0.00 0.00 1.73
5090 6362 2.292267 CATGGGTGGTGAGTGATTAGC 58.708 52.381 0.00 0.00 0.00 3.09
5091 6363 1.357137 TGGGTGGTGAGTGATTAGCA 58.643 50.000 0.00 0.00 0.00 3.49
5106 6378 6.563422 GTGATTAGCACAAAAATAGCATCCA 58.437 36.000 0.00 0.00 46.91 3.41
5107 6379 7.035004 GTGATTAGCACAAAAATAGCATCCAA 58.965 34.615 0.00 0.00 46.91 3.53
5108 6380 7.545265 GTGATTAGCACAAAAATAGCATCCAAA 59.455 33.333 0.00 0.00 46.91 3.28
5109 6381 8.259411 TGATTAGCACAAAAATAGCATCCAAAT 58.741 29.630 0.00 0.00 0.00 2.32
5110 6382 7.830940 TTAGCACAAAAATAGCATCCAAATG 57.169 32.000 0.00 0.00 35.87 2.32
5111 6383 6.040209 AGCACAAAAATAGCATCCAAATGA 57.960 33.333 0.00 0.00 34.61 2.57
5112 6384 6.103997 AGCACAAAAATAGCATCCAAATGAG 58.896 36.000 0.00 0.00 34.61 2.90
5113 6385 5.292589 GCACAAAAATAGCATCCAAATGAGG 59.707 40.000 0.00 0.00 34.61 3.86
5114 6386 6.632909 CACAAAAATAGCATCCAAATGAGGA 58.367 36.000 0.00 0.00 43.01 3.71
5123 6395 1.811965 TCCAAATGAGGATGTGCAACG 59.188 47.619 0.00 0.00 33.33 4.10
5124 6396 1.621107 CAAATGAGGATGTGCAACGC 58.379 50.000 0.00 0.00 42.39 4.84
5125 6397 1.068402 CAAATGAGGATGTGCAACGCA 60.068 47.619 0.00 0.00 42.39 5.24
5126 6398 1.246649 AATGAGGATGTGCAACGCAA 58.753 45.000 0.00 0.00 41.47 4.85
5127 6399 1.246649 ATGAGGATGTGCAACGCAAA 58.753 45.000 0.00 0.00 41.47 3.68
5128 6400 0.592637 TGAGGATGTGCAACGCAAAG 59.407 50.000 0.00 0.00 41.47 2.77
5129 6401 0.874390 GAGGATGTGCAACGCAAAGA 59.126 50.000 0.00 0.00 41.47 2.52
5130 6402 1.266718 GAGGATGTGCAACGCAAAGAA 59.733 47.619 0.00 0.00 41.47 2.52
5131 6403 1.267806 AGGATGTGCAACGCAAAGAAG 59.732 47.619 0.00 0.00 41.47 2.85
5132 6404 1.266718 GGATGTGCAACGCAAAGAAGA 59.733 47.619 0.00 0.00 41.47 2.87
5133 6405 2.310577 GATGTGCAACGCAAAGAAGAC 58.689 47.619 0.00 0.00 41.47 3.01
5134 6406 1.090728 TGTGCAACGCAAAGAAGACA 58.909 45.000 0.00 0.00 41.47 3.41
5135 6407 1.675483 TGTGCAACGCAAAGAAGACAT 59.325 42.857 0.00 0.00 41.47 3.06
5136 6408 2.286950 TGTGCAACGCAAAGAAGACATC 60.287 45.455 0.00 0.00 41.47 3.06
5137 6409 2.031682 GTGCAACGCAAAGAAGACATCT 60.032 45.455 0.00 0.00 41.47 2.90
5138 6410 5.984601 TGTGCAACGCAAAGAAGACATCTT 61.985 41.667 0.00 0.00 46.09 2.40
5148 6420 5.444663 AAGAAGACATCTTTTGCTTGTCC 57.555 39.130 0.00 0.00 46.39 4.02
5149 6421 3.823304 AGAAGACATCTTTTGCTTGTCCC 59.177 43.478 0.00 0.00 40.46 4.46
5150 6422 3.228188 AGACATCTTTTGCTTGTCCCA 57.772 42.857 0.00 0.00 40.46 4.37
5151 6423 2.887152 AGACATCTTTTGCTTGTCCCAC 59.113 45.455 0.00 0.00 40.46 4.61
5152 6424 1.608590 ACATCTTTTGCTTGTCCCACG 59.391 47.619 0.00 0.00 0.00 4.94
5153 6425 1.879380 CATCTTTTGCTTGTCCCACGA 59.121 47.619 0.00 0.00 0.00 4.35
5154 6426 2.270352 TCTTTTGCTTGTCCCACGAT 57.730 45.000 0.00 0.00 0.00 3.73
5155 6427 2.151202 TCTTTTGCTTGTCCCACGATC 58.849 47.619 0.00 0.00 0.00 3.69
5156 6428 0.871722 TTTTGCTTGTCCCACGATCG 59.128 50.000 14.88 14.88 0.00 3.69
5157 6429 0.034198 TTTGCTTGTCCCACGATCGA 59.966 50.000 24.34 0.00 0.00 3.59
5158 6430 0.034198 TTGCTTGTCCCACGATCGAA 59.966 50.000 24.34 3.06 0.00 3.71
5159 6431 0.389817 TGCTTGTCCCACGATCGAAG 60.390 55.000 24.34 14.44 0.00 3.79
5160 6432 0.389948 GCTTGTCCCACGATCGAAGT 60.390 55.000 24.34 0.00 0.00 3.01
5161 6433 1.350193 CTTGTCCCACGATCGAAGTG 58.650 55.000 24.34 9.82 39.19 3.16
5162 6434 0.669318 TTGTCCCACGATCGAAGTGC 60.669 55.000 24.34 9.25 38.22 4.40
5163 6435 1.810030 GTCCCACGATCGAAGTGCC 60.810 63.158 24.34 0.84 38.22 5.01
5164 6436 2.264480 CCCACGATCGAAGTGCCA 59.736 61.111 24.34 0.00 38.22 4.92
5165 6437 1.153369 CCCACGATCGAAGTGCCAT 60.153 57.895 24.34 0.00 38.22 4.40
5166 6438 0.104120 CCCACGATCGAAGTGCCATA 59.896 55.000 24.34 0.00 38.22 2.74
5167 6439 1.209128 CCACGATCGAAGTGCCATAC 58.791 55.000 24.34 0.00 38.22 2.39
5168 6440 1.209128 CACGATCGAAGTGCCATACC 58.791 55.000 24.34 0.00 32.52 2.73
5169 6441 1.112113 ACGATCGAAGTGCCATACCT 58.888 50.000 24.34 0.00 0.00 3.08
5170 6442 1.067212 ACGATCGAAGTGCCATACCTC 59.933 52.381 24.34 0.00 0.00 3.85
5171 6443 1.338337 CGATCGAAGTGCCATACCTCT 59.662 52.381 10.26 0.00 0.00 3.69
5172 6444 2.748605 GATCGAAGTGCCATACCTCTG 58.251 52.381 0.00 0.00 0.00 3.35
5173 6445 1.847328 TCGAAGTGCCATACCTCTGA 58.153 50.000 0.00 0.00 0.00 3.27
5174 6446 2.388735 TCGAAGTGCCATACCTCTGAT 58.611 47.619 0.00 0.00 0.00 2.90
5175 6447 3.562182 TCGAAGTGCCATACCTCTGATA 58.438 45.455 0.00 0.00 0.00 2.15
5176 6448 4.152647 TCGAAGTGCCATACCTCTGATAT 58.847 43.478 0.00 0.00 0.00 1.63
5177 6449 4.021981 TCGAAGTGCCATACCTCTGATATG 60.022 45.833 0.00 0.00 0.00 1.78
5178 6450 4.262207 CGAAGTGCCATACCTCTGATATGT 60.262 45.833 0.00 0.00 0.00 2.29
5179 6451 4.881019 AGTGCCATACCTCTGATATGTC 57.119 45.455 0.00 0.00 0.00 3.06
5180 6452 4.226384 AGTGCCATACCTCTGATATGTCA 58.774 43.478 0.00 0.00 0.00 3.58
5181 6453 4.655649 AGTGCCATACCTCTGATATGTCAA 59.344 41.667 0.00 0.00 33.05 3.18
5182 6454 5.309020 AGTGCCATACCTCTGATATGTCAAT 59.691 40.000 0.00 0.00 33.05 2.57
5183 6455 6.498303 AGTGCCATACCTCTGATATGTCAATA 59.502 38.462 0.00 0.00 33.05 1.90
5184 6456 6.591834 GTGCCATACCTCTGATATGTCAATAC 59.408 42.308 0.00 0.00 33.05 1.89
5185 6457 6.109359 GCCATACCTCTGATATGTCAATACC 58.891 44.000 0.00 0.00 33.05 2.73
5186 6458 6.070538 GCCATACCTCTGATATGTCAATACCT 60.071 42.308 0.00 0.00 33.05 3.08
5187 6459 7.527868 GCCATACCTCTGATATGTCAATACCTT 60.528 40.741 0.00 0.00 33.05 3.50
5188 6460 9.035890 CCATACCTCTGATATGTCAATACCTTA 57.964 37.037 0.00 0.00 33.05 2.69
5191 6463 7.445945 ACCTCTGATATGTCAATACCTTAAGC 58.554 38.462 0.00 0.00 33.05 3.09
5192 6464 7.071196 ACCTCTGATATGTCAATACCTTAAGCA 59.929 37.037 0.00 0.00 33.05 3.91
5193 6465 7.933577 CCTCTGATATGTCAATACCTTAAGCAA 59.066 37.037 0.00 0.00 33.05 3.91
5194 6466 9.330063 CTCTGATATGTCAATACCTTAAGCAAA 57.670 33.333 0.00 0.00 33.05 3.68
5195 6467 9.679661 TCTGATATGTCAATACCTTAAGCAAAA 57.320 29.630 0.00 0.00 33.05 2.44
5201 6473 8.586570 TGTCAATACCTTAAGCAAAATGTTTG 57.413 30.769 0.00 0.00 0.00 2.93
5202 6474 8.200792 TGTCAATACCTTAAGCAAAATGTTTGT 58.799 29.630 0.00 0.00 0.00 2.83
5203 6475 9.685828 GTCAATACCTTAAGCAAAATGTTTGTA 57.314 29.630 0.00 0.00 0.00 2.41
5209 6481 9.830975 ACCTTAAGCAAAATGTTTGTAAATCTT 57.169 25.926 0.00 0.76 0.00 2.40
5211 6483 9.584839 CTTAAGCAAAATGTTTGTAAATCTTGC 57.415 29.630 2.92 0.00 38.51 4.01
5212 6484 6.214205 AGCAAAATGTTTGTAAATCTTGCG 57.786 33.333 2.92 0.00 42.04 4.85
5213 6485 5.177327 AGCAAAATGTTTGTAAATCTTGCGG 59.823 36.000 2.92 0.00 42.04 5.69
5214 6486 5.373262 CAAAATGTTTGTAAATCTTGCGGC 58.627 37.500 0.00 0.00 0.00 6.53
5215 6487 3.932545 ATGTTTGTAAATCTTGCGGCA 57.067 38.095 0.00 0.00 0.00 5.69
5216 6488 3.932545 TGTTTGTAAATCTTGCGGCAT 57.067 38.095 2.28 0.00 0.00 4.40
5217 6489 3.832276 TGTTTGTAAATCTTGCGGCATC 58.168 40.909 2.28 0.00 0.00 3.91
5218 6490 3.505680 TGTTTGTAAATCTTGCGGCATCT 59.494 39.130 2.28 0.00 0.00 2.90
5219 6491 4.098416 GTTTGTAAATCTTGCGGCATCTC 58.902 43.478 2.28 0.00 0.00 2.75
5220 6492