Multiple sequence alignment - TraesCS1B01G004600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G004600 chr1B 100.000 6114 0 0 1 6114 2757771 2751658 0.000000e+00 11291.0
1 TraesCS1B01G004600 chr1B 79.596 2475 419 55 2476 4914 1780981 1783405 0.000000e+00 1694.0
2 TraesCS1B01G004600 chr1B 79.501 2283 386 54 2683 4915 1731311 1729061 0.000000e+00 1548.0
3 TraesCS1B01G004600 chr1B 78.017 2511 453 62 2461 4914 724353 721885 0.000000e+00 1487.0
4 TraesCS1B01G004600 chr1B 76.823 2455 473 77 2508 4909 2006500 2004089 0.000000e+00 1293.0
5 TraesCS1B01G004600 chr1B 76.053 2113 413 59 2453 4542 171271 169229 0.000000e+00 1013.0
6 TraesCS1B01G004600 chr1B 77.830 1484 270 41 3438 4895 2303486 2302036 0.000000e+00 863.0
7 TraesCS1B01G004600 chr1B 76.330 1504 275 46 3438 4896 1971342 1972809 0.000000e+00 730.0
8 TraesCS1B01G004600 chr1B 75.987 1520 295 37 3436 4914 2054849 2053359 0.000000e+00 721.0
9 TraesCS1B01G004600 chr1B 75.069 1440 281 40 3516 4914 2077478 2076076 3.150000e-167 599.0
10 TraesCS1B01G004600 chr1B 77.778 378 67 12 3494 3869 2280237 2279875 3.710000e-52 217.0
11 TraesCS1B01G004600 chr3B 77.611 2528 490 51 2411 4902 801314758 801317245 0.000000e+00 1463.0
12 TraesCS1B01G004600 chr3B 73.774 1529 321 51 3420 4896 815478491 815479991 4.200000e-146 529.0
13 TraesCS1B01G004600 chr1A 77.464 2445 442 59 2568 4968 3617233 3614854 0.000000e+00 1362.0
14 TraesCS1B01G004600 chr1A 75.256 1657 314 51 3436 5040 1668657 1670269 0.000000e+00 701.0
15 TraesCS1B01G004600 chr1D 78.722 1894 324 54 2458 4310 2498331 2496476 0.000000e+00 1192.0
16 TraesCS1B01G004600 chr1D 80.942 446 71 11 5578 6011 148603309 148603752 2.110000e-89 340.0
17 TraesCS1B01G004600 chr1D 83.607 183 26 3 5353 5533 355276240 355276060 1.050000e-37 169.0
18 TraesCS1B01G004600 chr1D 76.976 291 59 5 822 1111 2499436 2499153 6.340000e-35 159.0
19 TraesCS1B01G004600 chr6B 75.735 2551 481 87 2497 4956 10747485 10744982 0.000000e+00 1155.0
20 TraesCS1B01G004600 chrUn 77.011 1392 237 51 3550 4895 21801 23155 0.000000e+00 721.0
21 TraesCS1B01G004600 chrUn 87.755 49 6 0 4850 4898 38593501 38593453 2.380000e-04 58.4
22 TraesCS1B01G004600 chr4B 74.898 1470 272 57 3478 4909 604003686 604005096 1.140000e-161 580.0
23 TraesCS1B01G004600 chr4B 85.802 162 21 2 5365 5525 327925352 327925192 2.930000e-38 171.0
24 TraesCS1B01G004600 chr3A 74.234 1502 310 51 3436 4896 737799714 737801179 5.350000e-155 558.0
25 TraesCS1B01G004600 chr3A 75.191 915 174 34 4034 4915 52196895 52196001 3.460000e-102 383.0
26 TraesCS1B01G004600 chr7D 81.599 663 103 13 5351 6006 383226896 383227546 1.170000e-146 531.0
27 TraesCS1B01G004600 chr7D 76.371 529 83 31 5473 5979 476967950 476967442 4.730000e-61 246.0
28 TraesCS1B01G004600 chr7D 83.815 173 24 1 5353 5525 476968164 476967996 1.760000e-35 161.0
29 TraesCS1B01G004600 chr4D 74.253 1472 281 57 3478 4909 477866573 477867986 4.200000e-146 529.0
30 TraesCS1B01G004600 chr4D 82.278 237 39 3 330 564 13093586 13093351 1.040000e-47 202.0
31 TraesCS1B01G004600 chr4D 81.871 171 27 2 5355 5525 474658228 474658062 2.300000e-29 141.0
32 TraesCS1B01G004600 chr6A 78.761 565 99 14 5356 5915 471053995 471054543 5.830000e-95 359.0
33 TraesCS1B01G004600 chr6D 75.610 615 118 24 4325 4914 3163042 3163649 6.040000e-70 276.0
34 TraesCS1B01G004600 chr6D 80.913 241 41 5 327 564 55427703 55427465 1.050000e-42 185.0
35 TraesCS1B01G004600 chr3D 83.682 239 38 1 327 564 354440440 354440202 2.220000e-54 224.0
36 TraesCS1B01G004600 chr3D 74.659 513 94 17 4417 4902 555302228 555302731 1.740000e-45 195.0
37 TraesCS1B01G004600 chr7B 82.845 239 38 2 327 565 231694383 231694618 1.730000e-50 211.0
38 TraesCS1B01G004600 chr7B 82.305 243 38 5 323 562 27490962 27491202 8.030000e-49 206.0
39 TraesCS1B01G004600 chr2B 81.250 240 43 2 327 564 37776176 37776415 6.250000e-45 193.0
40 TraesCS1B01G004600 chr2B 80.992 242 38 8 329 567 261463924 261463688 1.050000e-42 185.0
41 TraesCS1B01G004600 chr2B 85.039 127 18 1 5364 5489 562211241 562211115 1.790000e-25 128.0
42 TraesCS1B01G004600 chr7A 80.488 246 45 3 326 569 6801613 6801369 1.050000e-42 185.0
43 TraesCS1B01G004600 chr7A 80.408 245 45 3 326 568 699511480 699511237 3.760000e-42 183.0
44 TraesCS1B01G004600 chr7A 84.000 175 25 3 5353 5525 494233599 494233772 1.360000e-36 165.0
45 TraesCS1B01G004600 chr5D 84.181 177 24 3 5351 5525 136917885 136917711 1.050000e-37 169.0
46 TraesCS1B01G004600 chr5B 81.325 166 29 2 5411 5575 270100300 270100136 3.840000e-27 134.0
47 TraesCS1B01G004600 chr2D 81.818 143 21 4 4407 4548 636049740 636049878 1.390000e-21 115.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G004600 chr1B 2751658 2757771 6113 True 11291.0 11291 100.000 1 6114 1 chr1B.!!$R9 6113
1 TraesCS1B01G004600 chr1B 1780981 1783405 2424 False 1694.0 1694 79.596 2476 4914 1 chr1B.!!$F1 2438
2 TraesCS1B01G004600 chr1B 1729061 1731311 2250 True 1548.0 1548 79.501 2683 4915 1 chr1B.!!$R3 2232
3 TraesCS1B01G004600 chr1B 721885 724353 2468 True 1487.0 1487 78.017 2461 4914 1 chr1B.!!$R2 2453
4 TraesCS1B01G004600 chr1B 2004089 2006500 2411 True 1293.0 1293 76.823 2508 4909 1 chr1B.!!$R4 2401
5 TraesCS1B01G004600 chr1B 169229 171271 2042 True 1013.0 1013 76.053 2453 4542 1 chr1B.!!$R1 2089
6 TraesCS1B01G004600 chr1B 2302036 2303486 1450 True 863.0 863 77.830 3438 4895 1 chr1B.!!$R8 1457
7 TraesCS1B01G004600 chr1B 1971342 1972809 1467 False 730.0 730 76.330 3438 4896 1 chr1B.!!$F2 1458
8 TraesCS1B01G004600 chr1B 2053359 2054849 1490 True 721.0 721 75.987 3436 4914 1 chr1B.!!$R5 1478
9 TraesCS1B01G004600 chr1B 2076076 2077478 1402 True 599.0 599 75.069 3516 4914 1 chr1B.!!$R6 1398
10 TraesCS1B01G004600 chr3B 801314758 801317245 2487 False 1463.0 1463 77.611 2411 4902 1 chr3B.!!$F1 2491
11 TraesCS1B01G004600 chr3B 815478491 815479991 1500 False 529.0 529 73.774 3420 4896 1 chr3B.!!$F2 1476
12 TraesCS1B01G004600 chr1A 3614854 3617233 2379 True 1362.0 1362 77.464 2568 4968 1 chr1A.!!$R1 2400
13 TraesCS1B01G004600 chr1A 1668657 1670269 1612 False 701.0 701 75.256 3436 5040 1 chr1A.!!$F1 1604
14 TraesCS1B01G004600 chr1D 2496476 2499436 2960 True 675.5 1192 77.849 822 4310 2 chr1D.!!$R2 3488
15 TraesCS1B01G004600 chr6B 10744982 10747485 2503 True 1155.0 1155 75.735 2497 4956 1 chr6B.!!$R1 2459
16 TraesCS1B01G004600 chrUn 21801 23155 1354 False 721.0 721 77.011 3550 4895 1 chrUn.!!$F1 1345
17 TraesCS1B01G004600 chr4B 604003686 604005096 1410 False 580.0 580 74.898 3478 4909 1 chr4B.!!$F1 1431
18 TraesCS1B01G004600 chr3A 737799714 737801179 1465 False 558.0 558 74.234 3436 4896 1 chr3A.!!$F1 1460
19 TraesCS1B01G004600 chr3A 52196001 52196895 894 True 383.0 383 75.191 4034 4915 1 chr3A.!!$R1 881
20 TraesCS1B01G004600 chr7D 383226896 383227546 650 False 531.0 531 81.599 5351 6006 1 chr7D.!!$F1 655
21 TraesCS1B01G004600 chr7D 476967442 476968164 722 True 203.5 246 80.093 5353 5979 2 chr7D.!!$R1 626
22 TraesCS1B01G004600 chr4D 477866573 477867986 1413 False 529.0 529 74.253 3478 4909 1 chr4D.!!$F1 1431
23 TraesCS1B01G004600 chr6A 471053995 471054543 548 False 359.0 359 78.761 5356 5915 1 chr6A.!!$F1 559
24 TraesCS1B01G004600 chr6D 3163042 3163649 607 False 276.0 276 75.610 4325 4914 1 chr6D.!!$F1 589


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
350 351 0.030369 CCTCCGTCCTCGTTTATCGG 59.970 60.0 0.00 0.0 42.12 4.18 F
742 743 0.035439 CTCGCCCCTTGCTAGGAAAA 60.035 55.0 16.43 0.0 45.05 2.29 F
1958 1970 0.033228 CATCGCCCACTCCTCATCTC 59.967 60.0 0.00 0.0 0.00 2.75 F
2782 2866 0.106149 AAACTCCGTGAGACACCACC 59.894 55.0 7.76 0.0 33.67 4.61 F
3667 3766 0.321034 TCGTGCTCATTTCTGCAGCT 60.321 50.0 9.47 0.0 40.06 4.24 F
4613 4876 0.392706 CCCCAAAGGACCTGCAAAAC 59.607 55.0 0.00 0.0 38.24 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1332 1333 0.035056 AGTGAGTAATGCAGGTGGCC 60.035 55.0 0.00 0.00 43.89 5.36 R
2735 2819 0.106708 TATCCTCACGCAATGCCTCC 59.893 55.0 0.00 0.00 0.00 4.30 R
3362 3461 0.250295 GCTGTCCTGCCACTGTTACA 60.250 55.0 0.00 0.00 0.00 2.41 R
4199 4388 0.034089 GCAGGTTGATAAGGCCAGGT 60.034 55.0 5.01 0.00 0.00 4.00 R
5025 5307 0.106268 TTCAAAGGCTGCCAAGTGGA 60.106 50.0 22.65 7.31 37.39 4.02 R
6015 6414 0.107312 CTGCTAGCCATTCCTGCAGT 60.107 55.0 13.29 0.00 44.04 4.40 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 2.840974 GACACACGTTCATGGGGAG 58.159 57.895 0.00 0.00 0.00 4.30
19 20 0.673644 GACACACGTTCATGGGGAGG 60.674 60.000 0.00 0.00 0.00 4.30
20 21 1.377202 CACACGTTCATGGGGAGGG 60.377 63.158 0.00 0.00 0.00 4.30
21 22 1.537889 ACACGTTCATGGGGAGGGA 60.538 57.895 0.00 0.00 0.00 4.20
22 23 1.131303 ACACGTTCATGGGGAGGGAA 61.131 55.000 0.00 0.00 0.00 3.97
23 24 0.037590 CACGTTCATGGGGAGGGAAA 59.962 55.000 0.00 0.00 0.00 3.13
24 25 0.999712 ACGTTCATGGGGAGGGAAAT 59.000 50.000 0.00 0.00 0.00 2.17
25 26 1.357761 ACGTTCATGGGGAGGGAAATT 59.642 47.619 0.00 0.00 0.00 1.82
26 27 2.225267 ACGTTCATGGGGAGGGAAATTT 60.225 45.455 0.00 0.00 0.00 1.82
27 28 3.010808 ACGTTCATGGGGAGGGAAATTTA 59.989 43.478 0.00 0.00 0.00 1.40
28 29 4.020543 CGTTCATGGGGAGGGAAATTTAA 58.979 43.478 0.00 0.00 0.00 1.52
29 30 4.464597 CGTTCATGGGGAGGGAAATTTAAA 59.535 41.667 0.00 0.00 0.00 1.52
30 31 5.046950 CGTTCATGGGGAGGGAAATTTAAAA 60.047 40.000 0.00 0.00 0.00 1.52
31 32 6.351796 CGTTCATGGGGAGGGAAATTTAAAAT 60.352 38.462 0.00 0.00 0.00 1.82
32 33 7.402054 GTTCATGGGGAGGGAAATTTAAAATT 58.598 34.615 0.00 0.00 0.00 1.82
33 34 8.544622 GTTCATGGGGAGGGAAATTTAAAATTA 58.455 33.333 0.00 0.00 0.00 1.40
34 35 8.868404 TCATGGGGAGGGAAATTTAAAATTAT 57.132 30.769 0.00 0.00 0.00 1.28
35 36 9.290282 TCATGGGGAGGGAAATTTAAAATTATT 57.710 29.630 0.00 0.00 0.00 1.40
38 39 9.562226 TGGGGAGGGAAATTTAAAATTATTACA 57.438 29.630 0.00 0.00 0.00 2.41
91 92 9.213777 TCTGGTTTATGTATCACCTATTCTTCT 57.786 33.333 0.00 0.00 0.00 2.85
92 93 9.838339 CTGGTTTATGTATCACCTATTCTTCTT 57.162 33.333 0.00 0.00 0.00 2.52
93 94 9.832445 TGGTTTATGTATCACCTATTCTTCTTC 57.168 33.333 0.00 0.00 0.00 2.87
138 139 2.552768 CGTCGACGTCGGAAGTCA 59.447 61.111 35.05 14.35 38.46 3.41
139 140 1.082561 CGTCGACGTCGGAAGTCAA 60.083 57.895 35.05 13.57 38.46 3.18
140 141 0.658244 CGTCGACGTCGGAAGTCAAA 60.658 55.000 35.05 12.79 38.46 2.69
141 142 1.694639 GTCGACGTCGGAAGTCAAAT 58.305 50.000 35.05 0.00 38.46 2.32
142 143 1.647702 GTCGACGTCGGAAGTCAAATC 59.352 52.381 35.05 10.81 38.46 2.17
143 144 0.989890 CGACGTCGGAAGTCAAATCC 59.010 55.000 29.70 0.00 38.46 3.01
144 145 1.667756 CGACGTCGGAAGTCAAATCCA 60.668 52.381 29.70 0.00 38.46 3.41
145 146 2.618053 GACGTCGGAAGTCAAATCCAT 58.382 47.619 17.37 0.00 38.42 3.41
146 147 3.000727 GACGTCGGAAGTCAAATCCATT 58.999 45.455 17.37 0.00 38.42 3.16
147 148 3.000727 ACGTCGGAAGTCAAATCCATTC 58.999 45.455 0.00 0.00 36.74 2.67
148 149 2.351726 CGTCGGAAGTCAAATCCATTCC 59.648 50.000 0.00 0.00 36.74 3.01
149 150 3.343617 GTCGGAAGTCAAATCCATTCCA 58.656 45.455 3.93 0.00 41.08 3.53
150 151 3.127030 GTCGGAAGTCAAATCCATTCCAC 59.873 47.826 3.93 0.00 41.08 4.02
151 152 3.009033 TCGGAAGTCAAATCCATTCCACT 59.991 43.478 3.93 0.00 41.08 4.00
152 153 3.127548 CGGAAGTCAAATCCATTCCACTG 59.872 47.826 3.93 0.00 41.08 3.66
153 154 4.335416 GGAAGTCAAATCCATTCCACTGA 58.665 43.478 0.00 0.00 40.78 3.41
154 155 4.397417 GGAAGTCAAATCCATTCCACTGAG 59.603 45.833 0.00 0.00 40.78 3.35
155 156 4.647564 AGTCAAATCCATTCCACTGAGT 57.352 40.909 0.00 0.00 0.00 3.41
156 157 4.583871 AGTCAAATCCATTCCACTGAGTC 58.416 43.478 0.00 0.00 0.00 3.36
157 158 4.288105 AGTCAAATCCATTCCACTGAGTCT 59.712 41.667 0.00 0.00 0.00 3.24
158 159 5.006386 GTCAAATCCATTCCACTGAGTCTT 58.994 41.667 0.00 0.00 0.00 3.01
159 160 5.005740 TCAAATCCATTCCACTGAGTCTTG 58.994 41.667 0.00 0.00 0.00 3.02
160 161 4.647564 AATCCATTCCACTGAGTCTTGT 57.352 40.909 0.00 0.00 0.00 3.16
161 162 3.407424 TCCATTCCACTGAGTCTTGTG 57.593 47.619 9.04 9.04 0.00 3.33
166 167 2.332063 CCACTGAGTCTTGTGGTGTT 57.668 50.000 20.49 0.00 46.18 3.32
167 168 2.643551 CCACTGAGTCTTGTGGTGTTT 58.356 47.619 20.49 0.00 46.18 2.83
168 169 2.355756 CCACTGAGTCTTGTGGTGTTTG 59.644 50.000 20.49 2.64 46.18 2.93
169 170 2.017049 ACTGAGTCTTGTGGTGTTTGC 58.983 47.619 0.00 0.00 0.00 3.68
170 171 2.292267 CTGAGTCTTGTGGTGTTTGCT 58.708 47.619 0.00 0.00 0.00 3.91
171 172 3.118408 ACTGAGTCTTGTGGTGTTTGCTA 60.118 43.478 0.00 0.00 0.00 3.49
172 173 3.466836 TGAGTCTTGTGGTGTTTGCTAG 58.533 45.455 0.00 0.00 0.00 3.42
173 174 3.118408 TGAGTCTTGTGGTGTTTGCTAGT 60.118 43.478 0.00 0.00 0.00 2.57
174 175 3.206150 AGTCTTGTGGTGTTTGCTAGTG 58.794 45.455 0.00 0.00 0.00 2.74
175 176 2.290641 GTCTTGTGGTGTTTGCTAGTGG 59.709 50.000 0.00 0.00 0.00 4.00
176 177 2.092646 TCTTGTGGTGTTTGCTAGTGGT 60.093 45.455 0.00 0.00 0.00 4.16
177 178 1.674359 TGTGGTGTTTGCTAGTGGTG 58.326 50.000 0.00 0.00 0.00 4.17
178 179 1.065053 TGTGGTGTTTGCTAGTGGTGT 60.065 47.619 0.00 0.00 0.00 4.16
179 180 1.333619 GTGGTGTTTGCTAGTGGTGTG 59.666 52.381 0.00 0.00 0.00 3.82
180 181 1.210722 TGGTGTTTGCTAGTGGTGTGA 59.789 47.619 0.00 0.00 0.00 3.58
181 182 2.294074 GGTGTTTGCTAGTGGTGTGAA 58.706 47.619 0.00 0.00 0.00 3.18
182 183 2.685897 GGTGTTTGCTAGTGGTGTGAAA 59.314 45.455 0.00 0.00 0.00 2.69
183 184 3.129638 GGTGTTTGCTAGTGGTGTGAAAA 59.870 43.478 0.00 0.00 0.00 2.29
184 185 4.202111 GGTGTTTGCTAGTGGTGTGAAAAT 60.202 41.667 0.00 0.00 0.00 1.82
185 186 4.976116 GTGTTTGCTAGTGGTGTGAAAATC 59.024 41.667 0.00 0.00 0.00 2.17
186 187 4.642437 TGTTTGCTAGTGGTGTGAAAATCA 59.358 37.500 0.00 0.00 0.00 2.57
187 188 5.215160 GTTTGCTAGTGGTGTGAAAATCAG 58.785 41.667 0.00 0.00 0.00 2.90
188 189 4.350368 TGCTAGTGGTGTGAAAATCAGA 57.650 40.909 0.00 0.00 0.00 3.27
189 190 4.713553 TGCTAGTGGTGTGAAAATCAGAA 58.286 39.130 0.00 0.00 0.00 3.02
190 191 5.129634 TGCTAGTGGTGTGAAAATCAGAAA 58.870 37.500 0.00 0.00 0.00 2.52
191 192 5.769662 TGCTAGTGGTGTGAAAATCAGAAAT 59.230 36.000 0.00 0.00 0.00 2.17
192 193 6.088824 GCTAGTGGTGTGAAAATCAGAAATG 58.911 40.000 0.00 0.00 0.00 2.32
193 194 6.294176 GCTAGTGGTGTGAAAATCAGAAATGT 60.294 38.462 0.00 0.00 0.00 2.71
194 195 6.469782 AGTGGTGTGAAAATCAGAAATGTT 57.530 33.333 0.00 0.00 0.00 2.71
195 196 6.275335 AGTGGTGTGAAAATCAGAAATGTTG 58.725 36.000 0.00 0.00 0.00 3.33
196 197 6.096705 AGTGGTGTGAAAATCAGAAATGTTGA 59.903 34.615 0.00 0.00 0.00 3.18
197 198 6.756074 GTGGTGTGAAAATCAGAAATGTTGAA 59.244 34.615 0.00 0.00 0.00 2.69
198 199 7.439056 GTGGTGTGAAAATCAGAAATGTTGAAT 59.561 33.333 0.00 0.00 0.00 2.57
199 200 7.986320 TGGTGTGAAAATCAGAAATGTTGAATT 59.014 29.630 0.00 0.00 0.00 2.17
200 201 9.474920 GGTGTGAAAATCAGAAATGTTGAATTA 57.525 29.630 0.00 0.00 0.00 1.40
212 213 9.525409 AGAAATGTTGAATTAGAATAATGCAGC 57.475 29.630 0.00 0.00 0.00 5.25
213 214 7.919313 AATGTTGAATTAGAATAATGCAGCG 57.081 32.000 0.00 0.00 0.00 5.18
214 215 5.820131 TGTTGAATTAGAATAATGCAGCGG 58.180 37.500 0.00 0.00 0.00 5.52
215 216 5.588246 TGTTGAATTAGAATAATGCAGCGGA 59.412 36.000 0.00 0.00 0.00 5.54
216 217 5.929697 TGAATTAGAATAATGCAGCGGAG 57.070 39.130 0.00 0.00 0.00 4.63
217 218 5.610398 TGAATTAGAATAATGCAGCGGAGA 58.390 37.500 0.00 0.00 0.00 3.71
218 219 5.466728 TGAATTAGAATAATGCAGCGGAGAC 59.533 40.000 0.00 0.00 0.00 3.36
219 220 4.672587 TTAGAATAATGCAGCGGAGACT 57.327 40.909 0.00 0.00 0.00 3.24
220 221 5.784578 TTAGAATAATGCAGCGGAGACTA 57.215 39.130 0.00 0.00 0.00 2.59
221 222 4.250116 AGAATAATGCAGCGGAGACTAG 57.750 45.455 0.00 0.00 0.00 2.57
222 223 3.891977 AGAATAATGCAGCGGAGACTAGA 59.108 43.478 0.00 0.00 0.00 2.43
223 224 3.651803 ATAATGCAGCGGAGACTAGAC 57.348 47.619 0.00 0.00 0.00 2.59
224 225 1.479709 AATGCAGCGGAGACTAGACT 58.520 50.000 0.00 0.00 0.00 3.24
225 226 1.479709 ATGCAGCGGAGACTAGACTT 58.520 50.000 0.00 0.00 0.00 3.01
226 227 0.528017 TGCAGCGGAGACTAGACTTG 59.472 55.000 0.00 0.00 0.00 3.16
227 228 0.528470 GCAGCGGAGACTAGACTTGT 59.472 55.000 0.00 0.00 0.00 3.16
228 229 1.743958 GCAGCGGAGACTAGACTTGTA 59.256 52.381 0.00 0.00 0.00 2.41
229 230 2.478200 GCAGCGGAGACTAGACTTGTAC 60.478 54.545 0.00 0.00 0.00 2.90
230 231 2.008329 AGCGGAGACTAGACTTGTACG 58.992 52.381 0.00 1.27 0.00 3.67
231 232 1.531470 GCGGAGACTAGACTTGTACGC 60.531 57.143 13.87 13.87 37.66 4.42
232 233 1.267433 CGGAGACTAGACTTGTACGCG 60.267 57.143 3.53 3.53 0.00 6.01
233 234 1.063764 GGAGACTAGACTTGTACGCGG 59.936 57.143 12.47 0.00 0.00 6.46
234 235 1.736681 GAGACTAGACTTGTACGCGGT 59.263 52.381 12.47 0.00 0.00 5.68
235 236 1.467734 AGACTAGACTTGTACGCGGTG 59.532 52.381 12.47 0.00 0.00 4.94
236 237 1.198637 GACTAGACTTGTACGCGGTGT 59.801 52.381 12.47 0.00 0.00 4.16
237 238 1.610522 ACTAGACTTGTACGCGGTGTT 59.389 47.619 12.47 0.00 0.00 3.32
238 239 2.248487 CTAGACTTGTACGCGGTGTTC 58.752 52.381 12.47 0.00 0.00 3.18
239 240 0.662374 AGACTTGTACGCGGTGTTCG 60.662 55.000 12.47 0.00 42.76 3.95
240 241 1.611592 GACTTGTACGCGGTGTTCGG 61.612 60.000 12.47 0.00 39.69 4.30
241 242 1.662446 CTTGTACGCGGTGTTCGGT 60.662 57.895 12.47 0.00 39.69 4.69
242 243 1.882682 CTTGTACGCGGTGTTCGGTG 61.883 60.000 12.47 0.00 39.69 4.94
243 244 3.770424 GTACGCGGTGTTCGGTGC 61.770 66.667 12.47 0.00 39.69 5.01
244 245 3.980989 TACGCGGTGTTCGGTGCT 61.981 61.111 12.47 0.00 39.69 4.40
248 249 2.340809 CGGTGTTCGGTGCTGGTA 59.659 61.111 0.00 0.00 34.75 3.25
249 250 1.736645 CGGTGTTCGGTGCTGGTAG 60.737 63.158 0.00 0.00 34.75 3.18
250 251 1.669440 GGTGTTCGGTGCTGGTAGA 59.331 57.895 0.00 0.00 0.00 2.59
251 252 0.389948 GGTGTTCGGTGCTGGTAGAG 60.390 60.000 0.00 0.00 0.00 2.43
252 253 0.317479 GTGTTCGGTGCTGGTAGAGT 59.683 55.000 0.00 0.00 0.00 3.24
253 254 0.601558 TGTTCGGTGCTGGTAGAGTC 59.398 55.000 0.00 0.00 0.00 3.36
254 255 0.601558 GTTCGGTGCTGGTAGAGTCA 59.398 55.000 0.00 0.00 0.00 3.41
255 256 1.204941 GTTCGGTGCTGGTAGAGTCAT 59.795 52.381 0.00 0.00 0.00 3.06
256 257 0.817654 TCGGTGCTGGTAGAGTCATG 59.182 55.000 0.00 0.00 0.00 3.07
257 258 0.179100 CGGTGCTGGTAGAGTCATGG 60.179 60.000 0.00 0.00 0.00 3.66
258 259 0.179000 GGTGCTGGTAGAGTCATGGG 59.821 60.000 0.00 0.00 0.00 4.00
259 260 0.462759 GTGCTGGTAGAGTCATGGGC 60.463 60.000 0.00 0.00 0.00 5.36
260 261 1.227380 GCTGGTAGAGTCATGGGCG 60.227 63.158 0.00 0.00 0.00 6.13
261 262 1.961180 GCTGGTAGAGTCATGGGCGT 61.961 60.000 0.00 0.00 0.00 5.68
262 263 0.179100 CTGGTAGAGTCATGGGCGTG 60.179 60.000 0.00 0.00 0.00 5.34
263 264 1.144057 GGTAGAGTCATGGGCGTGG 59.856 63.158 0.00 0.00 0.00 4.94
264 265 1.614241 GGTAGAGTCATGGGCGTGGT 61.614 60.000 0.00 0.00 0.00 4.16
265 266 0.249398 GTAGAGTCATGGGCGTGGTT 59.751 55.000 0.00 0.00 0.00 3.67
266 267 0.249120 TAGAGTCATGGGCGTGGTTG 59.751 55.000 0.00 0.00 0.00 3.77
267 268 1.003839 GAGTCATGGGCGTGGTTGA 60.004 57.895 0.00 0.00 0.00 3.18
268 269 1.003355 AGTCATGGGCGTGGTTGAG 60.003 57.895 0.00 0.00 0.00 3.02
269 270 1.003839 GTCATGGGCGTGGTTGAGA 60.004 57.895 0.00 0.00 0.00 3.27
270 271 0.392998 GTCATGGGCGTGGTTGAGAT 60.393 55.000 0.00 0.00 0.00 2.75
271 272 0.327924 TCATGGGCGTGGTTGAGATT 59.672 50.000 0.00 0.00 0.00 2.40
272 273 0.452987 CATGGGCGTGGTTGAGATTG 59.547 55.000 0.00 0.00 0.00 2.67
273 274 0.680921 ATGGGCGTGGTTGAGATTGG 60.681 55.000 0.00 0.00 0.00 3.16
274 275 1.303317 GGGCGTGGTTGAGATTGGT 60.303 57.895 0.00 0.00 0.00 3.67
275 276 1.305930 GGGCGTGGTTGAGATTGGTC 61.306 60.000 0.00 0.00 0.00 4.02
276 277 0.321653 GGCGTGGTTGAGATTGGTCT 60.322 55.000 0.00 0.00 37.42 3.85
277 278 0.798776 GCGTGGTTGAGATTGGTCTG 59.201 55.000 0.00 0.00 33.97 3.51
278 279 0.798776 CGTGGTTGAGATTGGTCTGC 59.201 55.000 0.00 0.00 33.97 4.26
279 280 1.877680 CGTGGTTGAGATTGGTCTGCA 60.878 52.381 0.00 0.00 33.97 4.41
280 281 1.537202 GTGGTTGAGATTGGTCTGCAC 59.463 52.381 0.00 0.00 33.97 4.57
281 282 1.142667 TGGTTGAGATTGGTCTGCACA 59.857 47.619 0.00 0.00 33.97 4.57
282 283 1.537202 GGTTGAGATTGGTCTGCACAC 59.463 52.381 0.00 0.00 33.97 3.82
283 284 2.221169 GTTGAGATTGGTCTGCACACA 58.779 47.619 0.00 0.00 33.97 3.72
284 285 2.816087 GTTGAGATTGGTCTGCACACAT 59.184 45.455 0.00 0.00 33.97 3.21
285 286 2.703416 TGAGATTGGTCTGCACACATC 58.297 47.619 0.00 0.00 33.97 3.06
286 287 2.012673 GAGATTGGTCTGCACACATCC 58.987 52.381 0.00 0.00 33.97 3.51
287 288 1.352017 AGATTGGTCTGCACACATCCA 59.648 47.619 0.00 0.00 32.13 3.41
288 289 1.470098 GATTGGTCTGCACACATCCAC 59.530 52.381 0.00 0.00 32.05 4.02
289 290 0.182299 TTGGTCTGCACACATCCACA 59.818 50.000 0.00 0.00 32.05 4.17
290 291 0.401356 TGGTCTGCACACATCCACAT 59.599 50.000 0.00 0.00 0.00 3.21
291 292 0.806868 GGTCTGCACACATCCACATG 59.193 55.000 0.00 0.00 35.92 3.21
292 293 0.169672 GTCTGCACACATCCACATGC 59.830 55.000 0.00 0.00 38.59 4.06
293 294 0.961857 TCTGCACACATCCACATGCC 60.962 55.000 0.00 0.00 37.26 4.40
294 295 2.261172 CTGCACACATCCACATGCCG 62.261 60.000 0.00 0.00 37.26 5.69
295 296 2.039974 GCACACATCCACATGCCGA 61.040 57.895 0.00 0.00 32.57 5.54
296 297 1.796151 CACACATCCACATGCCGAC 59.204 57.895 0.00 0.00 32.57 4.79
297 298 1.377202 ACACATCCACATGCCGACC 60.377 57.895 0.00 0.00 32.57 4.79
298 299 1.078214 CACATCCACATGCCGACCT 60.078 57.895 0.00 0.00 32.57 3.85
299 300 1.091771 CACATCCACATGCCGACCTC 61.092 60.000 0.00 0.00 32.57 3.85
300 301 1.524621 CATCCACATGCCGACCTCC 60.525 63.158 0.00 0.00 0.00 4.30
301 302 1.995066 ATCCACATGCCGACCTCCA 60.995 57.895 0.00 0.00 0.00 3.86
302 303 1.348008 ATCCACATGCCGACCTCCAT 61.348 55.000 0.00 0.00 0.00 3.41
303 304 1.524621 CCACATGCCGACCTCCATC 60.525 63.158 0.00 0.00 0.00 3.51
304 305 1.524002 CACATGCCGACCTCCATCT 59.476 57.895 0.00 0.00 0.00 2.90
305 306 0.752658 CACATGCCGACCTCCATCTA 59.247 55.000 0.00 0.00 0.00 1.98
306 307 1.345741 CACATGCCGACCTCCATCTAT 59.654 52.381 0.00 0.00 0.00 1.98
307 308 1.620819 ACATGCCGACCTCCATCTATC 59.379 52.381 0.00 0.00 0.00 2.08
308 309 1.898472 CATGCCGACCTCCATCTATCT 59.102 52.381 0.00 0.00 0.00 1.98
309 310 2.088104 TGCCGACCTCCATCTATCTT 57.912 50.000 0.00 0.00 0.00 2.40
310 311 2.398588 TGCCGACCTCCATCTATCTTT 58.601 47.619 0.00 0.00 0.00 2.52
311 312 2.103094 TGCCGACCTCCATCTATCTTTG 59.897 50.000 0.00 0.00 0.00 2.77
312 313 2.365617 GCCGACCTCCATCTATCTTTGA 59.634 50.000 0.00 0.00 0.00 2.69
313 314 3.181465 GCCGACCTCCATCTATCTTTGAA 60.181 47.826 0.00 0.00 0.00 2.69
314 315 4.503991 GCCGACCTCCATCTATCTTTGAAT 60.504 45.833 0.00 0.00 0.00 2.57
315 316 5.615289 CCGACCTCCATCTATCTTTGAATT 58.385 41.667 0.00 0.00 0.00 2.17
316 317 6.741521 GCCGACCTCCATCTATCTTTGAATTA 60.742 42.308 0.00 0.00 0.00 1.40
317 318 7.217200 CCGACCTCCATCTATCTTTGAATTAA 58.783 38.462 0.00 0.00 0.00 1.40
318 319 7.880195 CCGACCTCCATCTATCTTTGAATTAAT 59.120 37.037 0.00 0.00 0.00 1.40
319 320 9.929180 CGACCTCCATCTATCTTTGAATTAATA 57.071 33.333 0.00 0.00 0.00 0.98
322 323 9.171877 CCTCCATCTATCTTTGAATTAATAGGC 57.828 37.037 0.00 0.00 0.00 3.93
323 324 9.730705 CTCCATCTATCTTTGAATTAATAGGCA 57.269 33.333 0.00 0.00 0.00 4.75
332 333 9.555727 TCTTTGAATTAATAGGCATGTACTACC 57.444 33.333 0.00 0.00 0.00 3.18
333 334 9.561069 CTTTGAATTAATAGGCATGTACTACCT 57.439 33.333 7.03 7.03 37.61 3.08
334 335 9.555727 TTTGAATTAATAGGCATGTACTACCTC 57.444 33.333 5.35 0.00 34.92 3.85
335 336 7.676947 TGAATTAATAGGCATGTACTACCTCC 58.323 38.462 5.35 0.00 34.92 4.30
336 337 5.717078 TTAATAGGCATGTACTACCTCCG 57.283 43.478 5.35 0.00 34.92 4.63
337 338 2.742428 TAGGCATGTACTACCTCCGT 57.258 50.000 5.35 0.00 34.92 4.69
338 339 1.400737 AGGCATGTACTACCTCCGTC 58.599 55.000 0.00 0.00 0.00 4.79
339 340 0.388294 GGCATGTACTACCTCCGTCC 59.612 60.000 0.00 0.00 0.00 4.79
340 341 1.400737 GCATGTACTACCTCCGTCCT 58.599 55.000 0.00 0.00 0.00 3.85
341 342 1.337387 GCATGTACTACCTCCGTCCTC 59.663 57.143 0.00 0.00 0.00 3.71
342 343 1.602851 CATGTACTACCTCCGTCCTCG 59.397 57.143 0.00 0.00 0.00 4.63
343 344 0.615331 TGTACTACCTCCGTCCTCGT 59.385 55.000 0.00 0.00 35.01 4.18
344 345 1.003580 TGTACTACCTCCGTCCTCGTT 59.996 52.381 0.00 0.00 35.01 3.85
345 346 2.087646 GTACTACCTCCGTCCTCGTTT 58.912 52.381 0.00 0.00 35.01 3.60
346 347 2.496899 ACTACCTCCGTCCTCGTTTA 57.503 50.000 0.00 0.00 35.01 2.01
347 348 3.010200 ACTACCTCCGTCCTCGTTTAT 57.990 47.619 0.00 0.00 35.01 1.40
348 349 2.948315 ACTACCTCCGTCCTCGTTTATC 59.052 50.000 0.00 0.00 35.01 1.75
349 350 0.737219 ACCTCCGTCCTCGTTTATCG 59.263 55.000 0.00 0.00 41.41 2.92
350 351 0.030369 CCTCCGTCCTCGTTTATCGG 59.970 60.000 0.00 0.00 42.12 4.18
351 352 0.737219 CTCCGTCCTCGTTTATCGGT 59.263 55.000 0.00 0.00 41.58 4.69
352 353 0.734889 TCCGTCCTCGTTTATCGGTC 59.265 55.000 0.00 0.00 41.58 4.79
353 354 0.248784 CCGTCCTCGTTTATCGGTCC 60.249 60.000 0.00 0.00 40.32 4.46
354 355 0.248784 CGTCCTCGTTTATCGGTCCC 60.249 60.000 0.00 0.00 40.32 4.46
355 356 1.109609 GTCCTCGTTTATCGGTCCCT 58.890 55.000 0.00 0.00 40.32 4.20
356 357 1.479730 GTCCTCGTTTATCGGTCCCTT 59.520 52.381 0.00 0.00 40.32 3.95
357 358 2.093816 GTCCTCGTTTATCGGTCCCTTT 60.094 50.000 0.00 0.00 40.32 3.11
358 359 2.093869 TCCTCGTTTATCGGTCCCTTTG 60.094 50.000 0.00 0.00 40.32 2.77
359 360 2.354403 CCTCGTTTATCGGTCCCTTTGT 60.354 50.000 0.00 0.00 40.32 2.83
360 361 3.119029 CCTCGTTTATCGGTCCCTTTGTA 60.119 47.826 0.00 0.00 40.32 2.41
361 362 4.497300 CTCGTTTATCGGTCCCTTTGTAA 58.503 43.478 0.00 0.00 40.32 2.41
362 363 5.088680 TCGTTTATCGGTCCCTTTGTAAT 57.911 39.130 0.00 0.00 40.32 1.89
363 364 5.490159 TCGTTTATCGGTCCCTTTGTAATT 58.510 37.500 0.00 0.00 40.32 1.40
364 365 5.939296 TCGTTTATCGGTCCCTTTGTAATTT 59.061 36.000 0.00 0.00 40.32 1.82
365 366 6.025280 CGTTTATCGGTCCCTTTGTAATTTG 58.975 40.000 0.00 0.00 35.71 2.32
366 367 6.348704 CGTTTATCGGTCCCTTTGTAATTTGT 60.349 38.462 0.00 0.00 35.71 2.83
367 368 6.503589 TTATCGGTCCCTTTGTAATTTGTG 57.496 37.500 0.00 0.00 0.00 3.33
368 369 3.822940 TCGGTCCCTTTGTAATTTGTGT 58.177 40.909 0.00 0.00 0.00 3.72
369 370 4.208746 TCGGTCCCTTTGTAATTTGTGTT 58.791 39.130 0.00 0.00 0.00 3.32
370 371 5.374921 TCGGTCCCTTTGTAATTTGTGTTA 58.625 37.500 0.00 0.00 0.00 2.41
371 372 5.826737 TCGGTCCCTTTGTAATTTGTGTTAA 59.173 36.000 0.00 0.00 0.00 2.01
372 373 6.320672 TCGGTCCCTTTGTAATTTGTGTTAAA 59.679 34.615 0.00 0.00 0.00 1.52
373 374 7.014422 TCGGTCCCTTTGTAATTTGTGTTAAAT 59.986 33.333 0.00 0.00 0.00 1.40
374 375 7.654116 CGGTCCCTTTGTAATTTGTGTTAAATT 59.346 33.333 0.00 0.00 34.55 1.82
375 376 9.332502 GGTCCCTTTGTAATTTGTGTTAAATTT 57.667 29.630 0.00 0.00 32.64 1.82
415 416 9.926158 AACTAACAAAATATCAATGCATGTCAA 57.074 25.926 0.00 0.00 0.00 3.18
416 417 9.357652 ACTAACAAAATATCAATGCATGTCAAC 57.642 29.630 0.00 0.00 0.00 3.18
417 418 6.874297 ACAAAATATCAATGCATGTCAACG 57.126 33.333 0.00 0.00 0.00 4.10
418 419 6.619744 ACAAAATATCAATGCATGTCAACGA 58.380 32.000 0.00 0.00 0.00 3.85
419 420 7.089538 ACAAAATATCAATGCATGTCAACGAA 58.910 30.769 0.00 0.00 0.00 3.85
420 421 7.760794 ACAAAATATCAATGCATGTCAACGAAT 59.239 29.630 0.00 0.00 0.00 3.34
421 422 9.235537 CAAAATATCAATGCATGTCAACGAATA 57.764 29.630 0.00 0.00 0.00 1.75
422 423 9.970395 AAAATATCAATGCATGTCAACGAATAT 57.030 25.926 0.00 0.00 0.00 1.28
423 424 9.970395 AAATATCAATGCATGTCAACGAATATT 57.030 25.926 0.00 0.00 0.00 1.28
494 495 9.926158 TTTTTATGACATGCATAGACATTTTGT 57.074 25.926 14.44 1.30 40.40 2.83
495 496 9.926158 TTTTATGACATGCATAGACATTTTGTT 57.074 25.926 14.44 0.00 40.40 2.83
496 497 9.926158 TTTATGACATGCATAGACATTTTGTTT 57.074 25.926 14.44 0.00 40.40 2.83
497 498 7.821595 ATGACATGCATAGACATTTTGTTTG 57.178 32.000 0.00 0.00 34.82 2.93
498 499 6.747125 TGACATGCATAGACATTTTGTTTGT 58.253 32.000 0.00 0.00 0.00 2.83
499 500 7.208777 TGACATGCATAGACATTTTGTTTGTT 58.791 30.769 0.00 0.00 0.00 2.83
500 501 8.355913 TGACATGCATAGACATTTTGTTTGTTA 58.644 29.630 0.00 0.00 0.00 2.41
501 502 9.190858 GACATGCATAGACATTTTGTTTGTTAA 57.809 29.630 0.00 0.00 0.00 2.01
502 503 9.539825 ACATGCATAGACATTTTGTTTGTTAAA 57.460 25.926 0.00 0.00 0.00 1.52
505 506 9.979578 TGCATAGACATTTTGTTTGTTAAATCT 57.020 25.926 0.00 0.00 0.00 2.40
540 541 6.861065 TTCGCCTGAAATGTAATAAGGATC 57.139 37.500 0.00 0.00 0.00 3.36
541 542 5.924356 TCGCCTGAAATGTAATAAGGATCA 58.076 37.500 0.00 0.00 0.00 2.92
542 543 6.353323 TCGCCTGAAATGTAATAAGGATCAA 58.647 36.000 0.00 0.00 0.00 2.57
543 544 6.998074 TCGCCTGAAATGTAATAAGGATCAAT 59.002 34.615 0.00 0.00 0.00 2.57
544 545 8.154203 TCGCCTGAAATGTAATAAGGATCAATA 58.846 33.333 0.00 0.00 0.00 1.90
545 546 8.783093 CGCCTGAAATGTAATAAGGATCAATAA 58.217 33.333 0.00 0.00 0.00 1.40
553 554 8.974060 TGTAATAAGGATCAATAAACCAGGAC 57.026 34.615 0.00 0.00 0.00 3.85
554 555 7.713507 TGTAATAAGGATCAATAAACCAGGACG 59.286 37.037 0.00 0.00 0.00 4.79
555 556 3.560636 AGGATCAATAAACCAGGACGG 57.439 47.619 0.00 0.00 42.50 4.79
556 557 3.112263 AGGATCAATAAACCAGGACGGA 58.888 45.455 0.00 0.00 38.63 4.69
557 558 3.134804 AGGATCAATAAACCAGGACGGAG 59.865 47.826 0.00 0.00 38.63 4.63
558 559 3.467803 GATCAATAAACCAGGACGGAGG 58.532 50.000 0.00 0.00 38.63 4.30
559 560 2.262637 TCAATAAACCAGGACGGAGGT 58.737 47.619 0.00 0.00 40.61 3.85
560 561 3.443052 TCAATAAACCAGGACGGAGGTA 58.557 45.455 0.00 0.00 37.07 3.08
561 562 3.449737 TCAATAAACCAGGACGGAGGTAG 59.550 47.826 0.00 0.00 37.07 3.18
562 563 2.610438 TAAACCAGGACGGAGGTAGT 57.390 50.000 0.00 0.00 37.07 2.73
563 564 2.610438 AAACCAGGACGGAGGTAGTA 57.390 50.000 0.00 0.00 37.07 1.82
564 565 2.842645 AACCAGGACGGAGGTAGTAT 57.157 50.000 0.00 0.00 37.07 2.12
565 566 2.068834 ACCAGGACGGAGGTAGTATG 57.931 55.000 0.00 0.00 36.07 2.39
566 567 1.287146 ACCAGGACGGAGGTAGTATGT 59.713 52.381 0.00 0.00 36.07 2.29
567 568 2.292061 ACCAGGACGGAGGTAGTATGTT 60.292 50.000 0.00 0.00 36.07 2.71
568 569 2.100916 CCAGGACGGAGGTAGTATGTTG 59.899 54.545 0.00 0.00 36.56 3.33
569 570 2.100916 CAGGACGGAGGTAGTATGTTGG 59.899 54.545 0.00 0.00 0.00 3.77
570 571 2.024655 AGGACGGAGGTAGTATGTTGGA 60.025 50.000 0.00 0.00 0.00 3.53
571 572 2.361438 GGACGGAGGTAGTATGTTGGAG 59.639 54.545 0.00 0.00 0.00 3.86
572 573 1.755380 ACGGAGGTAGTATGTTGGAGC 59.245 52.381 0.00 0.00 0.00 4.70
573 574 1.754803 CGGAGGTAGTATGTTGGAGCA 59.245 52.381 0.00 0.00 0.00 4.26
574 575 2.167693 CGGAGGTAGTATGTTGGAGCAA 59.832 50.000 0.00 0.00 0.00 3.91
575 576 3.369052 CGGAGGTAGTATGTTGGAGCAAA 60.369 47.826 0.00 0.00 0.00 3.68
576 577 4.585879 GGAGGTAGTATGTTGGAGCAAAA 58.414 43.478 0.00 0.00 0.00 2.44
577 578 5.007682 GGAGGTAGTATGTTGGAGCAAAAA 58.992 41.667 0.00 0.00 0.00 1.94
578 579 5.652452 GGAGGTAGTATGTTGGAGCAAAAAT 59.348 40.000 0.00 0.00 0.00 1.82
579 580 6.826741 GGAGGTAGTATGTTGGAGCAAAAATA 59.173 38.462 0.00 0.00 0.00 1.40
580 581 7.012421 GGAGGTAGTATGTTGGAGCAAAAATAG 59.988 40.741 0.00 0.00 0.00 1.73
581 582 6.828785 AGGTAGTATGTTGGAGCAAAAATAGG 59.171 38.462 0.00 0.00 0.00 2.57
582 583 6.602009 GGTAGTATGTTGGAGCAAAAATAGGT 59.398 38.462 0.00 0.00 0.00 3.08
583 584 6.515272 AGTATGTTGGAGCAAAAATAGGTG 57.485 37.500 0.00 0.00 0.00 4.00
584 585 6.010219 AGTATGTTGGAGCAAAAATAGGTGT 58.990 36.000 0.00 0.00 0.00 4.16
585 586 4.846779 TGTTGGAGCAAAAATAGGTGTC 57.153 40.909 0.00 0.00 0.00 3.67
586 587 3.252215 TGTTGGAGCAAAAATAGGTGTCG 59.748 43.478 0.00 0.00 0.00 4.35
587 588 3.410631 TGGAGCAAAAATAGGTGTCGA 57.589 42.857 0.00 0.00 0.00 4.20
588 589 3.334691 TGGAGCAAAAATAGGTGTCGAG 58.665 45.455 0.00 0.00 0.00 4.04
589 590 3.244422 TGGAGCAAAAATAGGTGTCGAGT 60.244 43.478 0.00 0.00 0.00 4.18
590 591 3.125316 GGAGCAAAAATAGGTGTCGAGTG 59.875 47.826 0.00 0.00 0.00 3.51
591 592 3.074412 AGCAAAAATAGGTGTCGAGTGG 58.926 45.455 0.00 0.00 0.00 4.00
592 593 2.812011 GCAAAAATAGGTGTCGAGTGGT 59.188 45.455 0.00 0.00 0.00 4.16
593 594 3.252458 GCAAAAATAGGTGTCGAGTGGTT 59.748 43.478 0.00 0.00 0.00 3.67
594 595 4.783242 CAAAAATAGGTGTCGAGTGGTTG 58.217 43.478 0.00 0.00 0.00 3.77
595 596 2.762535 AATAGGTGTCGAGTGGTTGG 57.237 50.000 0.00 0.00 0.00 3.77
596 597 1.640917 ATAGGTGTCGAGTGGTTGGT 58.359 50.000 0.00 0.00 0.00 3.67
597 598 0.677288 TAGGTGTCGAGTGGTTGGTG 59.323 55.000 0.00 0.00 0.00 4.17
598 599 1.046472 AGGTGTCGAGTGGTTGGTGA 61.046 55.000 0.00 0.00 0.00 4.02
599 600 0.600255 GGTGTCGAGTGGTTGGTGAG 60.600 60.000 0.00 0.00 0.00 3.51
600 601 1.069090 TGTCGAGTGGTTGGTGAGC 59.931 57.895 0.00 0.00 0.00 4.26
601 602 1.668151 GTCGAGTGGTTGGTGAGCC 60.668 63.158 0.00 0.00 0.00 4.70
602 603 2.137528 TCGAGTGGTTGGTGAGCCA 61.138 57.895 0.00 0.00 44.38 4.75
603 604 1.669115 CGAGTGGTTGGTGAGCCAG 60.669 63.158 0.00 0.00 46.91 4.85
604 605 1.968540 GAGTGGTTGGTGAGCCAGC 60.969 63.158 0.00 0.00 46.91 4.85
628 629 4.234019 GCATACGGCACCCATTGA 57.766 55.556 0.00 0.00 43.97 2.57
629 630 1.727467 GCATACGGCACCCATTGAC 59.273 57.895 0.00 0.00 43.97 3.18
630 631 1.029408 GCATACGGCACCCATTGACA 61.029 55.000 0.00 0.00 43.97 3.58
631 632 1.679139 CATACGGCACCCATTGACAT 58.321 50.000 0.00 0.00 28.81 3.06
632 633 1.603802 CATACGGCACCCATTGACATC 59.396 52.381 0.00 0.00 28.81 3.06
633 634 0.461163 TACGGCACCCATTGACATCG 60.461 55.000 0.00 0.00 28.81 3.84
634 635 2.472059 CGGCACCCATTGACATCGG 61.472 63.158 0.00 0.00 28.81 4.18
635 636 1.077787 GGCACCCATTGACATCGGA 60.078 57.895 0.00 0.00 30.77 4.55
636 637 1.097547 GGCACCCATTGACATCGGAG 61.098 60.000 0.00 0.00 30.77 4.63
637 638 1.097547 GCACCCATTGACATCGGAGG 61.098 60.000 0.00 0.00 0.00 4.30
638 639 1.097547 CACCCATTGACATCGGAGGC 61.098 60.000 0.00 0.00 0.00 4.70
639 640 1.274703 ACCCATTGACATCGGAGGCT 61.275 55.000 0.00 0.00 0.00 4.58
640 641 0.816825 CCCATTGACATCGGAGGCTG 60.817 60.000 0.00 0.00 0.00 4.85
641 642 0.816825 CCATTGACATCGGAGGCTGG 60.817 60.000 0.00 0.00 0.00 4.85
642 643 0.816825 CATTGACATCGGAGGCTGGG 60.817 60.000 0.00 0.00 0.00 4.45
643 644 0.982852 ATTGACATCGGAGGCTGGGA 60.983 55.000 0.00 0.00 0.00 4.37
644 645 1.198094 TTGACATCGGAGGCTGGGAA 61.198 55.000 0.00 0.00 0.00 3.97
645 646 1.153349 GACATCGGAGGCTGGGAAC 60.153 63.158 0.00 0.00 0.00 3.62
646 647 2.202932 CATCGGAGGCTGGGAACG 60.203 66.667 0.00 0.00 0.00 3.95
647 648 4.162690 ATCGGAGGCTGGGAACGC 62.163 66.667 0.00 0.00 0.00 4.84
654 655 4.090057 GCTGGGAACGCGTGCTTC 62.090 66.667 18.55 9.21 0.00 3.86
655 656 2.357517 CTGGGAACGCGTGCTTCT 60.358 61.111 18.55 0.00 0.00 2.85
656 657 1.961277 CTGGGAACGCGTGCTTCTT 60.961 57.895 18.55 0.00 0.00 2.52
657 658 1.901650 CTGGGAACGCGTGCTTCTTC 61.902 60.000 18.55 7.56 0.00 2.87
658 659 2.677979 GGGAACGCGTGCTTCTTCC 61.678 63.158 18.55 16.79 32.75 3.46
659 660 2.470286 GAACGCGTGCTTCTTCCG 59.530 61.111 14.98 0.00 0.00 4.30
660 661 2.019951 GAACGCGTGCTTCTTCCGA 61.020 57.895 14.98 0.00 0.00 4.55
661 662 2.211761 GAACGCGTGCTTCTTCCGAC 62.212 60.000 14.98 0.00 0.00 4.79
662 663 3.827784 CGCGTGCTTCTTCCGACG 61.828 66.667 0.00 0.00 34.93 5.12
663 664 2.430244 GCGTGCTTCTTCCGACGA 60.430 61.111 0.00 0.00 33.64 4.20
664 665 2.437343 GCGTGCTTCTTCCGACGAG 61.437 63.158 0.00 0.00 33.64 4.18
665 666 1.801913 CGTGCTTCTTCCGACGAGG 60.802 63.158 0.00 0.00 42.97 4.63
666 667 1.446272 GTGCTTCTTCCGACGAGGG 60.446 63.158 0.00 0.00 41.52 4.30
667 668 1.605451 TGCTTCTTCCGACGAGGGA 60.605 57.895 0.00 0.00 41.52 4.20
668 669 1.153804 GCTTCTTCCGACGAGGGAC 60.154 63.158 0.00 0.00 41.52 4.46
670 671 1.302752 TTCTTCCGACGAGGGACGA 60.303 57.895 0.00 0.00 45.77 4.20
671 672 1.580845 TTCTTCCGACGAGGGACGAC 61.581 60.000 0.00 0.00 45.77 4.34
672 673 3.048941 CTTCCGACGAGGGACGACC 62.049 68.421 0.00 0.00 45.77 4.79
682 683 3.875865 GGGACGACCTAGCCAAAAT 57.124 52.632 3.44 0.00 35.85 1.82
683 684 1.379527 GGGACGACCTAGCCAAAATG 58.620 55.000 3.44 0.00 35.85 2.32
684 685 1.065709 GGGACGACCTAGCCAAAATGA 60.066 52.381 3.44 0.00 35.85 2.57
685 686 2.617021 GGGACGACCTAGCCAAAATGAA 60.617 50.000 3.44 0.00 35.85 2.57
686 687 3.078837 GGACGACCTAGCCAAAATGAAA 58.921 45.455 0.00 0.00 0.00 2.69
687 688 3.127030 GGACGACCTAGCCAAAATGAAAG 59.873 47.826 0.00 0.00 0.00 2.62
688 689 3.751518 ACGACCTAGCCAAAATGAAAGT 58.248 40.909 0.00 0.00 0.00 2.66
689 690 4.142038 ACGACCTAGCCAAAATGAAAGTT 58.858 39.130 0.00 0.00 0.00 2.66
690 691 5.310451 ACGACCTAGCCAAAATGAAAGTTA 58.690 37.500 0.00 0.00 0.00 2.24
691 692 5.766174 ACGACCTAGCCAAAATGAAAGTTAA 59.234 36.000 0.00 0.00 0.00 2.01
692 693 6.263617 ACGACCTAGCCAAAATGAAAGTTAAA 59.736 34.615 0.00 0.00 0.00 1.52
693 694 7.142680 CGACCTAGCCAAAATGAAAGTTAAAA 58.857 34.615 0.00 0.00 0.00 1.52
694 695 7.114388 CGACCTAGCCAAAATGAAAGTTAAAAC 59.886 37.037 0.00 0.00 0.00 2.43
695 696 7.787028 ACCTAGCCAAAATGAAAGTTAAAACA 58.213 30.769 0.00 0.00 0.00 2.83
696 697 8.428852 ACCTAGCCAAAATGAAAGTTAAAACAT 58.571 29.630 0.00 0.00 0.00 2.71
697 698 8.925700 CCTAGCCAAAATGAAAGTTAAAACATC 58.074 33.333 0.00 0.00 0.00 3.06
698 699 7.406799 AGCCAAAATGAAAGTTAAAACATCG 57.593 32.000 0.00 0.00 0.00 3.84
699 700 6.070829 GCCAAAATGAAAGTTAAAACATCGC 58.929 36.000 0.00 0.00 0.00 4.58
700 701 6.589454 CCAAAATGAAAGTTAAAACATCGCC 58.411 36.000 0.00 0.00 0.00 5.54
701 702 6.423604 CCAAAATGAAAGTTAAAACATCGCCT 59.576 34.615 0.00 0.00 0.00 5.52
702 703 7.359181 CCAAAATGAAAGTTAAAACATCGCCTC 60.359 37.037 0.00 0.00 0.00 4.70
703 704 6.575162 AATGAAAGTTAAAACATCGCCTCT 57.425 33.333 0.00 0.00 0.00 3.69
704 705 5.356882 TGAAAGTTAAAACATCGCCTCTG 57.643 39.130 0.00 0.00 0.00 3.35
705 706 5.060506 TGAAAGTTAAAACATCGCCTCTGA 58.939 37.500 0.00 0.00 0.00 3.27
706 707 5.705441 TGAAAGTTAAAACATCGCCTCTGAT 59.295 36.000 0.00 0.00 0.00 2.90
707 708 5.803020 AAGTTAAAACATCGCCTCTGATC 57.197 39.130 0.00 0.00 0.00 2.92
708 709 5.091261 AGTTAAAACATCGCCTCTGATCT 57.909 39.130 0.00 0.00 0.00 2.75
709 710 5.112686 AGTTAAAACATCGCCTCTGATCTC 58.887 41.667 0.00 0.00 0.00 2.75
710 711 2.611225 AAACATCGCCTCTGATCTCC 57.389 50.000 0.00 0.00 0.00 3.71
711 712 0.755686 AACATCGCCTCTGATCTCCC 59.244 55.000 0.00 0.00 0.00 4.30
712 713 0.105760 ACATCGCCTCTGATCTCCCT 60.106 55.000 0.00 0.00 0.00 4.20
713 714 0.602562 CATCGCCTCTGATCTCCCTC 59.397 60.000 0.00 0.00 0.00 4.30
714 715 0.187117 ATCGCCTCTGATCTCCCTCA 59.813 55.000 0.00 0.00 0.00 3.86
715 716 0.753479 TCGCCTCTGATCTCCCTCAC 60.753 60.000 0.00 0.00 0.00 3.51
716 717 0.754957 CGCCTCTGATCTCCCTCACT 60.755 60.000 0.00 0.00 0.00 3.41
717 718 1.039856 GCCTCTGATCTCCCTCACTC 58.960 60.000 0.00 0.00 0.00 3.51
718 719 1.411501 GCCTCTGATCTCCCTCACTCT 60.412 57.143 0.00 0.00 0.00 3.24
719 720 2.586425 CCTCTGATCTCCCTCACTCTC 58.414 57.143 0.00 0.00 0.00 3.20
720 721 2.175499 CCTCTGATCTCCCTCACTCTCT 59.825 54.545 0.00 0.00 0.00 3.10
721 722 3.394274 CCTCTGATCTCCCTCACTCTCTA 59.606 52.174 0.00 0.00 0.00 2.43
722 723 4.389374 CTCTGATCTCCCTCACTCTCTAC 58.611 52.174 0.00 0.00 0.00 2.59
723 724 3.137544 TCTGATCTCCCTCACTCTCTACC 59.862 52.174 0.00 0.00 0.00 3.18
724 725 3.127250 TGATCTCCCTCACTCTCTACCT 58.873 50.000 0.00 0.00 0.00 3.08
725 726 3.137544 TGATCTCCCTCACTCTCTACCTC 59.862 52.174 0.00 0.00 0.00 3.85
726 727 1.487142 TCTCCCTCACTCTCTACCTCG 59.513 57.143 0.00 0.00 0.00 4.63
727 728 0.107116 TCCCTCACTCTCTACCTCGC 60.107 60.000 0.00 0.00 0.00 5.03
728 729 1.104577 CCCTCACTCTCTACCTCGCC 61.105 65.000 0.00 0.00 0.00 5.54
729 730 1.104577 CCTCACTCTCTACCTCGCCC 61.105 65.000 0.00 0.00 0.00 6.13
730 731 1.076923 TCACTCTCTACCTCGCCCC 60.077 63.158 0.00 0.00 0.00 5.80
731 732 1.076632 CACTCTCTACCTCGCCCCT 60.077 63.158 0.00 0.00 0.00 4.79
732 733 0.684805 CACTCTCTACCTCGCCCCTT 60.685 60.000 0.00 0.00 0.00 3.95
733 734 0.684805 ACTCTCTACCTCGCCCCTTG 60.685 60.000 0.00 0.00 0.00 3.61
734 735 2.022240 CTCTCTACCTCGCCCCTTGC 62.022 65.000 0.00 0.00 0.00 4.01
735 736 2.038975 TCTACCTCGCCCCTTGCT 59.961 61.111 0.00 0.00 38.05 3.91
736 737 0.755698 CTCTACCTCGCCCCTTGCTA 60.756 60.000 0.00 0.00 38.05 3.49
737 738 0.755698 TCTACCTCGCCCCTTGCTAG 60.756 60.000 0.00 0.00 38.05 3.42
740 741 3.309582 CTCGCCCCTTGCTAGGAA 58.690 61.111 16.43 0.00 45.05 3.36
741 742 1.602237 CTCGCCCCTTGCTAGGAAA 59.398 57.895 16.43 0.00 45.05 3.13
742 743 0.035439 CTCGCCCCTTGCTAGGAAAA 60.035 55.000 16.43 0.00 45.05 2.29
743 744 0.402504 TCGCCCCTTGCTAGGAAAAA 59.597 50.000 16.43 0.00 45.05 1.94
762 763 5.659440 AAAAAGAAGAAAAGGACACAGCA 57.341 34.783 0.00 0.00 0.00 4.41
763 764 5.859205 AAAAGAAGAAAAGGACACAGCAT 57.141 34.783 0.00 0.00 0.00 3.79
764 765 5.444663 AAAGAAGAAAAGGACACAGCATC 57.555 39.130 0.00 0.00 0.00 3.91
765 766 3.070018 AGAAGAAAAGGACACAGCATCG 58.930 45.455 0.00 0.00 0.00 3.84
766 767 2.550830 AGAAAAGGACACAGCATCGT 57.449 45.000 0.00 0.00 0.00 3.73
767 768 2.146342 AGAAAAGGACACAGCATCGTG 58.854 47.619 0.00 0.00 42.81 4.35
768 769 0.593128 AAAAGGACACAGCATCGTGC 59.407 50.000 2.28 2.28 45.46 5.34
769 770 1.237285 AAAGGACACAGCATCGTGCC 61.237 55.000 6.39 4.27 46.52 5.01
770 771 3.127533 GGACACAGCATCGTGCCC 61.128 66.667 6.39 0.00 46.52 5.36
771 772 2.046892 GACACAGCATCGTGCCCT 60.047 61.111 6.39 0.00 46.52 5.19
772 773 1.672356 GACACAGCATCGTGCCCTT 60.672 57.895 6.39 0.00 46.52 3.95
773 774 1.639298 GACACAGCATCGTGCCCTTC 61.639 60.000 6.39 0.00 46.52 3.46
774 775 2.434884 ACAGCATCGTGCCCTTCG 60.435 61.111 6.39 0.00 46.52 3.79
775 776 2.434884 CAGCATCGTGCCCTTCGT 60.435 61.111 6.39 0.00 46.52 3.85
776 777 2.125512 AGCATCGTGCCCTTCGTC 60.126 61.111 6.39 0.00 46.52 4.20
777 778 2.125512 GCATCGTGCCCTTCGTCT 60.126 61.111 0.00 0.00 37.42 4.18
778 779 2.167861 GCATCGTGCCCTTCGTCTC 61.168 63.158 0.00 0.00 37.42 3.36
779 780 1.519455 CATCGTGCCCTTCGTCTCC 60.519 63.158 0.00 0.00 0.00 3.71
780 781 1.982395 ATCGTGCCCTTCGTCTCCA 60.982 57.895 0.00 0.00 0.00 3.86
781 782 2.227089 ATCGTGCCCTTCGTCTCCAC 62.227 60.000 0.00 0.00 0.00 4.02
782 783 2.741092 GTGCCCTTCGTCTCCACA 59.259 61.111 0.00 0.00 0.00 4.17
783 784 1.374758 GTGCCCTTCGTCTCCACAG 60.375 63.158 0.00 0.00 0.00 3.66
784 785 2.435059 GCCCTTCGTCTCCACAGC 60.435 66.667 0.00 0.00 0.00 4.40
785 786 3.059982 CCCTTCGTCTCCACAGCA 58.940 61.111 0.00 0.00 0.00 4.41
786 787 1.374758 CCCTTCGTCTCCACAGCAC 60.375 63.158 0.00 0.00 0.00 4.40
787 788 1.374758 CCTTCGTCTCCACAGCACC 60.375 63.158 0.00 0.00 0.00 5.01
788 789 1.734477 CTTCGTCTCCACAGCACCG 60.734 63.158 0.00 0.00 0.00 4.94
789 790 3.858868 TTCGTCTCCACAGCACCGC 62.859 63.158 0.00 0.00 0.00 5.68
806 807 4.424566 CGCAGCACAACCCATGGC 62.425 66.667 6.09 0.00 0.00 4.40
807 808 4.424566 GCAGCACAACCCATGGCG 62.425 66.667 6.09 2.02 32.48 5.69
808 809 2.672651 CAGCACAACCCATGGCGA 60.673 61.111 6.09 0.00 32.48 5.54
809 810 2.672996 AGCACAACCCATGGCGAC 60.673 61.111 6.09 0.00 32.48 5.19
810 811 2.672996 GCACAACCCATGGCGACT 60.673 61.111 6.09 0.00 0.00 4.18
811 812 1.376683 GCACAACCCATGGCGACTA 60.377 57.895 6.09 0.00 0.00 2.59
812 813 1.644786 GCACAACCCATGGCGACTAC 61.645 60.000 6.09 0.00 0.00 2.73
813 814 1.024579 CACAACCCATGGCGACTACC 61.025 60.000 6.09 0.00 0.00 3.18
814 815 1.198759 ACAACCCATGGCGACTACCT 61.199 55.000 6.09 0.00 0.00 3.08
815 816 0.828022 CAACCCATGGCGACTACCTA 59.172 55.000 6.09 0.00 0.00 3.08
816 817 1.416401 CAACCCATGGCGACTACCTAT 59.584 52.381 6.09 0.00 0.00 2.57
817 818 1.048601 ACCCATGGCGACTACCTATG 58.951 55.000 6.09 0.00 0.00 2.23
818 819 1.048601 CCCATGGCGACTACCTATGT 58.951 55.000 6.09 0.00 0.00 2.29
819 820 1.416401 CCCATGGCGACTACCTATGTT 59.584 52.381 6.09 0.00 0.00 2.71
820 821 2.631062 CCCATGGCGACTACCTATGTTA 59.369 50.000 6.09 0.00 0.00 2.41
829 830 5.048224 GCGACTACCTATGTTATTGCCTCTA 60.048 44.000 0.00 0.00 0.00 2.43
845 846 2.123338 TATTGGCTGGGGCATGGC 60.123 61.111 11.56 11.56 38.08 4.40
865 866 1.966451 GTCCTTGGCTGGTTCGTGG 60.966 63.158 0.00 0.00 0.00 4.94
882 883 2.597510 GCGCCCACCCTCAACTTT 60.598 61.111 0.00 0.00 0.00 2.66
883 884 2.200337 GCGCCCACCCTCAACTTTT 61.200 57.895 0.00 0.00 0.00 2.27
886 887 0.313987 GCCCACCCTCAACTTTTTCG 59.686 55.000 0.00 0.00 0.00 3.46
888 889 2.028876 CCCACCCTCAACTTTTTCGTT 58.971 47.619 0.00 0.00 0.00 3.85
899 900 3.154710 ACTTTTTCGTTCCCAAGATCCC 58.845 45.455 0.00 0.00 0.00 3.85
904 905 0.912486 CGTTCCCAAGATCCCTTCCT 59.088 55.000 0.00 0.00 0.00 3.36
906 907 1.064389 GTTCCCAAGATCCCTTCCTGG 60.064 57.143 0.00 0.00 35.92 4.45
909 910 0.182299 CCAAGATCCCTTCCTGGCTC 59.818 60.000 0.00 0.00 29.19 4.70
910 911 0.914644 CAAGATCCCTTCCTGGCTCA 59.085 55.000 0.00 0.00 0.00 4.26
912 913 1.148048 GATCCCTTCCTGGCTCAGC 59.852 63.158 0.00 0.00 0.00 4.26
914 915 1.633915 ATCCCTTCCTGGCTCAGCTG 61.634 60.000 7.63 7.63 0.00 4.24
918 919 3.596066 TTCCTGGCTCAGCTGCGAC 62.596 63.158 9.47 5.47 0.00 5.19
920 921 4.731612 CTGGCTCAGCTGCGACGT 62.732 66.667 9.47 0.00 0.00 4.34
924 925 2.807045 CTCAGCTGCGACGTGTCC 60.807 66.667 9.47 0.00 0.00 4.02
925 926 3.558099 CTCAGCTGCGACGTGTCCA 62.558 63.158 9.47 0.00 0.00 4.02
935 936 1.006102 ACGTGTCCAAGAAGCTCCG 60.006 57.895 0.00 0.00 0.00 4.63
938 939 1.535444 TGTCCAAGAAGCTCCGGGA 60.535 57.895 0.00 0.00 0.00 5.14
960 961 2.902523 CTGGAGATCCATATCATGCCG 58.097 52.381 1.15 0.00 46.46 5.69
964 965 1.209019 AGATCCATATCATGCCGGAGC 59.791 52.381 5.05 0.00 35.36 4.70
966 967 1.937191 TCCATATCATGCCGGAGCTA 58.063 50.000 5.05 0.00 40.80 3.32
972 973 1.035923 TCATGCCGGAGCTAGAGAAG 58.964 55.000 5.05 0.00 40.80 2.85
974 975 1.617850 CATGCCGGAGCTAGAGAAGAT 59.382 52.381 5.05 0.00 40.80 2.40
980 981 1.411977 GGAGCTAGAGAAGATGCTGCA 59.588 52.381 4.13 4.13 42.17 4.41
987 988 2.034687 AAGATGCTGCAGGCCGTT 59.965 55.556 17.12 0.00 40.92 4.44
988 989 1.589716 GAAGATGCTGCAGGCCGTTT 61.590 55.000 17.12 2.42 40.92 3.60
993 994 0.607762 TGCTGCAGGCCGTTTATCAA 60.608 50.000 17.12 0.00 40.92 2.57
1005 1006 5.279506 GGCCGTTTATCAAGAGAGGATGATA 60.280 44.000 0.00 0.00 37.46 2.15
1006 1007 6.223852 GCCGTTTATCAAGAGAGGATGATAA 58.776 40.000 4.56 4.56 43.29 1.75
1015 1016 6.777091 TCAAGAGAGGATGATAAAGAGAGGAG 59.223 42.308 0.00 0.00 0.00 3.69
1017 1018 7.107435 AGAGAGGATGATAAAGAGAGGAGAT 57.893 40.000 0.00 0.00 0.00 2.75
1018 1019 6.950041 AGAGAGGATGATAAAGAGAGGAGATG 59.050 42.308 0.00 0.00 0.00 2.90
1020 1021 6.950041 AGAGGATGATAAAGAGAGGAGATGAG 59.050 42.308 0.00 0.00 0.00 2.90
1021 1022 6.862225 AGGATGATAAAGAGAGGAGATGAGA 58.138 40.000 0.00 0.00 0.00 3.27
1022 1023 7.481297 AGGATGATAAAGAGAGGAGATGAGAT 58.519 38.462 0.00 0.00 0.00 2.75
1023 1024 7.398047 AGGATGATAAAGAGAGGAGATGAGATG 59.602 40.741 0.00 0.00 0.00 2.90
1025 1026 7.764141 TGATAAAGAGAGGAGATGAGATGAG 57.236 40.000 0.00 0.00 0.00 2.90
1026 1027 7.525165 TGATAAAGAGAGGAGATGAGATGAGA 58.475 38.462 0.00 0.00 0.00 3.27
1027 1028 8.003629 TGATAAAGAGAGGAGATGAGATGAGAA 58.996 37.037 0.00 0.00 0.00 2.87
1028 1029 6.720112 AAAGAGAGGAGATGAGATGAGAAG 57.280 41.667 0.00 0.00 0.00 2.85
1029 1030 4.733165 AGAGAGGAGATGAGATGAGAAGG 58.267 47.826 0.00 0.00 0.00 3.46
1030 1031 4.416513 AGAGAGGAGATGAGATGAGAAGGA 59.583 45.833 0.00 0.00 0.00 3.36
1031 1032 5.103558 AGAGAGGAGATGAGATGAGAAGGAA 60.104 44.000 0.00 0.00 0.00 3.36
1032 1033 5.527385 AGAGGAGATGAGATGAGAAGGAAA 58.473 41.667 0.00 0.00 0.00 3.13
1038 1039 4.392921 TGAGATGAGAAGGAAATCCGAC 57.607 45.455 0.00 0.00 42.08 4.79
1044 1045 1.693083 GAAGGAAATCCGACGTGGCG 61.693 60.000 0.00 0.00 42.08 5.69
1062 1063 2.825836 GCCCTGGACAAGATGGCG 60.826 66.667 0.00 0.00 31.55 5.69
1095 1096 3.849951 GCTCGGGAGGATGCGGAA 61.850 66.667 0.00 0.00 34.98 4.30
1104 1105 2.208431 GAGGATGCGGAAGACATCTTG 58.792 52.381 0.00 0.00 41.31 3.02
1111 1112 2.805099 GCGGAAGACATCTTGGATGATC 59.195 50.000 13.51 7.83 36.11 2.92
1112 1113 3.742327 GCGGAAGACATCTTGGATGATCA 60.742 47.826 13.51 0.00 36.11 2.92
1113 1114 3.806521 CGGAAGACATCTTGGATGATCAC 59.193 47.826 13.51 0.00 36.11 3.06
1116 1117 4.418973 AGACATCTTGGATGATCACCAG 57.581 45.455 13.51 10.25 38.70 4.00
1119 1120 3.118112 ACATCTTGGATGATCACCAGGAC 60.118 47.826 22.34 3.30 44.05 3.85
1121 1122 3.117745 TCTTGGATGATCACCAGGACAT 58.882 45.455 18.61 0.00 38.32 3.06
1122 1123 3.135348 TCTTGGATGATCACCAGGACATC 59.865 47.826 18.61 0.00 38.32 3.06
1123 1124 1.413812 TGGATGATCACCAGGACATCG 59.586 52.381 11.56 0.00 39.66 3.84
1124 1125 1.688735 GGATGATCACCAGGACATCGA 59.311 52.381 0.00 0.00 39.66 3.59
1125 1126 2.288702 GGATGATCACCAGGACATCGAG 60.289 54.545 0.00 0.00 39.66 4.04
1127 1128 2.179427 TGATCACCAGGACATCGAGTT 58.821 47.619 0.00 0.00 0.00 3.01
1128 1129 2.094026 TGATCACCAGGACATCGAGTTG 60.094 50.000 0.00 0.00 0.00 3.16
1129 1130 1.338107 TCACCAGGACATCGAGTTGT 58.662 50.000 0.00 0.00 0.00 3.32
1130 1131 2.521126 TCACCAGGACATCGAGTTGTA 58.479 47.619 0.00 0.00 0.00 2.41
1132 1133 1.549170 ACCAGGACATCGAGTTGTACC 59.451 52.381 0.00 0.00 30.11 3.34
1134 1135 0.172803 AGGACATCGAGTTGTACCGC 59.827 55.000 0.00 0.00 30.11 5.68
1135 1136 0.172803 GGACATCGAGTTGTACCGCT 59.827 55.000 0.00 0.00 0.00 5.52
1136 1137 1.403780 GGACATCGAGTTGTACCGCTT 60.404 52.381 0.00 0.00 0.00 4.68
1138 1139 1.271379 ACATCGAGTTGTACCGCTTCA 59.729 47.619 0.00 0.00 0.00 3.02
1139 1140 1.920574 CATCGAGTTGTACCGCTTCAG 59.079 52.381 0.00 0.00 0.00 3.02
1140 1141 1.241165 TCGAGTTGTACCGCTTCAGA 58.759 50.000 0.00 0.00 0.00 3.27
1141 1142 1.816835 TCGAGTTGTACCGCTTCAGAT 59.183 47.619 0.00 0.00 0.00 2.90
1143 1144 2.993899 CGAGTTGTACCGCTTCAGATTT 59.006 45.455 0.00 0.00 0.00 2.17
1144 1145 3.432252 CGAGTTGTACCGCTTCAGATTTT 59.568 43.478 0.00 0.00 0.00 1.82
1145 1146 4.666655 CGAGTTGTACCGCTTCAGATTTTG 60.667 45.833 0.00 0.00 0.00 2.44
1146 1147 3.502211 AGTTGTACCGCTTCAGATTTTGG 59.498 43.478 0.00 0.00 0.00 3.28
1147 1148 1.810151 TGTACCGCTTCAGATTTTGGC 59.190 47.619 0.00 0.00 0.00 4.52
1149 1150 0.889186 ACCGCTTCAGATTTTGGCGT 60.889 50.000 0.00 0.00 43.57 5.68
1150 1151 0.179189 CCGCTTCAGATTTTGGCGTC 60.179 55.000 0.00 0.00 43.57 5.19
1151 1152 0.519175 CGCTTCAGATTTTGGCGTCG 60.519 55.000 0.00 0.00 40.78 5.12
1152 1153 0.517316 GCTTCAGATTTTGGCGTCGT 59.483 50.000 0.00 0.00 0.00 4.34
1153 1154 1.464189 GCTTCAGATTTTGGCGTCGTC 60.464 52.381 0.00 0.00 0.00 4.20
1155 1156 1.710013 TCAGATTTTGGCGTCGTCTC 58.290 50.000 0.00 0.00 0.00 3.36
1156 1157 1.272490 TCAGATTTTGGCGTCGTCTCT 59.728 47.619 0.00 0.00 0.00 3.10
1157 1158 1.391485 CAGATTTTGGCGTCGTCTCTG 59.609 52.381 0.00 0.00 0.00 3.35
1158 1159 0.095417 GATTTTGGCGTCGTCTCTGC 59.905 55.000 0.00 0.00 0.00 4.26
1162 1163 3.749064 GGCGTCGTCTCTGCCTCA 61.749 66.667 0.00 0.00 45.40 3.86
1164 1165 1.725557 GGCGTCGTCTCTGCCTCATA 61.726 60.000 0.00 0.00 45.40 2.15
1165 1166 0.317436 GCGTCGTCTCTGCCTCATAG 60.317 60.000 0.00 0.00 0.00 2.23
1167 1168 1.268285 CGTCGTCTCTGCCTCATAGTG 60.268 57.143 0.00 0.00 0.00 2.74
1168 1169 0.741326 TCGTCTCTGCCTCATAGTGC 59.259 55.000 0.00 0.00 0.00 4.40
1174 1175 3.441244 TGCCTCATAGTGCAGAACG 57.559 52.632 0.00 0.00 32.77 3.95
1175 1176 0.894835 TGCCTCATAGTGCAGAACGA 59.105 50.000 0.00 0.00 32.77 3.85
1176 1177 1.281899 GCCTCATAGTGCAGAACGAC 58.718 55.000 0.00 0.00 0.00 4.34
1177 1178 1.404181 GCCTCATAGTGCAGAACGACA 60.404 52.381 0.00 0.00 0.00 4.35
1178 1179 2.739932 GCCTCATAGTGCAGAACGACAT 60.740 50.000 0.00 0.00 0.00 3.06
1179 1180 3.525537 CCTCATAGTGCAGAACGACATT 58.474 45.455 0.00 0.00 0.00 2.71
1180 1181 3.308053 CCTCATAGTGCAGAACGACATTG 59.692 47.826 0.00 0.00 0.00 2.82
1181 1182 4.176271 CTCATAGTGCAGAACGACATTGA 58.824 43.478 0.00 0.00 0.00 2.57
1182 1183 3.926527 TCATAGTGCAGAACGACATTGAC 59.073 43.478 0.00 0.00 0.00 3.18
1183 1184 1.512926 AGTGCAGAACGACATTGACC 58.487 50.000 0.00 0.00 0.00 4.02
1184 1185 0.163788 GTGCAGAACGACATTGACCG 59.836 55.000 0.00 0.00 0.00 4.79
1185 1186 1.132640 GCAGAACGACATTGACCGC 59.867 57.895 0.00 0.00 0.00 5.68
1186 1187 1.291877 GCAGAACGACATTGACCGCT 61.292 55.000 0.00 0.00 0.00 5.52
1187 1188 1.148310 CAGAACGACATTGACCGCTT 58.852 50.000 0.00 0.00 0.00 4.68
1188 1189 1.126846 CAGAACGACATTGACCGCTTC 59.873 52.381 0.00 1.83 0.00 3.86
1189 1190 1.144969 GAACGACATTGACCGCTTCA 58.855 50.000 0.00 0.00 0.00 3.02
1197 1198 2.024176 TTGACCGCTTCAATAGGAGC 57.976 50.000 0.00 0.00 39.45 4.70
1198 1199 1.195115 TGACCGCTTCAATAGGAGCT 58.805 50.000 0.00 0.00 0.00 4.09
1199 1200 1.134699 TGACCGCTTCAATAGGAGCTG 60.135 52.381 0.00 0.00 0.00 4.24
1200 1201 0.905357 ACCGCTTCAATAGGAGCTGT 59.095 50.000 0.00 0.00 0.00 4.40
1201 1202 1.134670 ACCGCTTCAATAGGAGCTGTC 60.135 52.381 0.00 0.00 0.00 3.51
1202 1203 1.137872 CCGCTTCAATAGGAGCTGTCT 59.862 52.381 0.00 0.00 0.00 3.41
1203 1204 2.200067 CGCTTCAATAGGAGCTGTCTG 58.800 52.381 0.00 0.00 0.00 3.51
1204 1205 2.559440 GCTTCAATAGGAGCTGTCTGG 58.441 52.381 0.00 0.00 0.00 3.86
1205 1206 2.093235 GCTTCAATAGGAGCTGTCTGGT 60.093 50.000 0.00 0.00 0.00 4.00
1219 1220 1.061411 CTGGTGATTGCACGCATCG 59.939 57.895 0.00 0.00 46.09 3.84
1221 1222 1.060937 GGTGATTGCACGCATCGTC 59.939 57.895 0.00 0.00 46.09 4.20
1241 1242 2.210711 GGAGGGGATCGGCTCGATT 61.211 63.158 10.72 0.00 47.00 3.34
1242 1243 1.290639 GAGGGGATCGGCTCGATTC 59.709 63.158 10.72 8.93 47.00 2.52
1243 1244 1.457643 AGGGGATCGGCTCGATTCA 60.458 57.895 15.07 0.00 47.00 2.57
1244 1245 1.048724 AGGGGATCGGCTCGATTCAA 61.049 55.000 15.07 0.00 47.00 2.69
1245 1246 0.880718 GGGGATCGGCTCGATTCAAC 60.881 60.000 15.07 6.26 47.00 3.18
1246 1247 0.880718 GGGATCGGCTCGATTCAACC 60.881 60.000 15.07 9.94 47.00 3.77
1247 1248 1.215655 GGATCGGCTCGATTCAACCG 61.216 60.000 10.72 0.00 47.00 4.44
1248 1249 1.215655 GATCGGCTCGATTCAACCGG 61.216 60.000 0.00 0.00 47.00 5.28
1249 1250 1.672854 ATCGGCTCGATTCAACCGGA 61.673 55.000 9.46 0.00 44.59 5.14
1250 1251 1.878522 CGGCTCGATTCAACCGGAG 60.879 63.158 9.46 0.00 41.95 4.63
1251 1252 1.218316 GGCTCGATTCAACCGGAGT 59.782 57.895 9.46 0.00 0.00 3.85
1252 1253 0.458669 GGCTCGATTCAACCGGAGTA 59.541 55.000 9.46 0.00 0.00 2.59
1253 1254 1.068741 GGCTCGATTCAACCGGAGTAT 59.931 52.381 9.46 0.00 0.00 2.12
1254 1255 2.395654 GCTCGATTCAACCGGAGTATC 58.604 52.381 9.46 8.28 0.00 2.24
1255 1256 2.651701 CTCGATTCAACCGGAGTATCG 58.348 52.381 23.49 23.49 37.51 2.92
1256 1257 1.129326 CGATTCAACCGGAGTATCGC 58.871 55.000 20.24 1.67 31.66 4.58
1257 1258 1.535226 CGATTCAACCGGAGTATCGCA 60.535 52.381 20.24 0.00 31.66 5.10
1258 1259 1.859080 GATTCAACCGGAGTATCGCAC 59.141 52.381 9.46 0.00 34.37 5.34
1259 1260 0.108520 TTCAACCGGAGTATCGCACC 60.109 55.000 9.46 0.00 34.37 5.01
1260 1261 1.520787 CAACCGGAGTATCGCACCC 60.521 63.158 9.46 0.00 34.37 4.61
1261 1262 1.985662 AACCGGAGTATCGCACCCA 60.986 57.895 9.46 0.00 34.37 4.51
1262 1263 1.335132 AACCGGAGTATCGCACCCAT 61.335 55.000 9.46 0.00 34.37 4.00
1263 1264 1.006102 CCGGAGTATCGCACCCATC 60.006 63.158 0.00 0.00 34.37 3.51
1264 1265 1.739667 CGGAGTATCGCACCCATCA 59.260 57.895 0.00 0.00 34.37 3.07
1265 1266 0.318441 CGGAGTATCGCACCCATCAT 59.682 55.000 0.00 0.00 34.37 2.45
1266 1267 1.670087 CGGAGTATCGCACCCATCATC 60.670 57.143 0.00 0.00 34.37 2.92
1267 1268 1.338200 GGAGTATCGCACCCATCATCC 60.338 57.143 0.00 0.00 34.37 3.51
1268 1269 0.318441 AGTATCGCACCCATCATCCG 59.682 55.000 0.00 0.00 0.00 4.18
1269 1270 0.670546 GTATCGCACCCATCATCCGG 60.671 60.000 0.00 0.00 0.00 5.14
1270 1271 0.830023 TATCGCACCCATCATCCGGA 60.830 55.000 6.61 6.61 0.00 5.14
1271 1272 2.104572 ATCGCACCCATCATCCGGAG 62.105 60.000 11.34 2.05 0.00 4.63
1272 1273 2.796193 CGCACCCATCATCCGGAGA 61.796 63.158 11.34 8.24 0.00 3.71
1273 1274 1.526887 GCACCCATCATCCGGAGAA 59.473 57.895 11.34 0.00 0.00 2.87
1274 1275 0.107214 GCACCCATCATCCGGAGAAA 60.107 55.000 11.34 0.00 0.00 2.52
1275 1276 1.477558 GCACCCATCATCCGGAGAAAT 60.478 52.381 11.34 0.00 0.00 2.17
1276 1277 2.224606 CACCCATCATCCGGAGAAATG 58.775 52.381 11.34 12.91 0.00 2.32
1277 1278 1.242076 CCCATCATCCGGAGAAATGC 58.758 55.000 11.34 0.00 0.00 3.56
1278 1279 1.477377 CCCATCATCCGGAGAAATGCA 60.477 52.381 11.34 0.00 0.00 3.96
1279 1280 2.511659 CCATCATCCGGAGAAATGCAT 58.488 47.619 11.34 0.00 0.00 3.96
1280 1281 2.889045 CCATCATCCGGAGAAATGCATT 59.111 45.455 11.34 5.99 0.00 3.56
1281 1282 3.057736 CCATCATCCGGAGAAATGCATTC 60.058 47.826 13.38 6.58 38.39 2.67
1282 1283 3.280197 TCATCCGGAGAAATGCATTCA 57.720 42.857 13.38 0.00 40.72 2.57
1283 1284 3.824133 TCATCCGGAGAAATGCATTCAT 58.176 40.909 13.38 4.07 40.72 2.57
1284 1285 3.817084 TCATCCGGAGAAATGCATTCATC 59.183 43.478 13.38 13.16 40.72 2.92
1285 1286 3.280197 TCCGGAGAAATGCATTCATCA 57.720 42.857 13.38 0.00 40.72 3.07
1286 1287 3.824133 TCCGGAGAAATGCATTCATCAT 58.176 40.909 13.38 0.00 40.72 2.45
1287 1288 3.817084 TCCGGAGAAATGCATTCATCATC 59.183 43.478 13.38 6.17 40.72 2.92
1288 1289 3.566742 CCGGAGAAATGCATTCATCATCA 59.433 43.478 13.38 0.00 40.72 3.07
1289 1290 4.320275 CCGGAGAAATGCATTCATCATCAG 60.320 45.833 13.38 7.29 40.72 2.90
1290 1291 4.320275 CGGAGAAATGCATTCATCATCAGG 60.320 45.833 13.38 0.00 40.72 3.86
1291 1292 4.825634 GGAGAAATGCATTCATCATCAGGA 59.174 41.667 13.38 0.00 40.72 3.86
1292 1293 5.048643 GGAGAAATGCATTCATCATCAGGAG 60.049 44.000 13.38 0.00 40.72 3.69
1293 1294 5.691896 AGAAATGCATTCATCATCAGGAGA 58.308 37.500 13.38 0.00 40.72 3.71
1294 1295 6.127101 AGAAATGCATTCATCATCAGGAGAA 58.873 36.000 13.38 0.00 40.72 2.87
1295 1296 6.605995 AGAAATGCATTCATCATCAGGAGAAA 59.394 34.615 13.38 0.00 40.72 2.52
1296 1297 6.785337 AATGCATTCATCATCAGGAGAAAA 57.215 33.333 5.99 0.00 31.27 2.29
1297 1298 6.978674 ATGCATTCATCATCAGGAGAAAAT 57.021 33.333 0.00 0.00 0.00 1.82
1298 1299 6.387041 TGCATTCATCATCAGGAGAAAATC 57.613 37.500 0.00 0.00 0.00 2.17
1299 1300 5.889289 TGCATTCATCATCAGGAGAAAATCA 59.111 36.000 0.00 0.00 0.00 2.57
1300 1301 6.039382 TGCATTCATCATCAGGAGAAAATCAG 59.961 38.462 0.00 0.00 0.00 2.90
1301 1302 6.262496 GCATTCATCATCAGGAGAAAATCAGA 59.738 38.462 0.00 0.00 0.00 3.27
1302 1303 7.520776 GCATTCATCATCAGGAGAAAATCAGAG 60.521 40.741 0.00 0.00 0.00 3.35
1303 1304 5.926663 TCATCATCAGGAGAAAATCAGAGG 58.073 41.667 0.00 0.00 0.00 3.69
1304 1305 5.664457 TCATCATCAGGAGAAAATCAGAGGA 59.336 40.000 0.00 0.00 31.71 3.71
1305 1306 6.329460 TCATCATCAGGAGAAAATCAGAGGAT 59.671 38.462 0.00 0.00 36.23 3.24
1306 1307 5.926663 TCATCAGGAGAAAATCAGAGGATG 58.073 41.667 0.00 0.00 32.92 3.51
1307 1308 5.427806 TCATCAGGAGAAAATCAGAGGATGT 59.572 40.000 0.00 0.00 32.92 3.06
1308 1309 6.612863 TCATCAGGAGAAAATCAGAGGATGTA 59.387 38.462 0.00 0.00 32.92 2.29
1309 1310 6.227298 TCAGGAGAAAATCAGAGGATGTAC 57.773 41.667 0.00 0.00 32.92 2.90
1310 1311 5.960811 TCAGGAGAAAATCAGAGGATGTACT 59.039 40.000 0.00 0.00 32.92 2.73
1311 1312 6.441924 TCAGGAGAAAATCAGAGGATGTACTT 59.558 38.462 0.00 0.00 32.92 2.24
1312 1313 6.760770 CAGGAGAAAATCAGAGGATGTACTTC 59.239 42.308 0.10 0.10 32.92 3.01
1313 1314 6.441924 AGGAGAAAATCAGAGGATGTACTTCA 59.558 38.462 10.60 0.00 32.92 3.02
1314 1315 6.536941 GGAGAAAATCAGAGGATGTACTTCAC 59.463 42.308 10.60 4.57 32.92 3.18
1315 1316 6.102663 AGAAAATCAGAGGATGTACTTCACG 58.897 40.000 10.60 0.00 32.92 4.35
1316 1317 5.407407 AAATCAGAGGATGTACTTCACGT 57.593 39.130 10.60 0.00 32.92 4.49
1317 1318 3.850122 TCAGAGGATGTACTTCACGTG 57.150 47.619 9.94 9.94 0.00 4.49
1318 1319 2.492088 TCAGAGGATGTACTTCACGTGG 59.508 50.000 17.00 2.57 0.00 4.94
1319 1320 1.204941 AGAGGATGTACTTCACGTGGC 59.795 52.381 17.00 2.13 0.00 5.01
1320 1321 1.204941 GAGGATGTACTTCACGTGGCT 59.795 52.381 17.00 0.56 0.00 4.75
1321 1322 1.066858 AGGATGTACTTCACGTGGCTG 60.067 52.381 17.00 8.65 0.00 4.85
1322 1323 0.721718 GATGTACTTCACGTGGCTGC 59.278 55.000 17.00 2.58 0.00 5.25
1323 1324 0.673644 ATGTACTTCACGTGGCTGCC 60.674 55.000 17.00 12.87 0.00 4.85
1324 1325 1.301401 GTACTTCACGTGGCTGCCA 60.301 57.895 19.30 19.30 0.00 4.92
1325 1326 1.005037 TACTTCACGTGGCTGCCAG 60.005 57.895 24.10 18.00 32.34 4.85
1326 1327 1.754380 TACTTCACGTGGCTGCCAGT 61.754 55.000 24.10 18.66 32.34 4.00
1327 1328 2.591429 TTCACGTGGCTGCCAGTG 60.591 61.111 29.45 29.45 35.52 3.66
1332 1333 3.667282 GTGGCTGCCAGTGCTGTG 61.667 66.667 24.10 0.00 38.57 3.66
1333 1334 4.960866 TGGCTGCCAGTGCTGTGG 62.961 66.667 19.30 0.78 41.01 4.17
1339 1340 4.275508 CCAGTGCTGTGGCCACCT 62.276 66.667 32.62 19.35 37.74 4.00
1340 1341 2.981909 CAGTGCTGTGGCCACCTG 60.982 66.667 32.62 25.99 37.74 4.00
1341 1342 4.962836 AGTGCTGTGGCCACCTGC 62.963 66.667 31.67 31.67 37.74 4.85
1343 1344 4.289101 TGCTGTGGCCACCTGCAT 62.289 61.111 34.96 0.00 43.89 3.96
1344 1345 2.993264 GCTGTGGCCACCTGCATT 60.993 61.111 32.66 0.00 43.89 3.56
1345 1346 1.678635 GCTGTGGCCACCTGCATTA 60.679 57.895 32.66 15.74 43.89 1.90
1346 1347 1.937546 GCTGTGGCCACCTGCATTAC 61.938 60.000 32.66 13.57 43.89 1.89
1347 1348 0.322816 CTGTGGCCACCTGCATTACT 60.323 55.000 32.62 0.00 43.89 2.24
1348 1349 0.322456 TGTGGCCACCTGCATTACTC 60.322 55.000 32.62 3.85 43.89 2.59
1349 1350 0.322456 GTGGCCACCTGCATTACTCA 60.322 55.000 26.31 0.00 43.89 3.41
1350 1351 0.322456 TGGCCACCTGCATTACTCAC 60.322 55.000 0.00 0.00 43.89 3.51
1351 1352 0.035056 GGCCACCTGCATTACTCACT 60.035 55.000 0.00 0.00 43.89 3.41
1352 1353 1.614317 GGCCACCTGCATTACTCACTT 60.614 52.381 0.00 0.00 43.89 3.16
1353 1354 1.740025 GCCACCTGCATTACTCACTTC 59.260 52.381 0.00 0.00 40.77 3.01
1354 1355 2.875672 GCCACCTGCATTACTCACTTCA 60.876 50.000 0.00 0.00 40.77 3.02
1355 1356 3.411446 CCACCTGCATTACTCACTTCAA 58.589 45.455 0.00 0.00 0.00 2.69
1356 1357 3.189287 CCACCTGCATTACTCACTTCAAC 59.811 47.826 0.00 0.00 0.00 3.18
1357 1358 3.814842 CACCTGCATTACTCACTTCAACA 59.185 43.478 0.00 0.00 0.00 3.33
1358 1359 4.275689 CACCTGCATTACTCACTTCAACAA 59.724 41.667 0.00 0.00 0.00 2.83
1359 1360 4.516698 ACCTGCATTACTCACTTCAACAAG 59.483 41.667 0.00 0.00 35.50 3.16
1360 1361 4.756642 CCTGCATTACTCACTTCAACAAGA 59.243 41.667 0.00 0.00 33.34 3.02
1361 1362 5.106791 CCTGCATTACTCACTTCAACAAGAG 60.107 44.000 0.00 0.00 33.34 2.85
1362 1363 4.214119 TGCATTACTCACTTCAACAAGAGC 59.786 41.667 0.00 0.00 33.34 4.09
1363 1364 4.453819 GCATTACTCACTTCAACAAGAGCT 59.546 41.667 0.00 0.00 33.34 4.09
1364 1365 5.049129 GCATTACTCACTTCAACAAGAGCTT 60.049 40.000 0.00 0.00 33.34 3.74
1365 1366 6.597614 CATTACTCACTTCAACAAGAGCTTC 58.402 40.000 0.00 0.00 33.34 3.86
1366 1367 4.142609 ACTCACTTCAACAAGAGCTTCA 57.857 40.909 0.00 0.00 33.34 3.02
1367 1368 4.125703 ACTCACTTCAACAAGAGCTTCAG 58.874 43.478 0.00 0.00 33.34 3.02
1368 1369 3.470709 TCACTTCAACAAGAGCTTCAGG 58.529 45.455 0.00 0.00 33.34 3.86
1369 1370 3.134623 TCACTTCAACAAGAGCTTCAGGA 59.865 43.478 0.00 0.00 33.34 3.86
1370 1371 3.497640 CACTTCAACAAGAGCTTCAGGAG 59.502 47.826 0.00 0.00 33.34 3.69
1371 1372 4.054235 ACTTCAACAAGAGCTTCAGGAGC 61.054 47.826 0.00 0.00 41.29 4.70
1378 1379 4.434685 GCTTCAGGAGCGGATCAG 57.565 61.111 0.00 0.00 42.46 2.90
1379 1380 1.886777 GCTTCAGGAGCGGATCAGC 60.887 63.158 10.10 10.10 42.46 4.26
1387 1388 2.355244 GCGGATCAGCTCGGCTAC 60.355 66.667 10.86 0.00 44.48 3.58
1391 1392 1.659954 GATCAGCTCGGCTACTGCG 60.660 63.158 0.00 0.00 36.40 5.18
1416 1417 1.361668 CGCGGAACATCTCCTTGTGG 61.362 60.000 0.00 0.00 42.85 4.17
1417 1418 0.036388 GCGGAACATCTCCTTGTGGA 60.036 55.000 0.00 0.00 42.85 4.02
1428 1429 0.622665 CCTTGTGGAGGCAAGAGGAT 59.377 55.000 7.32 0.00 46.34 3.24
1429 1430 1.681166 CCTTGTGGAGGCAAGAGGATG 60.681 57.143 7.32 0.00 46.34 3.51
1430 1431 1.004044 CTTGTGGAGGCAAGAGGATGT 59.996 52.381 0.00 0.00 46.34 3.06
1431 1432 1.951209 TGTGGAGGCAAGAGGATGTA 58.049 50.000 0.00 0.00 0.00 2.29
1432 1433 1.555075 TGTGGAGGCAAGAGGATGTAC 59.445 52.381 0.00 0.00 0.00 2.90
1436 1437 1.414550 GAGGCAAGAGGATGTACTCCC 59.585 57.143 7.50 2.60 46.27 4.30
1437 1438 1.008938 AGGCAAGAGGATGTACTCCCT 59.991 52.381 6.36 6.36 46.27 4.20
1438 1439 1.414550 GGCAAGAGGATGTACTCCCTC 59.585 57.143 19.84 19.84 46.27 4.30
1441 1442 3.823369 GAGGATGTACTCCCTCGGA 57.177 57.895 15.12 0.00 46.27 4.55
1442 1443 1.320507 GAGGATGTACTCCCTCGGAC 58.679 60.000 15.12 0.00 46.27 4.79
1443 1444 0.629596 AGGATGTACTCCCTCGGACA 59.370 55.000 7.50 0.00 46.27 4.02
1444 1445 1.006758 AGGATGTACTCCCTCGGACAA 59.993 52.381 7.50 0.00 46.27 3.18
1445 1446 1.136500 GGATGTACTCCCTCGGACAAC 59.864 57.143 0.00 0.00 38.19 3.32
1446 1447 1.136500 GATGTACTCCCTCGGACAACC 59.864 57.143 0.00 0.00 0.00 3.77
1447 1448 0.178955 TGTACTCCCTCGGACAACCA 60.179 55.000 0.00 0.00 35.59 3.67
1449 1450 1.553704 GTACTCCCTCGGACAACCAAT 59.446 52.381 0.00 0.00 35.59 3.16
1450 1451 1.946984 ACTCCCTCGGACAACCAATA 58.053 50.000 0.00 0.00 35.59 1.90
1451 1452 1.553704 ACTCCCTCGGACAACCAATAC 59.446 52.381 0.00 0.00 35.59 1.89
1458 1463 1.136085 CGGACAACCAATACTGTTGCG 60.136 52.381 3.23 0.00 45.42 4.85
1459 1464 1.401018 GGACAACCAATACTGTTGCGC 60.401 52.381 0.00 0.00 45.42 6.09
1464 1469 1.376609 CCAATACTGTTGCGCCCTCC 61.377 60.000 4.18 0.00 0.00 4.30
1465 1470 1.077716 AATACTGTTGCGCCCTCCC 60.078 57.895 4.18 0.00 0.00 4.30
1471 1476 3.008517 TTGCGCCCTCCCATGAGA 61.009 61.111 4.18 0.00 41.42 3.27
1475 1480 3.083997 GCCCTCCCATGAGACCGT 61.084 66.667 0.00 0.00 41.42 4.83
1476 1481 2.903357 CCCTCCCATGAGACCGTG 59.097 66.667 0.00 0.00 41.42 4.94
1478 1483 2.187946 CTCCCATGAGACCGTGCC 59.812 66.667 0.00 0.00 41.42 5.01
1479 1484 2.606213 TCCCATGAGACCGTGCCA 60.606 61.111 0.00 0.00 0.00 4.92
1484 1489 0.107993 CATGAGACCGTGCCAGTGAT 60.108 55.000 0.00 0.00 0.00 3.06
1487 1492 1.067142 TGAGACCGTGCCAGTGATTAC 60.067 52.381 0.00 0.00 0.00 1.89
1488 1493 0.249398 AGACCGTGCCAGTGATTACC 59.751 55.000 0.00 0.00 0.00 2.85
1490 1495 0.036388 ACCGTGCCAGTGATTACCAG 60.036 55.000 0.00 0.00 0.00 4.00
1492 1497 1.610624 CCGTGCCAGTGATTACCAGTT 60.611 52.381 0.00 0.00 0.00 3.16
1493 1498 1.732259 CGTGCCAGTGATTACCAGTTC 59.268 52.381 0.00 0.00 0.00 3.01
1496 1501 2.371841 TGCCAGTGATTACCAGTTCTGT 59.628 45.455 0.00 0.00 0.00 3.41
1500 1505 2.084546 GTGATTACCAGTTCTGTGGCC 58.915 52.381 0.00 0.00 41.90 5.36
1501 1506 1.985159 TGATTACCAGTTCTGTGGCCT 59.015 47.619 3.32 0.00 41.90 5.19
1503 1508 0.320374 TTACCAGTTCTGTGGCCTCG 59.680 55.000 3.32 0.00 41.90 4.63
1504 1509 1.541310 TACCAGTTCTGTGGCCTCGG 61.541 60.000 3.32 5.62 41.90 4.63
1505 1510 2.583441 CCAGTTCTGTGGCCTCGGA 61.583 63.158 12.37 12.37 0.00 4.55
1506 1511 1.599047 CAGTTCTGTGGCCTCGGAT 59.401 57.895 16.84 0.47 0.00 4.18
1509 1514 1.612146 TTCTGTGGCCTCGGATGGA 60.612 57.895 16.84 0.00 0.00 3.41
1510 1515 1.899437 TTCTGTGGCCTCGGATGGAC 61.899 60.000 16.84 0.00 35.14 4.02
1511 1516 3.391665 CTGTGGCCTCGGATGGACC 62.392 68.421 7.96 0.00 33.07 4.46
1512 1517 3.399181 GTGGCCTCGGATGGACCA 61.399 66.667 3.32 0.00 38.90 4.02
1518 1529 1.522569 CTCGGATGGACCAGTTCCC 59.477 63.158 8.31 2.47 45.17 3.97
1519 1530 1.972660 CTCGGATGGACCAGTTCCCC 61.973 65.000 8.31 0.24 45.17 4.81
1521 1532 1.562672 CGGATGGACCAGTTCCCCTT 61.563 60.000 8.31 0.00 45.17 3.95
1532 1543 2.904434 CAGTTCCCCTTACTACCAGTGT 59.096 50.000 0.00 0.00 0.00 3.55
1536 1547 1.674817 CCCCTTACTACCAGTGTTGCG 60.675 57.143 0.00 0.00 0.00 4.85
1542 1553 3.248446 TACCAGTGTTGCGGCCTCC 62.248 63.158 0.00 0.00 0.00 4.30
1545 1556 3.650950 AGTGTTGCGGCCTCCCAT 61.651 61.111 0.00 0.00 0.00 4.00
1547 1558 4.738998 TGTTGCGGCCTCCCATGG 62.739 66.667 4.14 4.14 0.00 3.66
1554 1565 3.728373 GCCTCCCATGGACCGGTT 61.728 66.667 15.22 0.00 0.00 4.44
1555 1566 2.590092 CCTCCCATGGACCGGTTC 59.410 66.667 15.22 7.49 0.00 3.62
1556 1567 1.995626 CCTCCCATGGACCGGTTCT 60.996 63.158 15.59 0.00 0.00 3.01
1557 1568 1.221840 CTCCCATGGACCGGTTCTG 59.778 63.158 15.59 9.74 0.00 3.02
1558 1569 2.257409 CTCCCATGGACCGGTTCTGG 62.257 65.000 15.59 17.89 0.00 3.86
1559 1570 2.438434 CCATGGACCGGTTCTGGC 60.438 66.667 15.59 0.00 0.00 4.85
1560 1571 2.819595 CATGGACCGGTTCTGGCG 60.820 66.667 15.59 0.00 0.00 5.69
1561 1572 4.096003 ATGGACCGGTTCTGGCGG 62.096 66.667 15.59 0.00 0.00 6.13
1564 1575 3.766691 GACCGGTTCTGGCGGCTA 61.767 66.667 9.42 0.00 0.00 3.93
1565 1576 4.078516 ACCGGTTCTGGCGGCTAC 62.079 66.667 11.43 5.72 0.00 3.58
1566 1577 4.077184 CCGGTTCTGGCGGCTACA 62.077 66.667 11.43 0.00 0.00 2.74
1567 1578 2.047655 CGGTTCTGGCGGCTACAA 60.048 61.111 11.43 0.00 0.00 2.41
1568 1579 1.669760 CGGTTCTGGCGGCTACAAA 60.670 57.895 11.43 0.00 0.00 2.83
1569 1580 1.024579 CGGTTCTGGCGGCTACAAAT 61.025 55.000 11.43 0.00 0.00 2.32
1570 1581 0.451783 GGTTCTGGCGGCTACAAATG 59.548 55.000 11.43 0.00 0.00 2.32
1571 1582 1.448985 GTTCTGGCGGCTACAAATGA 58.551 50.000 11.43 0.00 0.00 2.57
1572 1583 2.017049 GTTCTGGCGGCTACAAATGAT 58.983 47.619 11.43 0.00 0.00 2.45
1573 1584 1.667236 TCTGGCGGCTACAAATGATG 58.333 50.000 11.43 0.00 0.00 3.07
1574 1585 1.065491 TCTGGCGGCTACAAATGATGT 60.065 47.619 11.43 0.00 46.36 3.06
1575 1586 1.331756 CTGGCGGCTACAAATGATGTC 59.668 52.381 11.43 0.00 42.70 3.06
1576 1587 0.663153 GGCGGCTACAAATGATGTCC 59.337 55.000 0.00 0.00 42.70 4.02
1577 1588 0.663153 GCGGCTACAAATGATGTCCC 59.337 55.000 0.00 0.00 42.70 4.46
1578 1589 1.308998 CGGCTACAAATGATGTCCCC 58.691 55.000 0.00 0.00 42.70 4.81
1579 1590 1.134098 CGGCTACAAATGATGTCCCCT 60.134 52.381 0.00 0.00 42.70 4.79
1580 1591 2.576615 GGCTACAAATGATGTCCCCTC 58.423 52.381 0.00 0.00 42.70 4.30
1581 1592 2.092429 GGCTACAAATGATGTCCCCTCA 60.092 50.000 0.00 0.00 42.70 3.86
1582 1593 3.209410 GCTACAAATGATGTCCCCTCAG 58.791 50.000 0.00 0.00 42.70 3.35
1583 1594 3.118261 GCTACAAATGATGTCCCCTCAGA 60.118 47.826 0.00 0.00 42.70 3.27
1584 1595 3.356529 ACAAATGATGTCCCCTCAGAC 57.643 47.619 0.00 0.00 37.96 3.51
1585 1596 2.283298 CAAATGATGTCCCCTCAGACG 58.717 52.381 0.00 0.00 39.77 4.18
1586 1597 1.866015 AATGATGTCCCCTCAGACGA 58.134 50.000 0.00 0.00 39.77 4.20
1587 1598 1.115467 ATGATGTCCCCTCAGACGAC 58.885 55.000 0.00 0.00 39.77 4.34
1588 1599 0.970937 TGATGTCCCCTCAGACGACC 60.971 60.000 0.00 0.00 39.77 4.79
1589 1600 1.677637 GATGTCCCCTCAGACGACCC 61.678 65.000 0.00 0.00 39.77 4.46
1590 1601 2.037527 GTCCCCTCAGACGACCCT 59.962 66.667 0.00 0.00 0.00 4.34
1591 1602 2.037367 TCCCCTCAGACGACCCTG 59.963 66.667 0.00 0.00 35.55 4.45
1592 1603 2.283966 CCCCTCAGACGACCCTGT 60.284 66.667 0.00 0.00 35.71 4.00
1593 1604 2.352032 CCCCTCAGACGACCCTGTC 61.352 68.421 0.00 0.00 39.21 3.51
1594 1605 2.352032 CCCTCAGACGACCCTGTCC 61.352 68.421 0.00 0.00 39.77 4.02
1595 1606 2.352032 CCTCAGACGACCCTGTCCC 61.352 68.421 0.00 0.00 39.77 4.46
1596 1607 2.675423 TCAGACGACCCTGTCCCG 60.675 66.667 0.00 0.00 39.77 5.14
1597 1608 4.436998 CAGACGACCCTGTCCCGC 62.437 72.222 0.00 0.00 39.77 6.13
1598 1609 4.988716 AGACGACCCTGTCCCGCA 62.989 66.667 0.00 0.00 39.77 5.69
1599 1610 3.771160 GACGACCCTGTCCCGCAT 61.771 66.667 0.00 0.00 32.61 4.73
1600 1611 2.363276 ACGACCCTGTCCCGCATA 60.363 61.111 0.00 0.00 0.00 3.14
1601 1612 1.952102 GACGACCCTGTCCCGCATAA 61.952 60.000 0.00 0.00 32.61 1.90
1602 1613 1.520787 CGACCCTGTCCCGCATAAC 60.521 63.158 0.00 0.00 0.00 1.89
1603 1614 1.905512 GACCCTGTCCCGCATAACT 59.094 57.895 0.00 0.00 0.00 2.24
1604 1615 0.179081 GACCCTGTCCCGCATAACTC 60.179 60.000 0.00 0.00 0.00 3.01
1605 1616 1.227263 CCCTGTCCCGCATAACTCG 60.227 63.158 0.00 0.00 0.00 4.18
1606 1617 1.227263 CCTGTCCCGCATAACTCGG 60.227 63.158 0.00 0.00 46.05 4.63
1607 1618 1.515954 CTGTCCCGCATAACTCGGT 59.484 57.895 0.66 0.00 45.09 4.69
1608 1619 0.806102 CTGTCCCGCATAACTCGGTG 60.806 60.000 0.66 0.00 45.09 4.94
1609 1620 1.520787 GTCCCGCATAACTCGGTGG 60.521 63.158 0.66 0.00 45.09 4.61
1611 1622 2.582436 CCGCATAACTCGGTGGGT 59.418 61.111 0.00 0.00 41.85 4.51
1612 1623 1.813753 CCGCATAACTCGGTGGGTG 60.814 63.158 0.00 0.00 41.85 4.61
1613 1624 2.461110 CGCATAACTCGGTGGGTGC 61.461 63.158 0.00 0.00 0.00 5.01
1614 1625 1.078426 GCATAACTCGGTGGGTGCT 60.078 57.895 0.00 0.00 0.00 4.40
1615 1626 1.369091 GCATAACTCGGTGGGTGCTG 61.369 60.000 0.00 0.00 0.00 4.41
1616 1627 1.078426 ATAACTCGGTGGGTGCTGC 60.078 57.895 0.00 0.00 0.00 5.25
1617 1628 2.536997 ATAACTCGGTGGGTGCTGCC 62.537 60.000 0.00 0.00 0.00 4.85
1619 1630 4.767255 CTCGGTGGGTGCTGCCTC 62.767 72.222 0.00 0.00 37.43 4.70
1622 1633 4.269523 GGTGGGTGCTGCCTCACA 62.270 66.667 18.47 7.85 39.00 3.58
1623 1634 2.203337 GTGGGTGCTGCCTCACAA 60.203 61.111 13.87 0.00 37.93 3.33
1624 1635 2.113774 TGGGTGCTGCCTCACAAG 59.886 61.111 0.00 0.00 38.66 3.16
1625 1636 2.431683 GGGTGCTGCCTCACAAGA 59.568 61.111 0.00 0.00 38.66 3.02
1626 1637 1.228245 GGGTGCTGCCTCACAAGAA 60.228 57.895 0.00 0.00 38.66 2.52
1627 1638 0.610232 GGGTGCTGCCTCACAAGAAT 60.610 55.000 0.00 0.00 38.66 2.40
1628 1639 0.807496 GGTGCTGCCTCACAAGAATC 59.193 55.000 0.00 0.00 38.66 2.52
1629 1640 1.527034 GTGCTGCCTCACAAGAATCA 58.473 50.000 0.00 0.00 36.97 2.57
1630 1641 1.467734 GTGCTGCCTCACAAGAATCAG 59.532 52.381 0.00 0.00 36.97 2.90
1631 1642 1.072806 TGCTGCCTCACAAGAATCAGT 59.927 47.619 0.00 0.00 0.00 3.41
1632 1643 2.157738 GCTGCCTCACAAGAATCAGTT 58.842 47.619 0.00 0.00 0.00 3.16
1633 1644 2.161211 GCTGCCTCACAAGAATCAGTTC 59.839 50.000 0.00 0.00 34.46 3.01
1634 1645 2.746362 CTGCCTCACAAGAATCAGTTCC 59.254 50.000 0.00 0.00 34.81 3.62
1635 1646 2.106338 TGCCTCACAAGAATCAGTTCCA 59.894 45.455 0.00 0.00 34.81 3.53
1636 1647 2.746362 GCCTCACAAGAATCAGTTCCAG 59.254 50.000 0.00 0.00 34.81 3.86
1637 1648 3.557898 GCCTCACAAGAATCAGTTCCAGA 60.558 47.826 0.00 0.00 34.81 3.86
1638 1649 4.252073 CCTCACAAGAATCAGTTCCAGAG 58.748 47.826 0.00 0.00 34.81 3.35
1639 1650 3.668447 TCACAAGAATCAGTTCCAGAGC 58.332 45.455 0.00 0.00 34.81 4.09
1640 1651 2.746362 CACAAGAATCAGTTCCAGAGCC 59.254 50.000 0.00 0.00 34.81 4.70
1641 1652 2.641815 ACAAGAATCAGTTCCAGAGCCT 59.358 45.455 0.00 0.00 34.81 4.58
1642 1653 3.840666 ACAAGAATCAGTTCCAGAGCCTA 59.159 43.478 0.00 0.00 34.81 3.93
1643 1654 4.187694 CAAGAATCAGTTCCAGAGCCTAC 58.812 47.826 0.00 0.00 34.81 3.18
1644 1655 2.769095 AGAATCAGTTCCAGAGCCTACC 59.231 50.000 0.00 0.00 34.81 3.18
1645 1656 2.254152 ATCAGTTCCAGAGCCTACCA 57.746 50.000 0.00 0.00 0.00 3.25
1646 1657 2.024176 TCAGTTCCAGAGCCTACCAA 57.976 50.000 0.00 0.00 0.00 3.67
1647 1658 2.551270 TCAGTTCCAGAGCCTACCAAT 58.449 47.619 0.00 0.00 0.00 3.16
1648 1659 2.237143 TCAGTTCCAGAGCCTACCAATG 59.763 50.000 0.00 0.00 0.00 2.82
1649 1660 2.026822 CAGTTCCAGAGCCTACCAATGT 60.027 50.000 0.00 0.00 0.00 2.71
1650 1661 2.644798 AGTTCCAGAGCCTACCAATGTT 59.355 45.455 0.00 0.00 0.00 2.71
1651 1662 2.749621 GTTCCAGAGCCTACCAATGTTG 59.250 50.000 0.00 0.00 0.00 3.33
1652 1663 1.098050 CCAGAGCCTACCAATGTTGC 58.902 55.000 0.00 0.00 0.00 4.17
1653 1664 1.340405 CCAGAGCCTACCAATGTTGCT 60.340 52.381 0.00 0.00 35.01 3.91
1654 1665 1.741706 CAGAGCCTACCAATGTTGCTG 59.258 52.381 0.00 0.00 33.19 4.41
1655 1666 1.352352 AGAGCCTACCAATGTTGCTGT 59.648 47.619 0.00 0.00 33.19 4.40
1656 1667 2.162681 GAGCCTACCAATGTTGCTGTT 58.837 47.619 0.00 0.00 33.19 3.16
1657 1668 2.558359 GAGCCTACCAATGTTGCTGTTT 59.442 45.455 0.00 0.00 33.19 2.83
1658 1669 2.558359 AGCCTACCAATGTTGCTGTTTC 59.442 45.455 0.00 0.00 32.21 2.78
1659 1670 2.295909 GCCTACCAATGTTGCTGTTTCA 59.704 45.455 0.00 0.00 0.00 2.69
1660 1671 3.612479 GCCTACCAATGTTGCTGTTTCAG 60.612 47.826 0.00 0.00 34.12 3.02
1661 1672 3.820467 CCTACCAATGTTGCTGTTTCAGA 59.180 43.478 0.66 0.00 32.44 3.27
1662 1673 3.715628 ACCAATGTTGCTGTTTCAGAC 57.284 42.857 0.66 0.00 32.44 3.51
1663 1674 2.033299 ACCAATGTTGCTGTTTCAGACG 59.967 45.455 0.66 0.00 32.44 4.18
1664 1675 2.290367 CCAATGTTGCTGTTTCAGACGA 59.710 45.455 0.66 0.00 32.44 4.20
1665 1676 3.243035 CCAATGTTGCTGTTTCAGACGAA 60.243 43.478 0.66 0.00 32.44 3.85
1666 1677 4.539870 CAATGTTGCTGTTTCAGACGAAT 58.460 39.130 0.66 0.00 32.44 3.34
1667 1678 4.836125 ATGTTGCTGTTTCAGACGAATT 57.164 36.364 0.66 0.00 32.44 2.17
1668 1679 5.940192 ATGTTGCTGTTTCAGACGAATTA 57.060 34.783 0.66 0.00 32.44 1.40
1669 1680 5.743026 TGTTGCTGTTTCAGACGAATTAA 57.257 34.783 0.66 0.00 32.44 1.40
1670 1681 5.747565 TGTTGCTGTTTCAGACGAATTAAG 58.252 37.500 0.66 0.00 32.44 1.85
1671 1682 5.525745 TGTTGCTGTTTCAGACGAATTAAGA 59.474 36.000 0.66 0.00 32.44 2.10
1672 1683 5.845985 TGCTGTTTCAGACGAATTAAGAG 57.154 39.130 0.66 0.00 32.44 2.85
1673 1684 5.297547 TGCTGTTTCAGACGAATTAAGAGT 58.702 37.500 0.66 0.00 32.44 3.24
1674 1685 5.758296 TGCTGTTTCAGACGAATTAAGAGTT 59.242 36.000 0.66 0.00 32.44 3.01
1675 1686 6.073765 TGCTGTTTCAGACGAATTAAGAGTTC 60.074 38.462 0.66 0.00 32.44 3.01
1676 1687 6.618805 GCTGTTTCAGACGAATTAAGAGTTCC 60.619 42.308 0.66 0.00 32.44 3.62
1677 1688 5.404366 TGTTTCAGACGAATTAAGAGTTCCG 59.596 40.000 0.00 0.00 0.00 4.30
1678 1689 4.106029 TCAGACGAATTAAGAGTTCCGG 57.894 45.455 0.00 0.00 0.00 5.14
1679 1690 3.508793 TCAGACGAATTAAGAGTTCCGGT 59.491 43.478 0.00 0.00 0.00 5.28
1680 1691 3.612860 CAGACGAATTAAGAGTTCCGGTG 59.387 47.826 0.00 0.00 0.00 4.94
1681 1692 3.508793 AGACGAATTAAGAGTTCCGGTGA 59.491 43.478 0.00 0.00 0.00 4.02
1682 1693 4.159879 AGACGAATTAAGAGTTCCGGTGAT 59.840 41.667 0.00 0.00 0.00 3.06
1683 1694 4.828829 ACGAATTAAGAGTTCCGGTGATT 58.171 39.130 0.00 0.00 0.00 2.57
1684 1695 4.630069 ACGAATTAAGAGTTCCGGTGATTG 59.370 41.667 0.00 0.00 0.00 2.67
1685 1696 4.494199 CGAATTAAGAGTTCCGGTGATTGC 60.494 45.833 0.00 0.00 0.00 3.56
1686 1697 3.410631 TTAAGAGTTCCGGTGATTGCA 57.589 42.857 0.00 0.00 0.00 4.08
1687 1698 1.523758 AAGAGTTCCGGTGATTGCAC 58.476 50.000 0.00 0.00 44.39 4.57
1697 1708 2.832672 GTGATTGCACCCTCGAATTC 57.167 50.000 0.00 0.00 39.14 2.17
1698 1709 2.083774 GTGATTGCACCCTCGAATTCA 58.916 47.619 6.22 0.00 39.14 2.57
1699 1710 2.096496 GTGATTGCACCCTCGAATTCAG 59.904 50.000 6.22 2.40 39.14 3.02
1700 1711 2.027285 TGATTGCACCCTCGAATTCAGA 60.027 45.455 6.22 3.27 0.00 3.27
1701 1712 2.099141 TTGCACCCTCGAATTCAGAG 57.901 50.000 15.86 15.86 35.60 3.35
1702 1713 0.976641 TGCACCCTCGAATTCAGAGT 59.023 50.000 19.12 6.46 34.08 3.24
1703 1714 1.066858 TGCACCCTCGAATTCAGAGTC 60.067 52.381 19.12 10.28 34.08 3.36
1704 1715 1.914634 CACCCTCGAATTCAGAGTCG 58.085 55.000 19.12 13.65 44.11 4.18
1709 1720 2.834574 TCGAATTCAGAGTCGAGCTC 57.165 50.000 2.73 2.73 46.06 4.09
1710 1721 1.402259 TCGAATTCAGAGTCGAGCTCC 59.598 52.381 8.47 0.00 46.06 4.70
1711 1722 1.403679 CGAATTCAGAGTCGAGCTCCT 59.596 52.381 8.47 0.00 45.46 3.69
1712 1723 2.159310 CGAATTCAGAGTCGAGCTCCTT 60.159 50.000 8.47 0.00 45.46 3.36
1713 1724 3.065510 CGAATTCAGAGTCGAGCTCCTTA 59.934 47.826 8.47 0.00 45.46 2.69
1714 1725 4.606961 GAATTCAGAGTCGAGCTCCTTAG 58.393 47.826 8.47 0.00 45.21 2.18
1715 1726 3.351794 TTCAGAGTCGAGCTCCTTAGA 57.648 47.619 8.47 0.00 45.21 2.10
1716 1727 3.569194 TCAGAGTCGAGCTCCTTAGAT 57.431 47.619 8.47 0.00 45.21 1.98
1717 1728 3.892284 TCAGAGTCGAGCTCCTTAGATT 58.108 45.455 8.47 0.00 45.21 2.40
1718 1729 4.274147 TCAGAGTCGAGCTCCTTAGATTT 58.726 43.478 8.47 0.00 45.21 2.17
1719 1730 4.336993 TCAGAGTCGAGCTCCTTAGATTTC 59.663 45.833 8.47 2.54 45.21 2.17
1720 1731 4.097135 CAGAGTCGAGCTCCTTAGATTTCA 59.903 45.833 8.47 0.00 45.21 2.69
1721 1732 4.097286 AGAGTCGAGCTCCTTAGATTTCAC 59.903 45.833 8.47 0.00 45.21 3.18
1722 1733 4.020543 AGTCGAGCTCCTTAGATTTCACT 58.979 43.478 8.47 0.00 0.00 3.41
1723 1734 4.109050 GTCGAGCTCCTTAGATTTCACTG 58.891 47.826 8.47 0.00 0.00 3.66
1724 1735 4.017126 TCGAGCTCCTTAGATTTCACTGA 58.983 43.478 8.47 0.00 0.00 3.41
1725 1736 4.097135 TCGAGCTCCTTAGATTTCACTGAG 59.903 45.833 8.47 0.00 0.00 3.35
1726 1737 4.692228 GAGCTCCTTAGATTTCACTGAGG 58.308 47.826 0.87 0.00 42.58 3.86
1727 1738 3.454082 AGCTCCTTAGATTTCACTGAGGG 59.546 47.826 0.00 0.00 41.86 4.30
1728 1739 3.198853 GCTCCTTAGATTTCACTGAGGGT 59.801 47.826 0.00 0.00 41.86 4.34
1729 1740 4.764172 CTCCTTAGATTTCACTGAGGGTG 58.236 47.826 0.00 0.00 46.60 4.61
1730 1741 3.055094 TCCTTAGATTTCACTGAGGGTGC 60.055 47.826 0.00 0.00 44.98 5.01
1731 1742 2.672961 TAGATTTCACTGAGGGTGCG 57.327 50.000 0.00 0.00 44.98 5.34
1732 1743 0.036010 AGATTTCACTGAGGGTGCGG 60.036 55.000 0.00 0.00 44.98 5.69
1733 1744 0.321653 GATTTCACTGAGGGTGCGGT 60.322 55.000 0.00 0.00 44.98 5.68
1734 1745 0.321653 ATTTCACTGAGGGTGCGGTC 60.322 55.000 0.00 0.00 44.98 4.79
1735 1746 1.407656 TTTCACTGAGGGTGCGGTCT 61.408 55.000 0.00 0.00 44.98 3.85
1736 1747 1.407656 TTCACTGAGGGTGCGGTCTT 61.408 55.000 0.00 0.00 44.98 3.01
1737 1748 0.541063 TCACTGAGGGTGCGGTCTTA 60.541 55.000 0.00 0.00 44.98 2.10
1738 1749 0.108615 CACTGAGGGTGCGGTCTTAG 60.109 60.000 0.00 0.00 39.22 2.18
1739 1750 0.251653 ACTGAGGGTGCGGTCTTAGA 60.252 55.000 0.00 0.00 0.00 2.10
1740 1751 1.115467 CTGAGGGTGCGGTCTTAGAT 58.885 55.000 0.00 0.00 0.00 1.98
1741 1752 0.824109 TGAGGGTGCGGTCTTAGATG 59.176 55.000 0.00 0.00 0.00 2.90
1742 1753 1.112113 GAGGGTGCGGTCTTAGATGA 58.888 55.000 0.00 0.00 0.00 2.92
1743 1754 1.480954 GAGGGTGCGGTCTTAGATGAA 59.519 52.381 0.00 0.00 0.00 2.57
1744 1755 1.207329 AGGGTGCGGTCTTAGATGAAC 59.793 52.381 0.00 0.00 0.00 3.18
1745 1756 1.066430 GGGTGCGGTCTTAGATGAACA 60.066 52.381 0.00 0.00 0.00 3.18
1746 1757 2.614481 GGGTGCGGTCTTAGATGAACAA 60.614 50.000 0.00 0.00 0.00 2.83
1747 1758 2.673368 GGTGCGGTCTTAGATGAACAAG 59.327 50.000 0.00 0.00 0.00 3.16
1748 1759 2.094417 GTGCGGTCTTAGATGAACAAGC 59.906 50.000 0.00 0.00 0.00 4.01
1749 1760 2.289382 TGCGGTCTTAGATGAACAAGCA 60.289 45.455 0.00 0.00 0.00 3.91
1750 1761 2.349886 GCGGTCTTAGATGAACAAGCAG 59.650 50.000 0.00 0.00 0.00 4.24
1751 1762 3.589988 CGGTCTTAGATGAACAAGCAGT 58.410 45.455 0.00 0.00 0.00 4.40
1752 1763 3.997021 CGGTCTTAGATGAACAAGCAGTT 59.003 43.478 0.00 0.00 44.93 3.16
1759 1770 2.110213 AACAAGCAGTTCCGGCGA 59.890 55.556 9.30 0.00 34.74 5.54
1762 1773 2.357517 AAGCAGTTCCGGCGACTG 60.358 61.111 24.94 24.94 45.64 3.51
1770 1781 3.842923 CCGGCGACTGCATCCTCT 61.843 66.667 9.30 0.00 45.35 3.69
1777 1788 1.137675 CGACTGCATCCTCTGATTCCA 59.862 52.381 0.00 0.00 0.00 3.53
1779 1790 3.743584 CGACTGCATCCTCTGATTCCATT 60.744 47.826 0.00 0.00 0.00 3.16
1783 1794 2.423947 GCATCCTCTGATTCCATTGGGT 60.424 50.000 2.09 0.00 34.93 4.51
1797 1808 3.732849 GGGTGGGGGCTCTCTTGG 61.733 72.222 0.00 0.00 0.00 3.61
1799 1810 2.352805 GTGGGGGCTCTCTTGGTG 59.647 66.667 0.00 0.00 0.00 4.17
1800 1811 2.935481 TGGGGGCTCTCTTGGTGG 60.935 66.667 0.00 0.00 0.00 4.61
1802 1813 2.352805 GGGGCTCTCTTGGTGGTG 59.647 66.667 0.00 0.00 0.00 4.17
1805 1816 1.228245 GGCTCTCTTGGTGGTGCAA 60.228 57.895 0.00 0.00 0.00 4.08
1808 1819 1.972872 CTCTCTTGGTGGTGCAACTT 58.027 50.000 2.04 0.00 36.74 2.66
1819 1830 3.378427 GTGGTGCAACTTCTTCAACTTCT 59.622 43.478 2.04 0.00 36.74 2.85
1825 1836 5.647658 TGCAACTTCTTCAACTTCTTCAAGA 59.352 36.000 0.00 0.00 33.34 3.02
1829 1840 7.313951 ACTTCTTCAACTTCTTCAAGAACTG 57.686 36.000 0.00 0.00 32.65 3.16
1835 1846 7.539712 TCAACTTCTTCAAGAACTGTTGTAG 57.460 36.000 22.35 4.99 39.45 2.74
1836 1847 6.538742 TCAACTTCTTCAAGAACTGTTGTAGG 59.461 38.462 22.35 6.59 39.45 3.18
1841 1852 4.974645 TCAAGAACTGTTGTAGGTCCAT 57.025 40.909 0.00 0.00 44.61 3.41
1842 1853 6.269077 TCTTCAAGAACTGTTGTAGGTCCATA 59.731 38.462 0.00 0.00 44.61 2.74
1845 1856 8.141298 TCAAGAACTGTTGTAGGTCCATATTA 57.859 34.615 0.00 0.00 44.61 0.98
1846 1857 8.768397 TCAAGAACTGTTGTAGGTCCATATTAT 58.232 33.333 0.00 0.00 44.61 1.28
1857 1868 9.166222 TGTAGGTCCATATTATATTTGACAGGT 57.834 33.333 11.41 0.00 0.00 4.00
1858 1869 9.654663 GTAGGTCCATATTATATTTGACAGGTC 57.345 37.037 11.41 0.00 0.00 3.85
1859 1870 8.275187 AGGTCCATATTATATTTGACAGGTCA 57.725 34.615 11.41 0.00 37.91 4.02
1861 1872 8.950210 GGTCCATATTATATTTGACAGGTCATG 58.050 37.037 2.52 0.00 39.64 3.07
1862 1873 8.454106 GTCCATATTATATTTGACAGGTCATGC 58.546 37.037 2.52 0.00 39.64 4.06
1863 1874 8.162746 TCCATATTATATTTGACAGGTCATGCA 58.837 33.333 2.52 0.00 39.64 3.96
1864 1875 8.795513 CCATATTATATTTGACAGGTCATGCAA 58.204 33.333 2.52 0.00 39.64 4.08
1870 1881 5.389859 TTTGACAGGTCATGCAATTAAGG 57.610 39.130 2.52 0.00 39.64 2.69
1871 1882 2.754552 TGACAGGTCATGCAATTAAGGC 59.245 45.455 0.00 0.00 34.14 4.35
1872 1883 2.099756 GACAGGTCATGCAATTAAGGCC 59.900 50.000 0.00 0.00 0.00 5.19
1873 1884 1.066002 CAGGTCATGCAATTAAGGCCG 59.934 52.381 0.00 0.00 0.00 6.13
1874 1885 0.249031 GGTCATGCAATTAAGGCCGC 60.249 55.000 0.00 0.00 0.00 6.53
1875 1886 0.740737 GTCATGCAATTAAGGCCGCT 59.259 50.000 0.00 0.00 0.00 5.52
1876 1887 1.024271 TCATGCAATTAAGGCCGCTC 58.976 50.000 0.00 0.00 0.00 5.03
1877 1888 0.740149 CATGCAATTAAGGCCGCTCA 59.260 50.000 0.00 0.00 0.00 4.26
1878 1889 0.740737 ATGCAATTAAGGCCGCTCAC 59.259 50.000 0.00 0.00 0.00 3.51
1879 1890 0.607762 TGCAATTAAGGCCGCTCACA 60.608 50.000 0.00 0.00 0.00 3.58
1880 1891 0.179163 GCAATTAAGGCCGCTCACAC 60.179 55.000 0.00 0.00 0.00 3.82
1881 1892 1.453155 CAATTAAGGCCGCTCACACT 58.547 50.000 0.00 0.00 0.00 3.55
1882 1893 1.812571 CAATTAAGGCCGCTCACACTT 59.187 47.619 0.00 0.00 0.00 3.16
1883 1894 3.006940 CAATTAAGGCCGCTCACACTTA 58.993 45.455 0.00 0.00 0.00 2.24
1884 1895 3.560636 ATTAAGGCCGCTCACACTTAT 57.439 42.857 0.00 0.00 0.00 1.73
1885 1896 2.596904 TAAGGCCGCTCACACTTATC 57.403 50.000 0.00 0.00 0.00 1.75
1886 1897 0.613260 AAGGCCGCTCACACTTATCA 59.387 50.000 0.00 0.00 0.00 2.15
1887 1898 0.176680 AGGCCGCTCACACTTATCAG 59.823 55.000 0.00 0.00 0.00 2.90
1888 1899 0.811616 GGCCGCTCACACTTATCAGG 60.812 60.000 0.00 0.00 0.00 3.86
1889 1900 0.811616 GCCGCTCACACTTATCAGGG 60.812 60.000 0.00 0.00 0.00 4.45
1890 1901 0.179073 CCGCTCACACTTATCAGGGG 60.179 60.000 0.00 0.00 33.13 4.79
1893 1904 2.014068 GCTCACACTTATCAGGGGTGC 61.014 57.143 0.00 0.00 34.70 5.01
1902 1913 1.428869 ATCAGGGGTGCTCCTATGAC 58.571 55.000 12.58 0.00 35.26 3.06
1911 1922 1.090052 GCTCCTATGACGTGGTTGGC 61.090 60.000 0.00 0.00 0.00 4.52
1912 1923 0.249120 CTCCTATGACGTGGTTGGCA 59.751 55.000 0.00 0.00 0.00 4.92
1918 1929 0.884259 TGACGTGGTTGGCATCACAG 60.884 55.000 17.53 13.29 33.83 3.66
1919 1930 0.602638 GACGTGGTTGGCATCACAGA 60.603 55.000 17.53 0.00 33.83 3.41
1923 1934 2.095853 CGTGGTTGGCATCACAGATTAC 59.904 50.000 17.53 0.00 33.83 1.89
1931 1942 3.467803 GCATCACAGATTACCAGGTACC 58.532 50.000 2.73 2.73 0.00 3.34
1940 1952 4.542525 AGATTACCAGGTACCCCAATTTCA 59.457 41.667 8.74 0.00 0.00 2.69
1958 1970 0.033228 CATCGCCCACTCCTCATCTC 59.967 60.000 0.00 0.00 0.00 2.75
1963 1975 2.353505 CGCCCACTCCTCATCTCATATG 60.354 54.545 0.00 0.00 0.00 1.78
1964 1976 2.614987 GCCCACTCCTCATCTCATATGC 60.615 54.545 0.00 0.00 0.00 3.14
1965 1977 2.905085 CCCACTCCTCATCTCATATGCT 59.095 50.000 0.00 0.00 0.00 3.79
1966 1978 3.055963 CCCACTCCTCATCTCATATGCTC 60.056 52.174 0.00 0.00 0.00 4.26
1967 1979 3.833650 CCACTCCTCATCTCATATGCTCT 59.166 47.826 0.00 0.00 0.00 4.09
1968 1980 4.082081 CCACTCCTCATCTCATATGCTCTC 60.082 50.000 0.00 0.00 0.00 3.20
1969 1981 4.768448 CACTCCTCATCTCATATGCTCTCT 59.232 45.833 0.00 0.00 0.00 3.10
1970 1982 4.768448 ACTCCTCATCTCATATGCTCTCTG 59.232 45.833 0.00 0.00 0.00 3.35
1976 2005 6.777782 TCATCTCATATGCTCTCTGTCTCTA 58.222 40.000 0.00 0.00 0.00 2.43
1977 2006 7.404481 TCATCTCATATGCTCTCTGTCTCTAT 58.596 38.462 0.00 0.00 0.00 1.98
1979 2008 6.777782 TCTCATATGCTCTCTGTCTCTATGA 58.222 40.000 0.00 0.00 0.00 2.15
1980 2009 7.230027 TCTCATATGCTCTCTGTCTCTATGAA 58.770 38.462 0.00 0.00 0.00 2.57
1988 2017 6.201226 TCTCTGTCTCTATGAACATGTGTC 57.799 41.667 0.00 0.00 0.00 3.67
1990 2019 5.958955 TCTGTCTCTATGAACATGTGTCAG 58.041 41.667 0.00 0.00 0.00 3.51
1993 2022 5.423290 TGTCTCTATGAACATGTGTCAGGAT 59.577 40.000 0.00 0.00 0.00 3.24
1995 2024 7.288621 TGTCTCTATGAACATGTGTCAGGATAT 59.711 37.037 0.00 0.00 0.00 1.63
1996 2025 8.147058 GTCTCTATGAACATGTGTCAGGATATT 58.853 37.037 0.00 0.00 0.00 1.28
1997 2026 8.363390 TCTCTATGAACATGTGTCAGGATATTC 58.637 37.037 0.00 0.00 0.00 1.75
1998 2027 7.445121 TCTATGAACATGTGTCAGGATATTCC 58.555 38.462 0.00 0.00 36.58 3.01
2006 2035 8.328758 ACATGTGTCAGGATATTCCTTTTTCTA 58.671 33.333 0.00 0.00 46.91 2.10
2007 2036 9.347240 CATGTGTCAGGATATTCCTTTTTCTAT 57.653 33.333 0.00 0.00 46.91 1.98
2008 2037 9.927081 ATGTGTCAGGATATTCCTTTTTCTATT 57.073 29.630 0.00 0.00 46.91 1.73
2009 2038 9.753674 TGTGTCAGGATATTCCTTTTTCTATTT 57.246 29.630 0.00 0.00 46.91 1.40
2037 2066 7.864108 TGTTATTTCTGGGAGATATGTTGTG 57.136 36.000 0.00 0.00 0.00 3.33
2038 2067 6.828273 TGTTATTTCTGGGAGATATGTTGTGG 59.172 38.462 0.00 0.00 0.00 4.17
2039 2068 3.931907 TTCTGGGAGATATGTTGTGGG 57.068 47.619 0.00 0.00 0.00 4.61
2040 2069 2.126882 TCTGGGAGATATGTTGTGGGG 58.873 52.381 0.00 0.00 0.00 4.96
2041 2070 0.550914 TGGGAGATATGTTGTGGGGC 59.449 55.000 0.00 0.00 0.00 5.80
2042 2071 0.550914 GGGAGATATGTTGTGGGGCA 59.449 55.000 0.00 0.00 0.00 5.36
2043 2072 1.064017 GGGAGATATGTTGTGGGGCAA 60.064 52.381 0.00 0.00 34.16 4.52
2044 2073 2.622977 GGGAGATATGTTGTGGGGCAAA 60.623 50.000 0.00 0.00 39.03 3.68
2046 2075 3.706086 GGAGATATGTTGTGGGGCAAAAT 59.294 43.478 0.00 0.00 39.03 1.82
2048 2077 5.362430 GGAGATATGTTGTGGGGCAAAATTA 59.638 40.000 0.00 0.00 39.03 1.40
2049 2078 6.041979 GGAGATATGTTGTGGGGCAAAATTAT 59.958 38.462 0.00 0.00 39.03 1.28
2050 2079 7.232534 GGAGATATGTTGTGGGGCAAAATTATA 59.767 37.037 0.00 0.00 39.03 0.98
2051 2080 8.546083 AGATATGTTGTGGGGCAAAATTATAA 57.454 30.769 0.00 0.00 39.03 0.98
2053 2082 9.423061 GATATGTTGTGGGGCAAAATTATAATC 57.577 33.333 0.00 0.00 39.03 1.75
2054 2083 6.611613 TGTTGTGGGGCAAAATTATAATCA 57.388 33.333 0.00 0.00 39.03 2.57
2055 2084 6.638610 TGTTGTGGGGCAAAATTATAATCAG 58.361 36.000 0.00 0.00 39.03 2.90
2056 2085 6.212388 TGTTGTGGGGCAAAATTATAATCAGT 59.788 34.615 0.00 0.00 39.03 3.41
2057 2086 6.219417 TGTGGGGCAAAATTATAATCAGTG 57.781 37.500 0.00 0.00 0.00 3.66
2096 2142 9.681692 TTCACATAAGTCATTGATGTCAAAAAG 57.318 29.630 0.00 0.00 39.55 2.27
2098 2144 7.543172 CACATAAGTCATTGATGTCAAAAAGGG 59.457 37.037 0.00 0.00 39.55 3.95
2100 2146 6.729690 AAGTCATTGATGTCAAAAAGGGAA 57.270 33.333 0.00 0.00 39.55 3.97
2101 2147 6.729690 AGTCATTGATGTCAAAAAGGGAAA 57.270 33.333 0.00 0.00 39.55 3.13
2102 2148 7.307131 AGTCATTGATGTCAAAAAGGGAAAT 57.693 32.000 0.00 0.00 39.55 2.17
2103 2149 8.421249 AGTCATTGATGTCAAAAAGGGAAATA 57.579 30.769 0.00 0.00 39.55 1.40
2104 2150 8.869109 AGTCATTGATGTCAAAAAGGGAAATAA 58.131 29.630 0.00 0.00 39.55 1.40
2105 2151 9.487790 GTCATTGATGTCAAAAAGGGAAATAAA 57.512 29.630 0.00 0.00 39.55 1.40
2108 2154 9.844257 ATTGATGTCAAAAAGGGAAATAAAACA 57.156 25.926 0.00 0.00 39.55 2.83
2109 2155 9.672673 TTGATGTCAAAAAGGGAAATAAAACAA 57.327 25.926 0.00 0.00 32.11 2.83
2110 2156 9.103861 TGATGTCAAAAAGGGAAATAAAACAAC 57.896 29.630 0.00 0.00 0.00 3.32
2111 2157 9.103861 GATGTCAAAAAGGGAAATAAAACAACA 57.896 29.630 0.00 0.00 0.00 3.33
2112 2158 8.257830 TGTCAAAAAGGGAAATAAAACAACAC 57.742 30.769 0.00 0.00 0.00 3.32
2113 2159 7.878127 TGTCAAAAAGGGAAATAAAACAACACA 59.122 29.630 0.00 0.00 0.00 3.72
2114 2160 8.888716 GTCAAAAAGGGAAATAAAACAACACAT 58.111 29.630 0.00 0.00 0.00 3.21
2115 2161 8.887717 TCAAAAAGGGAAATAAAACAACACATG 58.112 29.630 0.00 0.00 0.00 3.21
2116 2162 6.859420 AAAGGGAAATAAAACAACACATGC 57.141 33.333 0.00 0.00 0.00 4.06
2117 2163 5.806654 AGGGAAATAAAACAACACATGCT 57.193 34.783 0.00 0.00 0.00 3.79
2118 2164 6.909550 AGGGAAATAAAACAACACATGCTA 57.090 33.333 0.00 0.00 0.00 3.49
2119 2165 6.687604 AGGGAAATAAAACAACACATGCTAC 58.312 36.000 0.00 0.00 0.00 3.58
2120 2166 5.571357 GGGAAATAAAACAACACATGCTACG 59.429 40.000 0.00 0.00 0.00 3.51
2124 2170 4.893424 AAAACAACACATGCTACGAACT 57.107 36.364 0.00 0.00 0.00 3.01
2134 2180 6.015504 CACATGCTACGAACTTGTATTTGAC 58.984 40.000 0.00 0.00 0.00 3.18
2137 2183 6.795098 TGCTACGAACTTGTATTTGACAAT 57.205 33.333 0.00 0.00 46.95 2.71
2138 2184 7.197071 TGCTACGAACTTGTATTTGACAATT 57.803 32.000 0.00 0.00 46.95 2.32
2139 2185 7.075121 TGCTACGAACTTGTATTTGACAATTG 58.925 34.615 3.24 3.24 46.95 2.32
2144 2190 9.607285 ACGAACTTGTATTTGACAATTGAATAC 57.393 29.630 13.59 15.28 46.95 1.89
2145 2191 9.605955 CGAACTTGTATTTGACAATTGAATACA 57.394 29.630 19.55 19.55 46.95 2.29
2162 2208 9.754382 ATTGAATACATTTGATTGATAACCTGC 57.246 29.630 0.00 0.00 0.00 4.85
2164 2210 8.916062 TGAATACATTTGATTGATAACCTGCAT 58.084 29.630 0.00 0.00 0.00 3.96
2165 2211 9.188588 GAATACATTTGATTGATAACCTGCATG 57.811 33.333 0.00 0.00 0.00 4.06
2168 2214 7.788026 ACATTTGATTGATAACCTGCATGATT 58.212 30.769 0.00 0.00 0.00 2.57
2169 2215 7.709182 ACATTTGATTGATAACCTGCATGATTG 59.291 33.333 0.00 0.00 0.00 2.67
2181 2227 2.878580 GCATGATTGCCAATTTGACGA 58.121 42.857 0.00 0.00 43.38 4.20
2182 2228 3.252400 GCATGATTGCCAATTTGACGAA 58.748 40.909 0.00 0.00 43.38 3.85
2183 2229 3.866910 GCATGATTGCCAATTTGACGAAT 59.133 39.130 0.00 0.00 43.38 3.34
2184 2230 4.260051 GCATGATTGCCAATTTGACGAATG 60.260 41.667 0.00 0.00 43.38 2.67
2185 2231 3.847542 TGATTGCCAATTTGACGAATGG 58.152 40.909 0.00 0.00 0.00 3.16
2186 2232 3.257873 TGATTGCCAATTTGACGAATGGT 59.742 39.130 0.00 0.00 0.00 3.55
2187 2233 3.742433 TTGCCAATTTGACGAATGGTT 57.258 38.095 0.00 0.00 0.00 3.67
2188 2234 3.742433 TGCCAATTTGACGAATGGTTT 57.258 38.095 0.00 0.00 0.00 3.27
2189 2235 4.855715 TGCCAATTTGACGAATGGTTTA 57.144 36.364 0.00 0.00 0.00 2.01
2190 2236 5.398603 TGCCAATTTGACGAATGGTTTAT 57.601 34.783 0.00 0.00 0.00 1.40
2191 2237 6.516739 TGCCAATTTGACGAATGGTTTATA 57.483 33.333 0.00 0.00 0.00 0.98
2192 2238 6.925211 TGCCAATTTGACGAATGGTTTATAA 58.075 32.000 0.00 0.00 0.00 0.98
2193 2239 7.032580 TGCCAATTTGACGAATGGTTTATAAG 58.967 34.615 0.00 0.00 0.00 1.73
2194 2240 7.094162 TGCCAATTTGACGAATGGTTTATAAGA 60.094 33.333 0.00 0.00 0.00 2.10
2195 2241 7.432252 GCCAATTTGACGAATGGTTTATAAGAG 59.568 37.037 0.00 0.00 0.00 2.85
2196 2242 8.673711 CCAATTTGACGAATGGTTTATAAGAGA 58.326 33.333 0.00 0.00 0.00 3.10
2212 2258 1.964552 GAGAATCTCATGGCCCACTG 58.035 55.000 5.22 0.00 0.00 3.66
2213 2259 1.487976 GAGAATCTCATGGCCCACTGA 59.512 52.381 5.22 0.00 0.00 3.41
2214 2260 2.106166 GAGAATCTCATGGCCCACTGAT 59.894 50.000 5.22 0.00 0.00 2.90
2215 2261 2.106166 AGAATCTCATGGCCCACTGATC 59.894 50.000 0.00 0.00 0.00 2.92
2216 2262 1.817087 ATCTCATGGCCCACTGATCT 58.183 50.000 0.00 0.00 0.00 2.75
2217 2263 0.835276 TCTCATGGCCCACTGATCTG 59.165 55.000 0.00 0.00 0.00 2.90
2218 2264 0.545171 CTCATGGCCCACTGATCTGT 59.455 55.000 0.00 0.00 0.00 3.41
2219 2265 0.543277 TCATGGCCCACTGATCTGTC 59.457 55.000 0.00 0.00 0.00 3.51
2220 2266 0.545171 CATGGCCCACTGATCTGTCT 59.455 55.000 0.00 0.00 0.00 3.41
2221 2267 1.064906 CATGGCCCACTGATCTGTCTT 60.065 52.381 0.00 0.00 0.00 3.01
2222 2268 1.951209 TGGCCCACTGATCTGTCTTA 58.049 50.000 0.00 0.00 0.00 2.10
2223 2269 1.555075 TGGCCCACTGATCTGTCTTAC 59.445 52.381 0.00 0.00 0.00 2.34
2224 2270 1.134371 GGCCCACTGATCTGTCTTACC 60.134 57.143 1.69 0.00 0.00 2.85
2225 2271 1.834263 GCCCACTGATCTGTCTTACCT 59.166 52.381 1.69 0.00 0.00 3.08
2226 2272 2.419297 GCCCACTGATCTGTCTTACCTG 60.419 54.545 1.69 0.00 0.00 4.00
2227 2273 3.099905 CCCACTGATCTGTCTTACCTGA 58.900 50.000 1.69 0.00 0.00 3.86
2228 2274 3.118956 CCCACTGATCTGTCTTACCTGAC 60.119 52.174 1.69 0.00 37.47 3.51
2229 2275 3.428180 CCACTGATCTGTCTTACCTGACG 60.428 52.174 1.69 0.00 39.64 4.35
2230 2276 3.191581 CACTGATCTGTCTTACCTGACGT 59.808 47.826 1.69 0.00 39.64 4.34
2231 2277 4.395231 CACTGATCTGTCTTACCTGACGTA 59.605 45.833 1.69 0.00 39.64 3.57
2232 2278 5.008331 ACTGATCTGTCTTACCTGACGTAA 58.992 41.667 0.00 0.00 39.64 3.18
2253 2299 7.426169 CGTAAGTTACAAAATTGTCGATTTGC 58.574 34.615 13.33 0.42 42.35 3.68
2254 2300 6.432802 AAGTTACAAAATTGTCGATTTGCG 57.567 33.333 8.72 0.00 42.35 4.85
2255 2301 5.516090 AGTTACAAAATTGTCGATTTGCGT 58.484 33.333 8.72 3.19 42.35 5.24
2256 2302 5.974751 AGTTACAAAATTGTCGATTTGCGTT 59.025 32.000 8.72 0.00 42.35 4.84
2257 2303 4.690731 ACAAAATTGTCGATTTGCGTTG 57.309 36.364 8.72 3.42 39.55 4.10
2258 2304 4.109050 ACAAAATTGTCGATTTGCGTTGT 58.891 34.783 8.72 3.96 39.55 3.32
2259 2305 5.274718 ACAAAATTGTCGATTTGCGTTGTA 58.725 33.333 8.72 0.00 39.55 2.41
2260 2306 5.744345 ACAAAATTGTCGATTTGCGTTGTAA 59.256 32.000 8.72 0.00 39.55 2.41
2261 2307 6.419413 ACAAAATTGTCGATTTGCGTTGTAAT 59.581 30.769 8.72 0.00 39.55 1.89
2262 2308 7.591795 ACAAAATTGTCGATTTGCGTTGTAATA 59.408 29.630 8.72 0.00 39.55 0.98
2263 2309 7.487180 AAATTGTCGATTTGCGTTGTAATAC 57.513 32.000 0.00 0.00 41.80 1.89
2264 2310 5.849357 TTGTCGATTTGCGTTGTAATACT 57.151 34.783 0.00 0.00 41.80 2.12
2265 2311 6.947903 TTGTCGATTTGCGTTGTAATACTA 57.052 33.333 0.00 0.00 41.80 1.82
2266 2312 7.528481 TTGTCGATTTGCGTTGTAATACTAT 57.472 32.000 0.00 0.00 41.80 2.12
2267 2313 6.928820 TGTCGATTTGCGTTGTAATACTATG 58.071 36.000 0.00 0.00 41.80 2.23
2268 2314 6.532302 TGTCGATTTGCGTTGTAATACTATGT 59.468 34.615 0.00 0.00 41.80 2.29
2269 2315 7.063662 TGTCGATTTGCGTTGTAATACTATGTT 59.936 33.333 0.00 0.00 41.80 2.71
2270 2316 7.369800 GTCGATTTGCGTTGTAATACTATGTTG 59.630 37.037 0.00 0.00 41.80 3.33
2271 2317 7.063662 TCGATTTGCGTTGTAATACTATGTTGT 59.936 33.333 0.00 0.00 41.80 3.32
2272 2318 7.161900 CGATTTGCGTTGTAATACTATGTTGTG 59.838 37.037 0.00 0.00 34.64 3.33
2273 2319 5.211266 TGCGTTGTAATACTATGTTGTGC 57.789 39.130 0.00 0.00 0.00 4.57
2274 2320 4.691216 TGCGTTGTAATACTATGTTGTGCA 59.309 37.500 0.00 0.00 0.00 4.57
2275 2321 5.019498 GCGTTGTAATACTATGTTGTGCAC 58.981 41.667 10.75 10.75 0.00 4.57
2276 2322 5.390040 GCGTTGTAATACTATGTTGTGCACA 60.390 40.000 17.42 17.42 40.71 4.57
2277 2323 6.594886 CGTTGTAATACTATGTTGTGCACAA 58.405 36.000 27.96 27.96 39.50 3.33
2291 2337 3.374745 GTGCACAACACTTCAGATTTGG 58.625 45.455 13.17 0.00 46.41 3.28
2292 2338 3.066621 GTGCACAACACTTCAGATTTGGA 59.933 43.478 13.17 0.00 46.41 3.53
2293 2339 3.890756 TGCACAACACTTCAGATTTGGAT 59.109 39.130 0.00 0.00 0.00 3.41
2294 2340 4.022935 TGCACAACACTTCAGATTTGGATC 60.023 41.667 0.00 0.00 0.00 3.36
2295 2341 4.022935 GCACAACACTTCAGATTTGGATCA 60.023 41.667 0.00 0.00 34.60 2.92
2296 2342 5.336213 GCACAACACTTCAGATTTGGATCAT 60.336 40.000 0.00 0.00 34.60 2.45
2297 2343 6.127925 GCACAACACTTCAGATTTGGATCATA 60.128 38.462 0.00 0.00 34.60 2.15
2298 2344 7.575532 GCACAACACTTCAGATTTGGATCATAA 60.576 37.037 0.00 0.00 34.60 1.90
2299 2345 8.298854 CACAACACTTCAGATTTGGATCATAAA 58.701 33.333 0.00 0.00 34.60 1.40
2300 2346 9.028284 ACAACACTTCAGATTTGGATCATAAAT 57.972 29.630 6.83 6.83 34.60 1.40
2301 2347 9.297586 CAACACTTCAGATTTGGATCATAAATG 57.702 33.333 10.74 1.96 34.60 2.32
2302 2348 8.812513 ACACTTCAGATTTGGATCATAAATGA 57.187 30.769 10.74 0.00 41.70 2.57
2374 2426 5.529581 TTTTTCCCTCATGGTCAGTTTTC 57.470 39.130 0.00 0.00 34.77 2.29
2376 2428 4.453480 TTCCCTCATGGTCAGTTTTCTT 57.547 40.909 0.00 0.00 34.77 2.52
2377 2429 4.021102 TCCCTCATGGTCAGTTTTCTTC 57.979 45.455 0.00 0.00 34.77 2.87
2378 2430 3.652869 TCCCTCATGGTCAGTTTTCTTCT 59.347 43.478 0.00 0.00 34.77 2.85
2379 2431 4.844085 TCCCTCATGGTCAGTTTTCTTCTA 59.156 41.667 0.00 0.00 34.77 2.10
2380 2432 5.488919 TCCCTCATGGTCAGTTTTCTTCTAT 59.511 40.000 0.00 0.00 34.77 1.98
2381 2433 5.587844 CCCTCATGGTCAGTTTTCTTCTATG 59.412 44.000 0.00 0.00 0.00 2.23
2382 2434 6.409704 CCTCATGGTCAGTTTTCTTCTATGA 58.590 40.000 0.00 0.00 32.82 2.15
2383 2435 6.881065 CCTCATGGTCAGTTTTCTTCTATGAA 59.119 38.462 0.00 0.00 33.13 2.57
2384 2436 7.555554 CCTCATGGTCAGTTTTCTTCTATGAAT 59.444 37.037 0.00 0.00 33.13 2.57
2385 2437 8.272545 TCATGGTCAGTTTTCTTCTATGAATG 57.727 34.615 0.00 0.00 31.81 2.67
2386 2438 8.102676 TCATGGTCAGTTTTCTTCTATGAATGA 58.897 33.333 0.00 0.00 31.81 2.57
2387 2439 7.672983 TGGTCAGTTTTCTTCTATGAATGAC 57.327 36.000 0.00 0.00 34.93 3.06
2388 2440 7.223584 TGGTCAGTTTTCTTCTATGAATGACA 58.776 34.615 0.00 0.00 36.22 3.58
2390 2442 8.394121 GGTCAGTTTTCTTCTATGAATGACATC 58.606 37.037 0.00 0.00 40.07 3.06
2391 2443 9.160496 GTCAGTTTTCTTCTATGAATGACATCT 57.840 33.333 0.00 0.00 40.07 2.90
2392 2444 9.159364 TCAGTTTTCTTCTATGAATGACATCTG 57.841 33.333 0.00 0.00 40.07 2.90
2398 2450 9.676861 TTCTTCTATGAATGACATCTGAATGTT 57.323 29.630 0.00 0.00 46.20 2.71
2399 2451 9.322773 TCTTCTATGAATGACATCTGAATGTTC 57.677 33.333 0.00 0.00 46.20 3.18
2400 2452 9.327628 CTTCTATGAATGACATCTGAATGTTCT 57.672 33.333 0.00 0.00 46.20 3.01
2401 2453 9.676861 TTCTATGAATGACATCTGAATGTTCTT 57.323 29.630 0.00 0.00 46.20 2.52
2402 2454 9.676861 TCTATGAATGACATCTGAATGTTCTTT 57.323 29.630 0.00 0.00 46.20 2.52
2403 2455 9.932699 CTATGAATGACATCTGAATGTTCTTTC 57.067 33.333 0.00 2.69 46.20 2.62
2404 2456 7.991084 TGAATGACATCTGAATGTTCTTTCT 57.009 32.000 0.00 0.00 46.20 2.52
2405 2457 7.813645 TGAATGACATCTGAATGTTCTTTCTG 58.186 34.615 0.00 1.26 46.20 3.02
2406 2458 5.618056 TGACATCTGAATGTTCTTTCTGC 57.382 39.130 0.00 0.00 46.20 4.26
2407 2459 5.065235 TGACATCTGAATGTTCTTTCTGCA 58.935 37.500 0.00 0.00 46.20 4.41
2408 2460 5.708697 TGACATCTGAATGTTCTTTCTGCAT 59.291 36.000 0.00 0.00 46.20 3.96
2409 2461 5.950883 ACATCTGAATGTTCTTTCTGCATG 58.049 37.500 0.00 0.00 43.74 4.06
2413 2465 6.466812 TCTGAATGTTCTTTCTGCATGTCTA 58.533 36.000 0.00 0.00 0.00 2.59
2417 2469 8.579006 TGAATGTTCTTTCTGCATGTCTATTTT 58.421 29.630 0.00 0.00 0.00 1.82
2418 2470 8.976986 AATGTTCTTTCTGCATGTCTATTTTC 57.023 30.769 0.00 0.00 0.00 2.29
2451 2503 3.732212 TCACCAAAGATATCGCATCTGG 58.268 45.455 0.00 3.95 0.00 3.86
2455 2507 6.210584 TCACCAAAGATATCGCATCTGGTATA 59.789 38.462 13.38 6.16 0.00 1.47
2543 2606 2.401766 CGTGCAGGAGAATGCCACC 61.402 63.158 0.00 0.00 45.91 4.61
2565 2628 5.597182 ACCGCATTAGATTCTGTCCTTACTA 59.403 40.000 0.00 0.00 0.00 1.82
2566 2629 6.267928 ACCGCATTAGATTCTGTCCTTACTAT 59.732 38.462 0.00 0.00 0.00 2.12
2637 2700 4.246458 GGTTAGCGAAGTGAAGAAGTCAT 58.754 43.478 0.00 0.00 38.90 3.06
2648 2711 3.903714 TGAAGAAGTCATCACTCTTGGGA 59.096 43.478 0.00 0.00 29.93 4.37
2653 2716 1.153289 CATCACTCTTGGGAGCGGG 60.153 63.158 0.00 0.00 42.98 6.13
2717 2801 6.331369 AGCAAAATTAGAACTGCTAGCAAA 57.669 33.333 19.86 10.11 43.17 3.68
2735 2819 2.103537 AACGGAAGGTATTTGGTCGG 57.896 50.000 0.00 0.00 0.00 4.79
2741 2825 0.912487 AGGTATTTGGTCGGGAGGCA 60.912 55.000 0.00 0.00 34.97 4.75
2750 2834 3.197790 CGGGAGGCATTGCGTGAG 61.198 66.667 8.83 0.00 0.00 3.51
2762 2846 1.051008 TGCGTGAGGATATCATGGCT 58.949 50.000 4.83 0.00 43.98 4.75
2782 2866 0.106149 AAACTCCGTGAGACACCACC 59.894 55.000 7.76 0.00 33.67 4.61
2798 2894 1.000771 ACCCAGCTCGAGCACTAGA 60.001 57.895 36.87 0.00 45.16 2.43
2804 2900 0.873743 GCTCGAGCACTAGACCATGC 60.874 60.000 31.91 0.00 42.39 4.06
2810 2906 2.126914 GCACTAGACCATGCTACTCG 57.873 55.000 0.00 0.00 38.84 4.18
2957 3053 5.635700 GTCTGAGACTTTTAGTGTGGATGAC 59.364 44.000 5.12 0.00 0.00 3.06
2969 3065 9.631257 TTTAGTGTGGATGACATATTTCATGAT 57.369 29.630 9.08 0.00 36.30 2.45
2977 3073 8.613482 GGATGACATATTTCATGATATGCTGAG 58.387 37.037 9.08 1.75 41.56 3.35
3084 3180 9.613428 AACGTTTCTTCTTGATATTGGATGATA 57.387 29.630 0.00 0.00 0.00 2.15
3097 3193 4.963318 TGGATGATATCTGGGTGAAGAC 57.037 45.455 3.98 0.00 0.00 3.01
3098 3194 4.297768 TGGATGATATCTGGGTGAAGACA 58.702 43.478 3.98 0.00 0.00 3.41
3100 3196 5.163269 TGGATGATATCTGGGTGAAGACAAG 60.163 44.000 3.98 0.00 0.00 3.16
3164 3260 5.163216 TGTTGGGATGAAAGGAAGCAAAATT 60.163 36.000 0.00 0.00 0.00 1.82
3198 3294 3.874543 TCGAACAAAAGTTGCAGCTAGAA 59.125 39.130 2.53 0.00 0.00 2.10
3206 3302 3.791245 AGTTGCAGCTAGAACTCTATGC 58.209 45.455 0.00 5.68 35.87 3.14
3207 3303 3.196469 AGTTGCAGCTAGAACTCTATGCA 59.804 43.478 0.00 9.82 40.59 3.96
3223 3319 7.665690 ACTCTATGCACTGATGAACCTATTAG 58.334 38.462 0.00 0.00 0.00 1.73
3236 3332 9.507329 GATGAACCTATTAGAATGCCTGATTTA 57.493 33.333 0.00 0.00 0.00 1.40
3247 3343 4.362470 TGCCTGATTTAGATGAGGATGG 57.638 45.455 2.73 0.00 38.80 3.51
3256 3352 8.717717 TGATTTAGATGAGGATGGATACTTGTT 58.282 33.333 0.00 0.00 37.61 2.83
3263 3359 6.115446 TGAGGATGGATACTTGTTGATGTTC 58.885 40.000 0.00 0.00 37.61 3.18
3272 3368 7.645340 GGATACTTGTTGATGTTCATGCATTAC 59.355 37.037 0.00 0.00 0.00 1.89
3289 3385 2.563261 TACGCATTGGGTGGTACAAA 57.437 45.000 15.92 0.00 44.16 2.83
3293 3392 2.415357 CGCATTGGGTGGTACAAATGTC 60.415 50.000 0.00 0.00 44.16 3.06
3302 3401 4.084013 GGTGGTACAAATGTCGTTGAAGAG 60.084 45.833 0.00 0.00 44.16 2.85
3317 3416 5.107065 CGTTGAAGAGGAATTTGTACCAGTC 60.107 44.000 0.00 0.00 0.00 3.51
3319 3418 2.973945 AGAGGAATTTGTACCAGTCGC 58.026 47.619 0.00 0.00 0.00 5.19
3321 3420 0.725117 GGAATTTGTACCAGTCGCGG 59.275 55.000 6.13 0.00 0.00 6.46
3362 3461 2.634940 ACATAGATCACCTATTGCGGCT 59.365 45.455 0.00 0.00 35.96 5.52
3384 3483 0.764890 AACAGTGGCAGGACAGCTTA 59.235 50.000 0.00 0.00 34.17 3.09
3390 3489 1.746991 GCAGGACAGCTTAGGGCAC 60.747 63.158 0.00 0.00 44.79 5.01
3425 3524 5.585844 CCTCTTTTGGAAAAACACTGCAAAT 59.414 36.000 0.00 0.00 34.61 2.32
3432 3531 5.105392 TGGAAAAACACTGCAAATCTTGACT 60.105 36.000 0.00 0.00 0.00 3.41
3460 3559 3.593442 TGACACCATGGGTTCTCTTTT 57.407 42.857 18.09 0.00 31.02 2.27
3461 3560 3.486383 TGACACCATGGGTTCTCTTTTC 58.514 45.455 18.09 0.00 31.02 2.29
3467 3566 3.245052 CCATGGGTTCTCTTTTCTGGAGT 60.245 47.826 2.85 0.00 33.06 3.85
3513 3612 1.067821 AGCGATGCTTAGAGTACTGCC 59.932 52.381 0.00 0.00 33.89 4.85
3535 3634 5.564550 CCATATTTTCCCCAGAAGATCGAT 58.435 41.667 0.00 0.00 32.35 3.59
3547 3646 2.029838 AGATCGATGTTGACAAGGGC 57.970 50.000 0.54 0.00 0.00 5.19
3555 3654 1.141254 TGTTGACAAGGGCCGAGTTAA 59.859 47.619 0.00 0.83 0.00 2.01
3569 3668 5.067805 GGCCGAGTTAATTCATCTTTGGATT 59.932 40.000 0.00 0.00 35.20 3.01
3582 3681 3.454082 TCTTTGGATTGCACAAGGGTTTT 59.546 39.130 0.00 0.00 0.00 2.43
3667 3766 0.321034 TCGTGCTCATTTCTGCAGCT 60.321 50.000 9.47 0.00 40.06 4.24
3676 3775 5.633830 TCATTTCTGCAGCTAGAAAAAGG 57.366 39.130 14.14 5.24 46.35 3.11
3680 3779 1.396301 CTGCAGCTAGAAAAAGGCTCG 59.604 52.381 0.00 0.00 33.74 5.03
3681 3780 1.001974 TGCAGCTAGAAAAAGGCTCGA 59.998 47.619 0.00 0.00 33.74 4.04
3682 3781 2.284190 GCAGCTAGAAAAAGGCTCGAT 58.716 47.619 0.00 0.00 33.74 3.59
3683 3782 2.680339 GCAGCTAGAAAAAGGCTCGATT 59.320 45.455 0.00 0.00 33.74 3.34
3684 3783 3.486542 GCAGCTAGAAAAAGGCTCGATTG 60.487 47.826 0.00 0.00 33.74 2.67
3685 3784 3.935203 CAGCTAGAAAAAGGCTCGATTGA 59.065 43.478 0.00 0.00 33.74 2.57
3689 3788 5.238214 GCTAGAAAAAGGCTCGATTGATGAT 59.762 40.000 0.00 0.00 0.00 2.45
3690 3789 6.238593 GCTAGAAAAAGGCTCGATTGATGATT 60.239 38.462 0.00 0.00 0.00 2.57
3692 3791 6.928520 AGAAAAAGGCTCGATTGATGATTTT 58.071 32.000 0.00 0.00 0.00 1.82
3693 3792 7.031975 AGAAAAAGGCTCGATTGATGATTTTC 58.968 34.615 11.62 11.62 35.54 2.29
3694 3793 6.521151 AAAAGGCTCGATTGATGATTTTCT 57.479 33.333 0.00 0.00 0.00 2.52
3697 3796 7.630242 AAGGCTCGATTGATGATTTTCTAAA 57.370 32.000 0.00 0.00 0.00 1.85
3699 3798 7.050377 AGGCTCGATTGATGATTTTCTAAAGA 58.950 34.615 0.00 0.00 0.00 2.52
3701 3800 7.128976 GCTCGATTGATGATTTTCTAAAGACC 58.871 38.462 0.00 0.00 0.00 3.85
3704 3836 7.010183 TCGATTGATGATTTTCTAAAGACCGAC 59.990 37.037 0.00 0.00 0.00 4.79
3707 3854 6.234920 TGATGATTTTCTAAAGACCGACCAA 58.765 36.000 0.00 0.00 0.00 3.67
3793 3940 4.560136 TCGAGAATGCAGAGAGTGATAC 57.440 45.455 0.00 0.00 0.00 2.24
3895 4045 7.886629 TTAAGAAGATCCTTGGATTGGAATG 57.113 36.000 3.43 0.00 37.13 2.67
3946 4096 3.261818 AAGGAGTAGACCAGTTGAGGT 57.738 47.619 0.00 0.00 46.82 3.85
4004 4154 2.041686 GCGGGTATTGGCCGTTGAA 61.042 57.895 0.00 0.00 0.00 2.69
4005 4155 1.798087 CGGGTATTGGCCGTTGAAC 59.202 57.895 0.00 0.00 0.00 3.18
4037 4196 5.359194 AATATGATCCACTCGAACAACCT 57.641 39.130 0.00 0.00 0.00 3.50
4039 4198 6.672266 ATATGATCCACTCGAACAACCTAT 57.328 37.500 0.00 0.00 0.00 2.57
4053 4212 6.973474 CGAACAACCTATTAAGTTCTCGATCT 59.027 38.462 0.00 0.00 38.50 2.75
4070 4229 5.380900 TCGATCTCAGAGTCCATTAGTCAT 58.619 41.667 0.00 0.00 0.00 3.06
4097 4256 2.030946 GCACCTACGCTATCTTGCTTTG 59.969 50.000 0.00 0.00 0.00 2.77
4099 4258 3.307242 CACCTACGCTATCTTGCTTTGAC 59.693 47.826 0.00 0.00 0.00 3.18
4122 4290 6.103997 ACGACAAATTTGAGATGTACGGTAT 58.896 36.000 24.64 0.00 0.00 2.73
4173 4347 5.180868 CACCATATCCAGCTGCTAGATTTTC 59.819 44.000 15.47 0.00 0.00 2.29
4182 4368 4.880696 AGCTGCTAGATTTTCATGGAGAAC 59.119 41.667 0.00 0.00 35.56 3.01
4199 4388 4.086457 GAGAACCTTGGGAATTTGCCTTA 58.914 43.478 8.51 0.00 0.00 2.69
4236 4425 2.248431 GGCACGTGTTCTGTTCGC 59.752 61.111 18.38 0.00 0.00 4.70
4237 4426 2.128128 GCACGTGTTCTGTTCGCG 60.128 61.111 18.38 0.00 43.13 5.87
4265 4469 6.548171 TGTAAAATTTCGTAACATAGGCAGC 58.452 36.000 0.00 0.00 0.00 5.25
4279 4483 1.227205 GCAGCCTGATCTCACTCCG 60.227 63.158 0.00 0.00 0.00 4.63
4321 4537 4.832823 AGTAAGGAATGAAAAAGGGTGTGG 59.167 41.667 0.00 0.00 0.00 4.17
4352 4568 4.554960 ACTAAGGGACCTAAACAAGCTC 57.445 45.455 0.00 0.00 0.00 4.09
4353 4569 3.908103 ACTAAGGGACCTAAACAAGCTCA 59.092 43.478 0.00 0.00 0.00 4.26
4396 4612 5.619220 TGGCCTTGAAAATGTTAAAAGCAT 58.381 33.333 3.32 0.00 0.00 3.79
4456 4678 3.123621 CGGCTCACTAAACTGACATTGTC 59.876 47.826 9.93 9.93 0.00 3.18
4505 4745 3.672808 CAGTCCAGAAGTTGAAGCAGAT 58.327 45.455 0.00 0.00 0.00 2.90
4514 4754 6.203530 CAGAAGTTGAAGCAGATGTACTTGAA 59.796 38.462 0.00 0.00 0.00 2.69
4588 4830 2.537633 ACGAGGTACCCATACTGGAA 57.462 50.000 8.74 0.00 40.96 3.53
4591 4833 2.037251 CGAGGTACCCATACTGGAATGG 59.963 54.545 8.74 4.74 45.20 3.16
4594 4836 3.971971 AGGTACCCATACTGGAATGGTAC 59.028 47.826 8.74 11.13 44.29 3.34
4599 4841 2.512056 CCATACTGGAATGGTACCCCAA 59.488 50.000 10.07 0.00 41.95 4.12
4613 4876 0.392706 CCCCAAAGGACCTGCAAAAC 59.607 55.000 0.00 0.00 38.24 2.43
4640 4903 0.960364 TCTTGGAATGCGGCCAACTC 60.960 55.000 2.24 0.00 40.32 3.01
4645 4908 2.051804 GAATGCGGCCAACTCGGATG 62.052 60.000 2.24 0.00 38.60 3.51
4648 4911 2.332654 GCGGCCAACTCGGATGTTT 61.333 57.895 2.24 0.00 36.56 2.83
4654 4917 1.812571 CCAACTCGGATGTTTTCCTGG 59.187 52.381 0.00 0.00 42.99 4.45
4669 4935 0.674895 CCTGGACTTGAGGCTTTCCG 60.675 60.000 0.00 0.00 37.47 4.30
4680 4946 1.002087 AGGCTTTCCGTCATCTTCGTT 59.998 47.619 0.00 0.00 37.47 3.85
4701 4967 0.510359 GCTCTGTCTTGTTCACTGCG 59.490 55.000 0.00 0.00 0.00 5.18
4727 4993 4.969999 TGGTACACCTTACCAGGCAATATA 59.030 41.667 0.00 0.00 45.56 0.86
4729 4995 4.086706 ACACCTTACCAGGCAATATAGC 57.913 45.455 0.00 0.00 45.56 2.97
4773 5048 5.620738 ACTGTATATCAGATGTTGCCACT 57.379 39.130 8.56 0.00 46.27 4.00
4799 5074 1.891919 GTCGCTTCCAACACTGCCA 60.892 57.895 0.00 0.00 0.00 4.92
4805 5080 0.813610 TTCCAACACTGCCACAGTCG 60.814 55.000 0.00 0.00 43.43 4.18
4818 5093 1.528586 CACAGTCGCTTGAGGAGTTTG 59.471 52.381 0.00 0.00 0.00 2.93
4824 5099 3.429207 GTCGCTTGAGGAGTTTGTACTTC 59.571 47.826 0.00 0.00 33.84 3.01
4845 5120 6.541641 ACTTCTATTCTGCAATGATGAGTTCC 59.458 38.462 0.00 0.00 0.00 3.62
4862 5137 1.996798 TCCTGGAGTCTTGTCGAACT 58.003 50.000 0.00 0.00 0.00 3.01
4865 5140 2.557056 CCTGGAGTCTTGTCGAACTGTA 59.443 50.000 0.00 0.00 0.00 2.74
4918 5200 7.418254 GCACATCCCCAAGAAAAGATTTCATAT 60.418 37.037 5.71 0.00 0.00 1.78
4919 5201 7.924412 CACATCCCCAAGAAAAGATTTCATATG 59.076 37.037 0.00 0.00 0.00 1.78
4937 5219 6.836242 TCATATGTGTAATACTGCAATCCCA 58.164 36.000 1.90 0.00 0.00 4.37
4942 5224 5.714333 TGTGTAATACTGCAATCCCATTTGT 59.286 36.000 0.00 0.00 0.00 2.83
4957 5239 4.273235 CCCATTTGTTGCCTTGTTCTTTTC 59.727 41.667 0.00 0.00 0.00 2.29
4958 5240 4.874966 CCATTTGTTGCCTTGTTCTTTTCA 59.125 37.500 0.00 0.00 0.00 2.69
4960 5242 6.038492 CCATTTGTTGCCTTGTTCTTTTCATT 59.962 34.615 0.00 0.00 0.00 2.57
4969 5251 8.203485 TGCCTTGTTCTTTTCATTTTTGTATCT 58.797 29.630 0.00 0.00 0.00 1.98
4970 5252 9.691362 GCCTTGTTCTTTTCATTTTTGTATCTA 57.309 29.630 0.00 0.00 0.00 1.98
4983 5265 9.017669 CATTTTTGTATCTAGAAAGATGCTTGC 57.982 33.333 0.00 0.00 43.21 4.01
4984 5266 5.973651 TTGTATCTAGAAAGATGCTTGCG 57.026 39.130 0.00 0.00 43.21 4.85
4985 5267 5.011090 TGTATCTAGAAAGATGCTTGCGT 57.989 39.130 0.00 0.00 43.21 5.24
4986 5268 5.043903 TGTATCTAGAAAGATGCTTGCGTC 58.956 41.667 6.71 6.71 43.21 5.19
4987 5269 3.592898 TCTAGAAAGATGCTTGCGTCA 57.407 42.857 15.93 0.00 0.00 4.35
4988 5270 4.128925 TCTAGAAAGATGCTTGCGTCAT 57.871 40.909 15.93 2.38 0.00 3.06
4990 5272 5.660460 TCTAGAAAGATGCTTGCGTCATTA 58.340 37.500 15.93 3.55 0.00 1.90
4992 5274 4.974591 AGAAAGATGCTTGCGTCATTAAC 58.025 39.130 15.93 1.64 0.00 2.01
5012 5294 9.171701 CATTAACGATCTACTACTTACTCTTGC 57.828 37.037 0.00 0.00 0.00 4.01
5013 5295 8.503458 TTAACGATCTACTACTTACTCTTGCT 57.497 34.615 0.00 0.00 0.00 3.91
5014 5296 9.605275 TTAACGATCTACTACTTACTCTTGCTA 57.395 33.333 0.00 0.00 0.00 3.49
5015 5297 8.503458 AACGATCTACTACTTACTCTTGCTAA 57.497 34.615 0.00 0.00 0.00 3.09
5016 5298 8.145316 ACGATCTACTACTTACTCTTGCTAAG 57.855 38.462 0.00 0.00 0.00 2.18
5017 5299 7.769970 ACGATCTACTACTTACTCTTGCTAAGT 59.230 37.037 0.00 1.52 37.96 2.24
5018 5300 8.614346 CGATCTACTACTTACTCTTGCTAAGTT 58.386 37.037 1.19 0.00 36.18 2.66
5021 5303 9.075678 TCTACTACTTACTCTTGCTAAGTTTGT 57.924 33.333 1.19 4.40 36.18 2.83
5022 5304 9.694137 CTACTACTTACTCTTGCTAAGTTTGTT 57.306 33.333 1.19 0.00 36.18 2.83
5023 5305 8.590719 ACTACTTACTCTTGCTAAGTTTGTTC 57.409 34.615 1.19 0.00 36.18 3.18
5024 5306 8.202137 ACTACTTACTCTTGCTAAGTTTGTTCA 58.798 33.333 1.19 0.00 36.18 3.18
5025 5307 9.209175 CTACTTACTCTTGCTAAGTTTGTTCAT 57.791 33.333 1.19 0.00 36.18 2.57
5026 5308 8.089115 ACTTACTCTTGCTAAGTTTGTTCATC 57.911 34.615 0.00 0.00 31.59 2.92
5027 5309 5.948992 ACTCTTGCTAAGTTTGTTCATCC 57.051 39.130 0.00 0.00 0.00 3.51
5028 5310 5.376625 ACTCTTGCTAAGTTTGTTCATCCA 58.623 37.500 0.00 0.00 0.00 3.41
5029 5311 5.239525 ACTCTTGCTAAGTTTGTTCATCCAC 59.760 40.000 0.00 0.00 0.00 4.02
5030 5312 5.376625 TCTTGCTAAGTTTGTTCATCCACT 58.623 37.500 0.00 0.00 0.00 4.00
5031 5313 5.827797 TCTTGCTAAGTTTGTTCATCCACTT 59.172 36.000 0.00 0.00 33.95 3.16
5032 5314 5.437289 TGCTAAGTTTGTTCATCCACTTG 57.563 39.130 0.00 0.00 31.83 3.16
5033 5315 4.278170 TGCTAAGTTTGTTCATCCACTTGG 59.722 41.667 0.00 0.00 31.83 3.61
5034 5316 3.733443 AAGTTTGTTCATCCACTTGGC 57.267 42.857 0.00 0.00 34.44 4.52
5035 5317 2.665165 AGTTTGTTCATCCACTTGGCA 58.335 42.857 0.00 0.00 34.44 4.92
5036 5318 2.624838 AGTTTGTTCATCCACTTGGCAG 59.375 45.455 0.00 0.00 34.44 4.85
5037 5319 0.961019 TTGTTCATCCACTTGGCAGC 59.039 50.000 0.00 0.00 34.44 5.25
5038 5320 0.895100 TGTTCATCCACTTGGCAGCC 60.895 55.000 3.66 3.66 34.44 4.85
5039 5321 0.610232 GTTCATCCACTTGGCAGCCT 60.610 55.000 14.15 0.00 34.44 4.58
5040 5322 0.112995 TTCATCCACTTGGCAGCCTT 59.887 50.000 14.15 0.00 34.44 4.35
5041 5323 0.112995 TCATCCACTTGGCAGCCTTT 59.887 50.000 14.15 0.00 34.44 3.11
5042 5324 0.245539 CATCCACTTGGCAGCCTTTG 59.754 55.000 14.15 6.76 34.44 2.77
5043 5325 0.112995 ATCCACTTGGCAGCCTTTGA 59.887 50.000 14.15 2.61 34.44 2.69
5044 5326 0.106268 TCCACTTGGCAGCCTTTGAA 60.106 50.000 14.15 0.00 34.44 2.69
5045 5327 0.316204 CCACTTGGCAGCCTTTGAAG 59.684 55.000 14.15 10.33 0.00 3.02
5046 5328 1.321474 CACTTGGCAGCCTTTGAAGA 58.679 50.000 14.15 0.00 0.00 2.87
5047 5329 1.682854 CACTTGGCAGCCTTTGAAGAA 59.317 47.619 14.15 0.00 0.00 2.52
5048 5330 1.959282 ACTTGGCAGCCTTTGAAGAAG 59.041 47.619 14.15 8.42 0.00 2.85
5049 5331 2.233271 CTTGGCAGCCTTTGAAGAAGA 58.767 47.619 14.15 0.00 0.00 2.87
5050 5332 2.363306 TGGCAGCCTTTGAAGAAGAA 57.637 45.000 14.15 0.00 0.00 2.52
5051 5333 2.233271 TGGCAGCCTTTGAAGAAGAAG 58.767 47.619 14.15 0.00 0.00 2.85
5052 5334 2.158623 TGGCAGCCTTTGAAGAAGAAGA 60.159 45.455 14.15 0.00 0.00 2.87
5053 5335 2.887152 GGCAGCCTTTGAAGAAGAAGAA 59.113 45.455 3.29 0.00 0.00 2.52
5054 5336 3.057666 GGCAGCCTTTGAAGAAGAAGAAG 60.058 47.826 3.29 0.00 0.00 2.85
5055 5337 3.817647 GCAGCCTTTGAAGAAGAAGAAGA 59.182 43.478 0.00 0.00 0.00 2.87
5056 5338 4.276926 GCAGCCTTTGAAGAAGAAGAAGAA 59.723 41.667 0.00 0.00 0.00 2.52
5057 5339 5.756849 CAGCCTTTGAAGAAGAAGAAGAAC 58.243 41.667 0.00 0.00 0.00 3.01
5058 5340 4.513318 AGCCTTTGAAGAAGAAGAAGAACG 59.487 41.667 0.00 0.00 0.00 3.95
5059 5341 4.511826 GCCTTTGAAGAAGAAGAAGAACGA 59.488 41.667 0.00 0.00 0.00 3.85
5060 5342 5.333721 GCCTTTGAAGAAGAAGAAGAACGAG 60.334 44.000 0.00 0.00 0.00 4.18
5061 5343 5.986135 CCTTTGAAGAAGAAGAAGAACGAGA 59.014 40.000 0.00 0.00 0.00 4.04
5062 5344 6.480320 CCTTTGAAGAAGAAGAAGAACGAGAA 59.520 38.462 0.00 0.00 0.00 2.87
5063 5345 7.307101 CCTTTGAAGAAGAAGAAGAACGAGAAG 60.307 40.741 0.00 0.00 0.00 2.85
5064 5346 4.985409 TGAAGAAGAAGAAGAACGAGAAGC 59.015 41.667 0.00 0.00 0.00 3.86
5065 5347 4.592485 AGAAGAAGAAGAACGAGAAGCA 57.408 40.909 0.00 0.00 0.00 3.91
5066 5348 4.555262 AGAAGAAGAAGAACGAGAAGCAG 58.445 43.478 0.00 0.00 0.00 4.24
5067 5349 4.279671 AGAAGAAGAAGAACGAGAAGCAGA 59.720 41.667 0.00 0.00 0.00 4.26
5068 5350 4.592485 AGAAGAAGAACGAGAAGCAGAA 57.408 40.909 0.00 0.00 0.00 3.02
5069 5351 4.555262 AGAAGAAGAACGAGAAGCAGAAG 58.445 43.478 0.00 0.00 0.00 2.85
5070 5352 4.279671 AGAAGAAGAACGAGAAGCAGAAGA 59.720 41.667 0.00 0.00 0.00 2.87
5071 5353 4.592485 AGAAGAACGAGAAGCAGAAGAA 57.408 40.909 0.00 0.00 0.00 2.52
5072 5354 4.555262 AGAAGAACGAGAAGCAGAAGAAG 58.445 43.478 0.00 0.00 0.00 2.85
5073 5355 4.279671 AGAAGAACGAGAAGCAGAAGAAGA 59.720 41.667 0.00 0.00 0.00 2.87
5074 5356 4.592485 AGAACGAGAAGCAGAAGAAGAA 57.408 40.909 0.00 0.00 0.00 2.52
5075 5357 4.555262 AGAACGAGAAGCAGAAGAAGAAG 58.445 43.478 0.00 0.00 0.00 2.85
5076 5358 4.279671 AGAACGAGAAGCAGAAGAAGAAGA 59.720 41.667 0.00 0.00 0.00 2.87
5077 5359 4.592485 ACGAGAAGCAGAAGAAGAAGAA 57.408 40.909 0.00 0.00 0.00 2.52
5078 5360 4.555262 ACGAGAAGCAGAAGAAGAAGAAG 58.445 43.478 0.00 0.00 0.00 2.85
5079 5361 4.279671 ACGAGAAGCAGAAGAAGAAGAAGA 59.720 41.667 0.00 0.00 0.00 2.87
5080 5362 5.221342 ACGAGAAGCAGAAGAAGAAGAAGAA 60.221 40.000 0.00 0.00 0.00 2.52
5081 5363 5.345741 CGAGAAGCAGAAGAAGAAGAAGAAG 59.654 44.000 0.00 0.00 0.00 2.85
5082 5364 6.418057 AGAAGCAGAAGAAGAAGAAGAAGA 57.582 37.500 0.00 0.00 0.00 2.87
5083 5365 6.825610 AGAAGCAGAAGAAGAAGAAGAAGAA 58.174 36.000 0.00 0.00 0.00 2.52
5084 5366 6.930722 AGAAGCAGAAGAAGAAGAAGAAGAAG 59.069 38.462 0.00 0.00 0.00 2.85
5085 5367 6.418057 AGCAGAAGAAGAAGAAGAAGAAGA 57.582 37.500 0.00 0.00 0.00 2.87
5086 5368 6.825610 AGCAGAAGAAGAAGAAGAAGAAGAA 58.174 36.000 0.00 0.00 0.00 2.52
5087 5369 6.930722 AGCAGAAGAAGAAGAAGAAGAAGAAG 59.069 38.462 0.00 0.00 0.00 2.85
5088 5370 6.928492 GCAGAAGAAGAAGAAGAAGAAGAAGA 59.072 38.462 0.00 0.00 0.00 2.87
5089 5371 7.440856 GCAGAAGAAGAAGAAGAAGAAGAAGAA 59.559 37.037 0.00 0.00 0.00 2.52
5090 5372 8.981647 CAGAAGAAGAAGAAGAAGAAGAAGAAG 58.018 37.037 0.00 0.00 0.00 2.85
5091 5373 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
5092 5374 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
5093 5375 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
5094 5376 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
5095 5377 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
5096 5378 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
5097 5379 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
5098 5380 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
5099 5381 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
5100 5382 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
5101 5383 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
5102 5384 9.898152 AAGAAGAAGAAGAAGAAGAAGAAGAAA 57.102 29.630 0.00 0.00 0.00 2.52
5103 5385 9.546428 AGAAGAAGAAGAAGAAGAAGAAGAAAG 57.454 33.333 0.00 0.00 0.00 2.62
5104 5386 7.728847 AGAAGAAGAAGAAGAAGAAGAAAGC 57.271 36.000 0.00 0.00 0.00 3.51
5105 5387 7.278875 AGAAGAAGAAGAAGAAGAAGAAAGCA 58.721 34.615 0.00 0.00 0.00 3.91
5106 5388 7.938490 AGAAGAAGAAGAAGAAGAAGAAAGCAT 59.062 33.333 0.00 0.00 0.00 3.79
5107 5389 8.462589 AAGAAGAAGAAGAAGAAGAAAGCATT 57.537 30.769 0.00 0.00 0.00 3.56
5108 5390 7.873910 AGAAGAAGAAGAAGAAGAAAGCATTG 58.126 34.615 0.00 0.00 0.00 2.82
5109 5391 7.718753 AGAAGAAGAAGAAGAAGAAAGCATTGA 59.281 33.333 0.00 0.00 0.00 2.57
5110 5392 7.200778 AGAAGAAGAAGAAGAAAGCATTGAC 57.799 36.000 0.00 0.00 0.00 3.18
5111 5393 6.997476 AGAAGAAGAAGAAGAAAGCATTGACT 59.003 34.615 0.00 0.00 0.00 3.41
5112 5394 8.153550 AGAAGAAGAAGAAGAAAGCATTGACTA 58.846 33.333 0.00 0.00 0.00 2.59
5113 5395 7.903995 AGAAGAAGAAGAAAGCATTGACTAG 57.096 36.000 0.00 0.00 0.00 2.57
5114 5396 7.449247 AGAAGAAGAAGAAAGCATTGACTAGT 58.551 34.615 0.00 0.00 0.00 2.57
5115 5397 7.602265 AGAAGAAGAAGAAAGCATTGACTAGTC 59.398 37.037 16.32 16.32 0.00 2.59
5116 5398 7.003402 AGAAGAAGAAAGCATTGACTAGTCT 57.997 36.000 23.01 1.36 0.00 3.24
5117 5399 6.873076 AGAAGAAGAAAGCATTGACTAGTCTG 59.127 38.462 23.01 14.96 0.00 3.51
5118 5400 6.352016 AGAAGAAAGCATTGACTAGTCTGA 57.648 37.500 23.01 12.44 0.00 3.27
5119 5401 6.945218 AGAAGAAAGCATTGACTAGTCTGAT 58.055 36.000 23.01 14.06 0.00 2.90
5120 5402 6.817641 AGAAGAAAGCATTGACTAGTCTGATG 59.182 38.462 23.01 23.56 0.00 3.07
5121 5403 5.426504 AGAAAGCATTGACTAGTCTGATGG 58.573 41.667 26.68 14.66 0.00 3.51
5122 5404 3.834489 AGCATTGACTAGTCTGATGGG 57.166 47.619 26.68 13.65 0.00 4.00
5123 5405 3.378512 AGCATTGACTAGTCTGATGGGA 58.621 45.455 26.68 7.17 0.00 4.37
5124 5406 3.133721 AGCATTGACTAGTCTGATGGGAC 59.866 47.826 26.68 17.10 36.56 4.46
5125 5407 3.133721 GCATTGACTAGTCTGATGGGACT 59.866 47.826 26.68 2.73 46.68 3.85
5126 5408 4.691175 CATTGACTAGTCTGATGGGACTG 58.309 47.826 23.01 2.71 44.98 3.51
5127 5409 2.103373 TGACTAGTCTGATGGGACTGC 58.897 52.381 23.01 0.00 44.98 4.40
5128 5410 2.291865 TGACTAGTCTGATGGGACTGCT 60.292 50.000 23.01 0.00 44.98 4.24
5129 5411 2.763448 GACTAGTCTGATGGGACTGCTT 59.237 50.000 15.91 0.00 44.98 3.91
5130 5412 2.763448 ACTAGTCTGATGGGACTGCTTC 59.237 50.000 7.31 0.00 44.98 3.86
5131 5413 1.649321 AGTCTGATGGGACTGCTTCA 58.351 50.000 0.00 0.00 43.89 3.02
5132 5414 2.194859 AGTCTGATGGGACTGCTTCAT 58.805 47.619 0.00 0.00 43.89 2.57
5133 5415 2.093075 AGTCTGATGGGACTGCTTCATG 60.093 50.000 0.00 0.00 43.89 3.07
5134 5416 1.022735 CTGATGGGACTGCTTCATGC 58.977 55.000 0.00 0.00 43.25 4.06
5148 5430 5.557891 GCTTCATGCAACTCTAATGACTT 57.442 39.130 0.00 0.00 42.31 3.01
5149 5431 5.947443 GCTTCATGCAACTCTAATGACTTT 58.053 37.500 0.00 0.00 42.31 2.66
5150 5432 5.798934 GCTTCATGCAACTCTAATGACTTTG 59.201 40.000 0.00 0.00 42.31 2.77
5151 5433 5.885230 TCATGCAACTCTAATGACTTTGG 57.115 39.130 0.00 0.00 0.00 3.28
5152 5434 5.316167 TCATGCAACTCTAATGACTTTGGT 58.684 37.500 0.00 0.00 0.00 3.67
5153 5435 5.181811 TCATGCAACTCTAATGACTTTGGTG 59.818 40.000 0.00 0.00 0.00 4.17
5154 5436 3.820467 TGCAACTCTAATGACTTTGGTGG 59.180 43.478 0.00 0.00 0.00 4.61
5155 5437 3.191371 GCAACTCTAATGACTTTGGTGGG 59.809 47.826 0.00 0.00 0.00 4.61
5156 5438 4.651778 CAACTCTAATGACTTTGGTGGGA 58.348 43.478 0.00 0.00 0.00 4.37
5157 5439 5.256474 CAACTCTAATGACTTTGGTGGGAT 58.744 41.667 0.00 0.00 0.00 3.85
5158 5440 5.520748 ACTCTAATGACTTTGGTGGGATT 57.479 39.130 0.00 0.00 0.00 3.01
5159 5441 5.256474 ACTCTAATGACTTTGGTGGGATTG 58.744 41.667 0.00 0.00 0.00 2.67
5160 5442 5.222130 ACTCTAATGACTTTGGTGGGATTGT 60.222 40.000 0.00 0.00 0.00 2.71
5161 5443 5.640147 TCTAATGACTTTGGTGGGATTGTT 58.360 37.500 0.00 0.00 0.00 2.83
5162 5444 6.074648 TCTAATGACTTTGGTGGGATTGTTT 58.925 36.000 0.00 0.00 0.00 2.83
5163 5445 4.871933 ATGACTTTGGTGGGATTGTTTC 57.128 40.909 0.00 0.00 0.00 2.78
5164 5446 2.962421 TGACTTTGGTGGGATTGTTTCC 59.038 45.455 0.00 0.00 44.62 3.13
5165 5447 3.230976 GACTTTGGTGGGATTGTTTCCT 58.769 45.455 0.00 0.00 44.75 3.36
5166 5448 3.641436 GACTTTGGTGGGATTGTTTCCTT 59.359 43.478 0.00 0.00 44.75 3.36
5167 5449 3.641436 ACTTTGGTGGGATTGTTTCCTTC 59.359 43.478 0.00 0.00 44.75 3.46
5168 5450 1.904287 TGGTGGGATTGTTTCCTTCG 58.096 50.000 0.00 0.00 44.75 3.79
5169 5451 1.144093 TGGTGGGATTGTTTCCTTCGT 59.856 47.619 0.00 0.00 44.75 3.85
5170 5452 1.539827 GGTGGGATTGTTTCCTTCGTG 59.460 52.381 0.00 0.00 44.75 4.35
5171 5453 2.500229 GTGGGATTGTTTCCTTCGTGA 58.500 47.619 0.00 0.00 44.75 4.35
5172 5454 2.484264 GTGGGATTGTTTCCTTCGTGAG 59.516 50.000 0.00 0.00 44.75 3.51
5173 5455 2.370519 TGGGATTGTTTCCTTCGTGAGA 59.629 45.455 0.00 0.00 44.75 3.27
5174 5456 3.009033 TGGGATTGTTTCCTTCGTGAGAT 59.991 43.478 0.00 0.00 44.75 2.75
5175 5457 3.623510 GGGATTGTTTCCTTCGTGAGATC 59.376 47.826 0.00 0.00 44.75 2.75
5176 5458 4.253685 GGATTGTTTCCTTCGTGAGATCA 58.746 43.478 0.00 0.00 41.78 2.92
5177 5459 4.878397 GGATTGTTTCCTTCGTGAGATCAT 59.122 41.667 0.00 0.00 41.78 2.45
5178 5460 6.049149 GGATTGTTTCCTTCGTGAGATCATA 58.951 40.000 0.00 0.00 41.78 2.15
5179 5461 6.018669 GGATTGTTTCCTTCGTGAGATCATAC 60.019 42.308 0.00 0.00 41.78 2.39
5180 5462 4.421058 TGTTTCCTTCGTGAGATCATACG 58.579 43.478 13.56 13.56 41.60 3.06
5181 5463 4.157105 TGTTTCCTTCGTGAGATCATACGA 59.843 41.667 17.10 17.10 46.31 3.43
5187 5469 2.872858 TCGTGAGATCATACGACTCTGG 59.127 50.000 17.10 0.00 43.54 3.86
5188 5470 2.603412 CGTGAGATCATACGACTCTGGC 60.603 54.545 14.31 0.00 42.54 4.85
5189 5471 2.621055 GTGAGATCATACGACTCTGGCT 59.379 50.000 0.00 0.00 0.00 4.75
5190 5472 3.067461 GTGAGATCATACGACTCTGGCTT 59.933 47.826 0.00 0.00 0.00 4.35
5191 5473 4.276183 GTGAGATCATACGACTCTGGCTTA 59.724 45.833 0.00 0.00 0.00 3.09
5192 5474 4.517075 TGAGATCATACGACTCTGGCTTAG 59.483 45.833 0.00 0.00 0.00 2.18
5193 5475 3.823873 AGATCATACGACTCTGGCTTAGG 59.176 47.826 0.00 0.00 0.00 2.69
5194 5476 3.292492 TCATACGACTCTGGCTTAGGA 57.708 47.619 0.00 0.00 0.00 2.94
5195 5477 3.628008 TCATACGACTCTGGCTTAGGAA 58.372 45.455 0.00 0.00 0.00 3.36
5196 5478 4.215908 TCATACGACTCTGGCTTAGGAAT 58.784 43.478 0.00 0.00 0.00 3.01
5197 5479 4.278669 TCATACGACTCTGGCTTAGGAATC 59.721 45.833 0.00 0.00 0.00 2.52
5198 5480 1.757699 ACGACTCTGGCTTAGGAATCC 59.242 52.381 0.00 0.00 0.00 3.01
5199 5481 1.757118 CGACTCTGGCTTAGGAATCCA 59.243 52.381 0.61 0.00 0.00 3.41
5200 5482 2.366916 CGACTCTGGCTTAGGAATCCAT 59.633 50.000 0.61 0.00 0.00 3.41
5201 5483 3.181461 CGACTCTGGCTTAGGAATCCATT 60.181 47.826 0.61 0.00 0.00 3.16
5202 5484 4.684485 CGACTCTGGCTTAGGAATCCATTT 60.684 45.833 0.61 0.00 0.00 2.32
5203 5485 5.453339 CGACTCTGGCTTAGGAATCCATTTA 60.453 44.000 0.61 0.00 0.00 1.40
5204 5486 5.934781 ACTCTGGCTTAGGAATCCATTTAG 58.065 41.667 0.61 0.00 0.00 1.85
5205 5487 4.718961 TCTGGCTTAGGAATCCATTTAGC 58.281 43.478 0.61 4.33 0.00 3.09
5206 5488 4.165950 TCTGGCTTAGGAATCCATTTAGCA 59.834 41.667 0.61 0.00 0.00 3.49
5207 5489 4.464008 TGGCTTAGGAATCCATTTAGCAG 58.536 43.478 0.61 0.00 0.00 4.24
5208 5490 3.254411 GGCTTAGGAATCCATTTAGCAGC 59.746 47.826 0.61 0.00 0.00 5.25
5209 5491 3.885297 GCTTAGGAATCCATTTAGCAGCA 59.115 43.478 0.61 0.00 0.00 4.41
5210 5492 4.261363 GCTTAGGAATCCATTTAGCAGCAC 60.261 45.833 0.61 0.00 0.00 4.40
5211 5493 3.370840 AGGAATCCATTTAGCAGCACA 57.629 42.857 0.61 0.00 0.00 4.57
5212 5494 3.700538 AGGAATCCATTTAGCAGCACAA 58.299 40.909 0.61 0.00 0.00 3.33
5213 5495 3.445096 AGGAATCCATTTAGCAGCACAAC 59.555 43.478 0.61 0.00 0.00 3.32
5214 5496 3.193267 GGAATCCATTTAGCAGCACAACA 59.807 43.478 0.00 0.00 0.00 3.33
5215 5497 4.321899 GGAATCCATTTAGCAGCACAACAA 60.322 41.667 0.00 0.00 0.00 2.83
5216 5498 3.921119 TCCATTTAGCAGCACAACAAG 57.079 42.857 0.00 0.00 0.00 3.16
5217 5499 3.485394 TCCATTTAGCAGCACAACAAGA 58.515 40.909 0.00 0.00 0.00 3.02
5218 5500 3.253188 TCCATTTAGCAGCACAACAAGAC 59.747 43.478 0.00 0.00 0.00 3.01
5219 5501 3.004629 CCATTTAGCAGCACAACAAGACA 59.995 43.478 0.00 0.00 0.00 3.41
5220 5502 3.969117 TTTAGCAGCACAACAAGACAG 57.031 42.857 0.00 0.00 0.00 3.51
5221 5503 2.620251 TAGCAGCACAACAAGACAGT 57.380 45.000 0.00 0.00 0.00 3.55
5222 5504 2.620251 AGCAGCACAACAAGACAGTA 57.380 45.000 0.00 0.00 0.00 2.74
5223 5505 2.487934 AGCAGCACAACAAGACAGTAG 58.512 47.619 0.00 0.00 0.00 2.57
5224 5506 2.158900 AGCAGCACAACAAGACAGTAGT 60.159 45.455 0.00 0.00 0.00 2.73
5225 5507 2.221981 GCAGCACAACAAGACAGTAGTC 59.778 50.000 0.00 0.00 45.31 2.59
5226 5508 2.802816 CAGCACAACAAGACAGTAGTCC 59.197 50.000 0.00 0.00 46.15 3.85
5227 5509 2.700897 AGCACAACAAGACAGTAGTCCT 59.299 45.455 0.00 0.00 46.15 3.85
5228 5510 2.802816 GCACAACAAGACAGTAGTCCTG 59.197 50.000 0.00 0.00 46.15 3.86
5237 5519 1.160137 CAGTAGTCCTGTTTGCTGCC 58.840 55.000 0.00 0.00 36.37 4.85
5238 5520 1.059913 AGTAGTCCTGTTTGCTGCCT 58.940 50.000 0.00 0.00 0.00 4.75
5239 5521 1.421646 AGTAGTCCTGTTTGCTGCCTT 59.578 47.619 0.00 0.00 0.00 4.35
5240 5522 1.537202 GTAGTCCTGTTTGCTGCCTTG 59.463 52.381 0.00 0.00 0.00 3.61
5241 5523 0.106519 AGTCCTGTTTGCTGCCTTGT 60.107 50.000 0.00 0.00 0.00 3.16
5242 5524 0.746659 GTCCTGTTTGCTGCCTTGTT 59.253 50.000 0.00 0.00 0.00 2.83
5243 5525 1.136891 GTCCTGTTTGCTGCCTTGTTT 59.863 47.619 0.00 0.00 0.00 2.83
5244 5526 1.830477 TCCTGTTTGCTGCCTTGTTTT 59.170 42.857 0.00 0.00 0.00 2.43
5245 5527 2.235898 TCCTGTTTGCTGCCTTGTTTTT 59.764 40.909 0.00 0.00 0.00 1.94
5246 5528 2.609002 CCTGTTTGCTGCCTTGTTTTTC 59.391 45.455 0.00 0.00 0.00 2.29
5247 5529 2.609002 CTGTTTGCTGCCTTGTTTTTCC 59.391 45.455 0.00 0.00 0.00 3.13
5248 5530 2.027745 TGTTTGCTGCCTTGTTTTTCCA 60.028 40.909 0.00 0.00 0.00 3.53
5249 5531 3.205338 GTTTGCTGCCTTGTTTTTCCAT 58.795 40.909 0.00 0.00 0.00 3.41
5250 5532 3.557228 TTGCTGCCTTGTTTTTCCATT 57.443 38.095 0.00 0.00 0.00 3.16
5251 5533 3.557228 TGCTGCCTTGTTTTTCCATTT 57.443 38.095 0.00 0.00 0.00 2.32
5252 5534 3.883669 TGCTGCCTTGTTTTTCCATTTT 58.116 36.364 0.00 0.00 0.00 1.82
5253 5535 3.626670 TGCTGCCTTGTTTTTCCATTTTG 59.373 39.130 0.00 0.00 0.00 2.44
5254 5536 3.627123 GCTGCCTTGTTTTTCCATTTTGT 59.373 39.130 0.00 0.00 0.00 2.83
5255 5537 4.813697 GCTGCCTTGTTTTTCCATTTTGTA 59.186 37.500 0.00 0.00 0.00 2.41
5256 5538 5.277297 GCTGCCTTGTTTTTCCATTTTGTAC 60.277 40.000 0.00 0.00 0.00 2.90
5257 5539 5.734720 TGCCTTGTTTTTCCATTTTGTACA 58.265 33.333 0.00 0.00 0.00 2.90
5258 5540 6.352516 TGCCTTGTTTTTCCATTTTGTACAT 58.647 32.000 0.00 0.00 0.00 2.29
5259 5541 6.259608 TGCCTTGTTTTTCCATTTTGTACATG 59.740 34.615 0.00 0.00 0.00 3.21
5260 5542 6.481644 GCCTTGTTTTTCCATTTTGTACATGA 59.518 34.615 0.00 0.00 0.00 3.07
5261 5543 7.011857 GCCTTGTTTTTCCATTTTGTACATGAA 59.988 33.333 0.00 0.00 0.00 2.57
5262 5544 8.887717 CCTTGTTTTTCCATTTTGTACATGAAA 58.112 29.630 0.00 0.00 0.00 2.69
5285 5567 7.530426 AAAAATTCCTTACTTGATGCTCTGT 57.470 32.000 0.00 0.00 0.00 3.41
5286 5568 7.530426 AAAATTCCTTACTTGATGCTCTGTT 57.470 32.000 0.00 0.00 0.00 3.16
5287 5569 6.749923 AATTCCTTACTTGATGCTCTGTTC 57.250 37.500 0.00 0.00 0.00 3.18
5288 5570 5.489792 TTCCTTACTTGATGCTCTGTTCT 57.510 39.130 0.00 0.00 0.00 3.01
5289 5571 4.825422 TCCTTACTTGATGCTCTGTTCTG 58.175 43.478 0.00 0.00 0.00 3.02
5290 5572 4.284490 TCCTTACTTGATGCTCTGTTCTGT 59.716 41.667 0.00 0.00 0.00 3.41
5291 5573 5.480422 TCCTTACTTGATGCTCTGTTCTGTA 59.520 40.000 0.00 0.00 0.00 2.74
5292 5574 5.578727 CCTTACTTGATGCTCTGTTCTGTAC 59.421 44.000 0.00 0.00 0.00 2.90
5293 5575 4.881019 ACTTGATGCTCTGTTCTGTACT 57.119 40.909 0.00 0.00 0.00 2.73
5294 5576 4.815269 ACTTGATGCTCTGTTCTGTACTC 58.185 43.478 0.00 0.00 0.00 2.59
5304 5586 7.093992 GCTCTGTTCTGTACTCTTATGTTTCT 58.906 38.462 0.00 0.00 0.00 2.52
5323 5605 3.813443 TCTTCATCCATTTGCTAGCCTC 58.187 45.455 13.29 0.00 0.00 4.70
5324 5606 3.200605 TCTTCATCCATTTGCTAGCCTCA 59.799 43.478 13.29 0.00 0.00 3.86
5325 5607 3.870538 TCATCCATTTGCTAGCCTCAT 57.129 42.857 13.29 0.00 0.00 2.90
5326 5608 3.483421 TCATCCATTTGCTAGCCTCATG 58.517 45.455 13.29 11.14 0.00 3.07
5327 5609 3.117776 TCATCCATTTGCTAGCCTCATGT 60.118 43.478 13.29 0.00 0.00 3.21
5328 5610 3.370840 TCCATTTGCTAGCCTCATGTT 57.629 42.857 13.29 0.00 0.00 2.71
5329 5611 3.700538 TCCATTTGCTAGCCTCATGTTT 58.299 40.909 13.29 0.00 0.00 2.83
5330 5612 3.444742 TCCATTTGCTAGCCTCATGTTTG 59.555 43.478 13.29 0.15 0.00 2.93
5331 5613 3.194116 CCATTTGCTAGCCTCATGTTTGT 59.806 43.478 13.29 0.00 0.00 2.83
5332 5614 4.398988 CCATTTGCTAGCCTCATGTTTGTA 59.601 41.667 13.29 0.00 0.00 2.41
5333 5615 5.105797 CCATTTGCTAGCCTCATGTTTGTAA 60.106 40.000 13.29 0.00 0.00 2.41
5334 5616 6.389091 CATTTGCTAGCCTCATGTTTGTAAA 58.611 36.000 13.29 1.52 0.00 2.01
5335 5617 6.588719 TTTGCTAGCCTCATGTTTGTAAAT 57.411 33.333 13.29 0.00 0.00 1.40
5336 5618 7.695480 TTTGCTAGCCTCATGTTTGTAAATA 57.305 32.000 13.29 0.00 0.00 1.40
5337 5619 7.880160 TTGCTAGCCTCATGTTTGTAAATAT 57.120 32.000 13.29 0.00 0.00 1.28
5338 5620 8.972458 TTGCTAGCCTCATGTTTGTAAATATA 57.028 30.769 13.29 0.00 0.00 0.86
5339 5621 9.573166 TTGCTAGCCTCATGTTTGTAAATATAT 57.427 29.630 13.29 0.00 0.00 0.86
5376 5658 1.143073 GTTTCCCTCCGCCCATCTAAT 59.857 52.381 0.00 0.00 0.00 1.73
5408 5690 3.465403 CCCTCCTCCACTCGCCTG 61.465 72.222 0.00 0.00 0.00 4.85
5497 5873 2.203252 CGCATGGGGATGACCTGG 60.203 66.667 0.89 0.00 40.03 4.45
5533 5909 3.443045 CGGTTGGTGGATGGCTGC 61.443 66.667 0.00 0.00 0.00 5.25
5541 5923 1.378531 GTGGATGGCTGCGTCATTTA 58.621 50.000 6.11 0.00 0.00 1.40
5569 5951 5.491323 AAAAAGGAACGGAATCTCTCTCT 57.509 39.130 0.00 0.00 0.00 3.10
5570 5952 4.729227 AAAGGAACGGAATCTCTCTCTC 57.271 45.455 0.00 0.00 0.00 3.20
5571 5953 3.662759 AGGAACGGAATCTCTCTCTCT 57.337 47.619 0.00 0.00 0.00 3.10
5572 5954 3.551846 AGGAACGGAATCTCTCTCTCTC 58.448 50.000 0.00 0.00 0.00 3.20
5573 5955 3.202151 AGGAACGGAATCTCTCTCTCTCT 59.798 47.826 0.00 0.00 0.00 3.10
5574 5956 3.564225 GGAACGGAATCTCTCTCTCTCTC 59.436 52.174 0.00 0.00 0.00 3.20
5575 5957 4.451900 GAACGGAATCTCTCTCTCTCTCT 58.548 47.826 0.00 0.00 0.00 3.10
5576 5958 4.073293 ACGGAATCTCTCTCTCTCTCTC 57.927 50.000 0.00 0.00 0.00 3.20
5577 5959 3.711704 ACGGAATCTCTCTCTCTCTCTCT 59.288 47.826 0.00 0.00 0.00 3.10
5578 5960 4.202264 ACGGAATCTCTCTCTCTCTCTCTC 60.202 50.000 0.00 0.00 0.00 3.20
5579 5961 4.039730 CGGAATCTCTCTCTCTCTCTCTCT 59.960 50.000 0.00 0.00 0.00 3.10
5580 5962 5.546526 GGAATCTCTCTCTCTCTCTCTCTC 58.453 50.000 0.00 0.00 0.00 3.20
5581 5963 5.306678 GGAATCTCTCTCTCTCTCTCTCTCT 59.693 48.000 0.00 0.00 0.00 3.10
5582 5964 6.418057 AATCTCTCTCTCTCTCTCTCTCTC 57.582 45.833 0.00 0.00 0.00 3.20
5591 5973 4.871822 TCTCTCTCTCTCTCTCTCTCTCA 58.128 47.826 0.00 0.00 0.00 3.27
5592 5974 5.462240 TCTCTCTCTCTCTCTCTCTCTCAT 58.538 45.833 0.00 0.00 0.00 2.90
5596 5978 7.901029 TCTCTCTCTCTCTCTCTCTCATATTC 58.099 42.308 0.00 0.00 0.00 1.75
5605 5987 2.564504 CTCTCTCATATTCCGCATCCCA 59.435 50.000 0.00 0.00 0.00 4.37
5606 5988 3.176411 TCTCTCATATTCCGCATCCCAT 58.824 45.455 0.00 0.00 0.00 4.00
5629 6011 4.748144 CCAAGCAGCCCACCTCCC 62.748 72.222 0.00 0.00 0.00 4.30
5651 6044 3.629449 ATCCCCACCCCCAATCCCA 62.629 63.158 0.00 0.00 0.00 4.37
5653 6046 3.272042 CCCACCCCCAATCCCACA 61.272 66.667 0.00 0.00 0.00 4.17
5677 6070 1.950630 CGTCGGCGATGATGATGCA 60.951 57.895 24.11 0.00 41.33 3.96
5687 6080 3.493176 CGATGATGATGCAGTTGGAGGTA 60.493 47.826 0.00 0.00 0.00 3.08
5708 6101 1.889105 CTGCGCTGGTGACACTGTT 60.889 57.895 9.73 0.00 35.60 3.16
5715 6108 2.287009 GCTGGTGACACTGTTTTACTGC 60.287 50.000 5.39 0.00 35.60 4.40
5716 6109 1.937223 TGGTGACACTGTTTTACTGCG 59.063 47.619 5.39 0.00 33.40 5.18
5750 6146 2.224523 CCACTCTTGGTTTCCTAGCACA 60.225 50.000 0.00 0.00 38.23 4.57
5799 6195 6.339730 CAATTGTTGATAAATGCAAGGCCTA 58.660 36.000 5.16 0.00 0.00 3.93
5810 6206 1.879796 GCAAGGCCTAATGAGATCCGG 60.880 57.143 5.16 0.00 0.00 5.14
5820 6216 4.819105 AATGAGATCCGGCGGATAATTA 57.181 40.909 38.89 26.61 43.27 1.40
5826 6222 6.323996 TGAGATCCGGCGGATAATTATAGATT 59.676 38.462 38.89 15.87 43.27 2.40
5862 6258 2.004733 CTTGTATCGGGGTTTTCGTCC 58.995 52.381 0.00 0.00 0.00 4.79
5863 6259 0.975135 TGTATCGGGGTTTTCGTCCA 59.025 50.000 0.00 0.00 0.00 4.02
5888 6284 2.109126 GCGTGAGGCAATGGAGTCC 61.109 63.158 0.73 0.73 42.87 3.85
5905 6301 1.840650 CCCCGGATCCTCATCAGCT 60.841 63.158 10.75 0.00 0.00 4.24
5928 6327 1.001597 CTCGCTGGTATTACGGGTCTC 60.002 57.143 0.00 0.00 0.00 3.36
5934 6333 0.659957 GTATTACGGGTCTCGACGCT 59.340 55.000 0.00 2.99 42.43 5.07
5939 6338 4.803426 GGGTCTCGACGCTGCTGG 62.803 72.222 6.84 0.00 40.60 4.85
5947 6346 3.670637 GACGCTGCTGGCTGGATCA 62.671 63.158 0.00 0.00 39.13 2.92
5962 6361 3.146066 TGGATCAAAAGGTCAAACGAGG 58.854 45.455 0.00 0.00 0.00 4.63
5966 6365 2.105134 TCAAAAGGTCAAACGAGGGCTA 59.895 45.455 0.00 0.00 0.00 3.93
5991 6390 1.544691 CTATTCCGGGGGTGAGATACG 59.455 57.143 0.00 0.00 0.00 3.06
5996 6395 1.830145 GGGGGTGAGATACGTGCAT 59.170 57.895 0.00 0.00 0.00 3.96
6002 6401 1.040646 TGAGATACGTGCATCCTCCC 58.959 55.000 0.00 0.00 0.00 4.30
6006 6405 1.410850 ATACGTGCATCCTCCCCCTG 61.411 60.000 0.00 0.00 0.00 4.45
6007 6406 2.523740 TACGTGCATCCTCCCCCTGA 62.524 60.000 0.00 0.00 0.00 3.86
6008 6407 2.446848 CGTGCATCCTCCCCCTGAT 61.447 63.158 0.00 0.00 0.00 2.90
6009 6408 1.121407 CGTGCATCCTCCCCCTGATA 61.121 60.000 0.00 0.00 0.00 2.15
6010 6409 1.366319 GTGCATCCTCCCCCTGATAT 58.634 55.000 0.00 0.00 0.00 1.63
6011 6410 1.280421 GTGCATCCTCCCCCTGATATC 59.720 57.143 0.00 0.00 0.00 1.63
6012 6411 1.132430 TGCATCCTCCCCCTGATATCA 60.132 52.381 5.07 5.07 0.00 2.15
6013 6412 1.280421 GCATCCTCCCCCTGATATCAC 59.720 57.143 0.00 0.00 0.00 3.06
6014 6413 2.913203 CATCCTCCCCCTGATATCACT 58.087 52.381 0.00 0.00 0.00 3.41
6015 6414 3.823061 GCATCCTCCCCCTGATATCACTA 60.823 52.174 0.00 0.00 0.00 2.74
6016 6415 3.544698 TCCTCCCCCTGATATCACTAC 57.455 52.381 0.00 0.00 0.00 2.73
6017 6416 3.072086 TCCTCCCCCTGATATCACTACT 58.928 50.000 0.00 0.00 0.00 2.57
6018 6417 3.169099 CCTCCCCCTGATATCACTACTG 58.831 54.545 0.00 0.00 0.00 2.74
6019 6418 2.564947 CTCCCCCTGATATCACTACTGC 59.435 54.545 0.00 0.00 0.00 4.40
6020 6419 2.090775 TCCCCCTGATATCACTACTGCA 60.091 50.000 0.00 0.00 0.00 4.41
6021 6420 2.301296 CCCCCTGATATCACTACTGCAG 59.699 54.545 13.48 13.48 0.00 4.41
6022 6421 2.301296 CCCCTGATATCACTACTGCAGG 59.699 54.545 19.93 3.21 41.88 4.85
6023 6422 3.234353 CCCTGATATCACTACTGCAGGA 58.766 50.000 19.93 9.06 44.27 3.86
6024 6423 3.643320 CCCTGATATCACTACTGCAGGAA 59.357 47.826 19.93 4.64 44.27 3.36
6025 6424 4.285517 CCCTGATATCACTACTGCAGGAAT 59.714 45.833 19.93 0.00 44.27 3.01
6026 6425 5.236282 CCTGATATCACTACTGCAGGAATG 58.764 45.833 19.93 10.49 44.27 2.67
6027 6426 5.219343 TGATATCACTACTGCAGGAATGG 57.781 43.478 19.93 0.00 0.00 3.16
6028 6427 2.338577 ATCACTACTGCAGGAATGGC 57.661 50.000 19.93 0.00 0.00 4.40
6029 6428 1.279496 TCACTACTGCAGGAATGGCT 58.721 50.000 19.93 0.00 0.00 4.75
6030 6429 2.466846 TCACTACTGCAGGAATGGCTA 58.533 47.619 19.93 0.00 0.00 3.93
6031 6430 2.432146 TCACTACTGCAGGAATGGCTAG 59.568 50.000 19.93 10.91 0.00 3.42
6032 6431 1.139853 ACTACTGCAGGAATGGCTAGC 59.860 52.381 19.93 6.04 0.00 3.42
6033 6432 1.139654 CTACTGCAGGAATGGCTAGCA 59.860 52.381 19.93 2.97 0.00 3.49
6034 6433 2.704108 CTGCAGGAATGGCTAGCAG 58.296 57.895 18.24 0.00 45.44 4.24
6035 6434 0.107312 CTGCAGGAATGGCTAGCAGT 60.107 55.000 18.24 1.62 45.57 4.40
6036 6435 0.329261 TGCAGGAATGGCTAGCAGTT 59.671 50.000 18.24 10.34 0.00 3.16
6037 6436 0.737219 GCAGGAATGGCTAGCAGTTG 59.263 55.000 18.24 6.77 0.00 3.16
6038 6437 0.737219 CAGGAATGGCTAGCAGTTGC 59.263 55.000 18.24 14.98 42.49 4.17
6045 6444 2.434185 CTAGCAGTTGCCGGCGAA 60.434 61.111 20.60 12.78 43.38 4.70
6046 6445 2.031314 TAGCAGTTGCCGGCGAAA 59.969 55.556 20.60 6.51 43.38 3.46
6047 6446 1.573829 CTAGCAGTTGCCGGCGAAAA 61.574 55.000 20.60 5.60 43.38 2.29
6048 6447 1.167155 TAGCAGTTGCCGGCGAAAAA 61.167 50.000 20.60 5.14 43.38 1.94
6082 6481 4.729918 GTCAGGCTGCCAGGGGTG 62.730 72.222 22.65 10.07 0.00 4.61
6087 6486 4.982701 GCTGCCAGGGGTGCTGTT 62.983 66.667 0.00 0.00 0.00 3.16
6088 6487 2.987547 CTGCCAGGGGTGCTGTTG 60.988 66.667 0.00 0.00 0.00 3.33
6089 6488 4.601794 TGCCAGGGGTGCTGTTGG 62.602 66.667 0.00 0.00 0.00 3.77
6091 6490 4.684134 CCAGGGGTGCTGTTGGGG 62.684 72.222 0.00 0.00 0.00 4.96
6092 6491 3.579302 CAGGGGTGCTGTTGGGGA 61.579 66.667 0.00 0.00 0.00 4.81
6093 6492 2.535317 AGGGGTGCTGTTGGGGAT 60.535 61.111 0.00 0.00 0.00 3.85
6094 6493 1.230149 AGGGGTGCTGTTGGGGATA 60.230 57.895 0.00 0.00 0.00 2.59
6095 6494 0.627469 AGGGGTGCTGTTGGGGATAT 60.627 55.000 0.00 0.00 0.00 1.63
6096 6495 0.261696 GGGGTGCTGTTGGGGATATT 59.738 55.000 0.00 0.00 0.00 1.28
6097 6496 1.342975 GGGGTGCTGTTGGGGATATTT 60.343 52.381 0.00 0.00 0.00 1.40
6098 6497 2.031870 GGGTGCTGTTGGGGATATTTC 58.968 52.381 0.00 0.00 0.00 2.17
6099 6498 2.031870 GGTGCTGTTGGGGATATTTCC 58.968 52.381 0.00 0.00 41.77 3.13
6111 6510 3.821748 GGATATTTCCCAGGACCAAGAC 58.178 50.000 0.00 0.00 35.84 3.01
6112 6511 3.435169 GGATATTTCCCAGGACCAAGACC 60.435 52.174 0.00 0.00 35.84 3.85
6113 6512 0.704664 ATTTCCCAGGACCAAGACCC 59.295 55.000 0.00 0.00 0.00 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.673644 CCTCCCCATGAACGTGTGTC 60.674 60.000 0.00 0.00 0.00 3.67
1 2 1.374947 CCTCCCCATGAACGTGTGT 59.625 57.895 0.00 0.00 0.00 3.72
2 3 1.377202 CCCTCCCCATGAACGTGTG 60.377 63.158 0.00 0.00 0.00 3.82
3 4 1.131303 TTCCCTCCCCATGAACGTGT 61.131 55.000 0.00 0.00 0.00 4.49
4 5 0.037590 TTTCCCTCCCCATGAACGTG 59.962 55.000 0.00 0.00 0.00 4.49
5 6 0.999712 ATTTCCCTCCCCATGAACGT 59.000 50.000 0.00 0.00 0.00 3.99
6 7 2.143876 AATTTCCCTCCCCATGAACG 57.856 50.000 0.00 0.00 0.00 3.95
7 8 6.367374 TTTTAAATTTCCCTCCCCATGAAC 57.633 37.500 0.00 0.00 0.00 3.18
8 9 7.581424 AATTTTAAATTTCCCTCCCCATGAA 57.419 32.000 0.00 0.00 0.00 2.57
9 10 8.868404 ATAATTTTAAATTTCCCTCCCCATGA 57.132 30.769 8.28 0.00 0.00 3.07
12 13 9.562226 TGTAATAATTTTAAATTTCCCTCCCCA 57.438 29.630 8.28 0.00 0.00 4.96
65 66 9.213777 AGAAGAATAGGTGATACATAAACCAGA 57.786 33.333 0.00 0.00 36.37 3.86
66 67 9.838339 AAGAAGAATAGGTGATACATAAACCAG 57.162 33.333 0.00 0.00 36.37 4.00
67 68 9.832445 GAAGAAGAATAGGTGATACATAAACCA 57.168 33.333 0.00 0.00 36.37 3.67
121 122 0.658244 TTTGACTTCCGACGTCGACG 60.658 55.000 37.65 34.58 43.02 5.12
122 123 1.647702 GATTTGACTTCCGACGTCGAC 59.352 52.381 37.65 21.59 43.02 4.20
123 124 1.401931 GGATTTGACTTCCGACGTCGA 60.402 52.381 37.65 21.13 43.02 4.20
124 125 0.989890 GGATTTGACTTCCGACGTCG 59.010 55.000 30.33 30.33 39.44 5.12
125 126 2.074547 TGGATTTGACTTCCGACGTC 57.925 50.000 5.18 5.18 35.94 4.34
126 127 2.762535 ATGGATTTGACTTCCGACGT 57.237 45.000 0.00 0.00 35.94 4.34
127 128 2.351726 GGAATGGATTTGACTTCCGACG 59.648 50.000 0.00 0.00 35.94 5.12
128 129 3.127030 GTGGAATGGATTTGACTTCCGAC 59.873 47.826 0.00 0.00 40.04 4.79
129 130 3.009033 AGTGGAATGGATTTGACTTCCGA 59.991 43.478 0.00 0.00 40.04 4.55
130 131 3.127548 CAGTGGAATGGATTTGACTTCCG 59.872 47.826 0.00 0.00 40.04 4.30
131 132 4.335416 TCAGTGGAATGGATTTGACTTCC 58.665 43.478 0.00 0.00 38.10 3.46
132 133 5.006386 ACTCAGTGGAATGGATTTGACTTC 58.994 41.667 0.00 0.00 0.00 3.01
133 134 4.990526 ACTCAGTGGAATGGATTTGACTT 58.009 39.130 0.00 0.00 0.00 3.01
134 135 4.288105 AGACTCAGTGGAATGGATTTGACT 59.712 41.667 0.00 0.00 0.00 3.41
135 136 4.583871 AGACTCAGTGGAATGGATTTGAC 58.416 43.478 0.00 0.00 0.00 3.18
136 137 4.916041 AGACTCAGTGGAATGGATTTGA 57.084 40.909 0.00 0.00 0.00 2.69
137 138 4.763793 ACAAGACTCAGTGGAATGGATTTG 59.236 41.667 0.00 0.00 0.00 2.32
138 139 4.763793 CACAAGACTCAGTGGAATGGATTT 59.236 41.667 0.00 0.00 32.24 2.17
139 140 4.330250 CACAAGACTCAGTGGAATGGATT 58.670 43.478 0.00 0.00 32.24 3.01
140 141 3.947868 CACAAGACTCAGTGGAATGGAT 58.052 45.455 0.00 0.00 32.24 3.41
141 142 3.407424 CACAAGACTCAGTGGAATGGA 57.593 47.619 0.00 0.00 32.24 3.41
148 149 2.223340 GCAAACACCACAAGACTCAGTG 60.223 50.000 0.00 1.95 35.56 3.66
149 150 2.017049 GCAAACACCACAAGACTCAGT 58.983 47.619 0.00 0.00 0.00 3.41
150 151 2.292267 AGCAAACACCACAAGACTCAG 58.708 47.619 0.00 0.00 0.00 3.35
151 152 2.418368 AGCAAACACCACAAGACTCA 57.582 45.000 0.00 0.00 0.00 3.41
152 153 3.248602 CACTAGCAAACACCACAAGACTC 59.751 47.826 0.00 0.00 0.00 3.36
153 154 3.206150 CACTAGCAAACACCACAAGACT 58.794 45.455 0.00 0.00 0.00 3.24
154 155 2.290641 CCACTAGCAAACACCACAAGAC 59.709 50.000 0.00 0.00 0.00 3.01
155 156 2.092646 ACCACTAGCAAACACCACAAGA 60.093 45.455 0.00 0.00 0.00 3.02
156 157 2.033299 CACCACTAGCAAACACCACAAG 59.967 50.000 0.00 0.00 0.00 3.16
157 158 2.020720 CACCACTAGCAAACACCACAA 58.979 47.619 0.00 0.00 0.00 3.33
158 159 1.065053 ACACCACTAGCAAACACCACA 60.065 47.619 0.00 0.00 0.00 4.17
159 160 1.333619 CACACCACTAGCAAACACCAC 59.666 52.381 0.00 0.00 0.00 4.16
160 161 1.210722 TCACACCACTAGCAAACACCA 59.789 47.619 0.00 0.00 0.00 4.17
161 162 1.961793 TCACACCACTAGCAAACACC 58.038 50.000 0.00 0.00 0.00 4.16
162 163 4.364415 TTTTCACACCACTAGCAAACAC 57.636 40.909 0.00 0.00 0.00 3.32
163 164 4.642437 TGATTTTCACACCACTAGCAAACA 59.358 37.500 0.00 0.00 0.00 2.83
164 165 5.008613 TCTGATTTTCACACCACTAGCAAAC 59.991 40.000 0.00 0.00 0.00 2.93
165 166 5.129634 TCTGATTTTCACACCACTAGCAAA 58.870 37.500 0.00 0.00 0.00 3.68
166 167 4.713553 TCTGATTTTCACACCACTAGCAA 58.286 39.130 0.00 0.00 0.00 3.91
167 168 4.350368 TCTGATTTTCACACCACTAGCA 57.650 40.909 0.00 0.00 0.00 3.49
168 169 5.689383 TTTCTGATTTTCACACCACTAGC 57.311 39.130 0.00 0.00 0.00 3.42
169 170 7.206981 ACATTTCTGATTTTCACACCACTAG 57.793 36.000 0.00 0.00 0.00 2.57
170 171 7.284261 TCAACATTTCTGATTTTCACACCACTA 59.716 33.333 0.00 0.00 0.00 2.74
171 172 6.096705 TCAACATTTCTGATTTTCACACCACT 59.903 34.615 0.00 0.00 0.00 4.00
172 173 6.272318 TCAACATTTCTGATTTTCACACCAC 58.728 36.000 0.00 0.00 0.00 4.16
173 174 6.462552 TCAACATTTCTGATTTTCACACCA 57.537 33.333 0.00 0.00 0.00 4.17
174 175 7.951530 ATTCAACATTTCTGATTTTCACACC 57.048 32.000 0.00 0.00 0.00 4.16
186 187 9.525409 GCTGCATTATTCTAATTCAACATTTCT 57.475 29.630 0.00 0.00 0.00 2.52
187 188 8.474577 CGCTGCATTATTCTAATTCAACATTTC 58.525 33.333 0.00 0.00 0.00 2.17
188 189 7.436080 CCGCTGCATTATTCTAATTCAACATTT 59.564 33.333 0.00 0.00 0.00 2.32
189 190 6.919662 CCGCTGCATTATTCTAATTCAACATT 59.080 34.615 0.00 0.00 0.00 2.71
190 191 6.262944 TCCGCTGCATTATTCTAATTCAACAT 59.737 34.615 0.00 0.00 0.00 2.71
191 192 5.588246 TCCGCTGCATTATTCTAATTCAACA 59.412 36.000 0.00 0.00 0.00 3.33
192 193 6.017934 TCTCCGCTGCATTATTCTAATTCAAC 60.018 38.462 0.00 0.00 0.00 3.18
193 194 6.017934 GTCTCCGCTGCATTATTCTAATTCAA 60.018 38.462 0.00 0.00 0.00 2.69
194 195 5.466728 GTCTCCGCTGCATTATTCTAATTCA 59.533 40.000 0.00 0.00 0.00 2.57
195 196 5.698545 AGTCTCCGCTGCATTATTCTAATTC 59.301 40.000 0.00 0.00 0.00 2.17
196 197 5.615289 AGTCTCCGCTGCATTATTCTAATT 58.385 37.500 0.00 0.00 0.00 1.40
197 198 5.220710 AGTCTCCGCTGCATTATTCTAAT 57.779 39.130 0.00 0.00 0.00 1.73
198 199 4.672587 AGTCTCCGCTGCATTATTCTAA 57.327 40.909 0.00 0.00 0.00 2.10
199 200 5.048643 GTCTAGTCTCCGCTGCATTATTCTA 60.049 44.000 0.00 0.00 0.00 2.10
200 201 3.891977 TCTAGTCTCCGCTGCATTATTCT 59.108 43.478 0.00 0.00 0.00 2.40
201 202 3.984633 GTCTAGTCTCCGCTGCATTATTC 59.015 47.826 0.00 0.00 0.00 1.75
202 203 3.639094 AGTCTAGTCTCCGCTGCATTATT 59.361 43.478 0.00 0.00 0.00 1.40
203 204 3.226777 AGTCTAGTCTCCGCTGCATTAT 58.773 45.455 0.00 0.00 0.00 1.28
204 205 2.656002 AGTCTAGTCTCCGCTGCATTA 58.344 47.619 0.00 0.00 0.00 1.90
205 206 1.479709 AGTCTAGTCTCCGCTGCATT 58.520 50.000 0.00 0.00 0.00 3.56
206 207 1.135915 CAAGTCTAGTCTCCGCTGCAT 59.864 52.381 0.00 0.00 0.00 3.96
207 208 0.528017 CAAGTCTAGTCTCCGCTGCA 59.472 55.000 0.00 0.00 0.00 4.41
208 209 0.528470 ACAAGTCTAGTCTCCGCTGC 59.472 55.000 0.00 0.00 0.00 5.25
209 210 2.223066 CGTACAAGTCTAGTCTCCGCTG 60.223 54.545 0.00 0.00 0.00 5.18
210 211 2.008329 CGTACAAGTCTAGTCTCCGCT 58.992 52.381 0.00 0.00 0.00 5.52
211 212 1.531470 GCGTACAAGTCTAGTCTCCGC 60.531 57.143 0.00 7.23 0.00 5.54
212 213 1.267433 CGCGTACAAGTCTAGTCTCCG 60.267 57.143 0.00 0.00 0.00 4.63
213 214 1.063764 CCGCGTACAAGTCTAGTCTCC 59.936 57.143 4.92 0.00 0.00 3.71
214 215 1.736681 ACCGCGTACAAGTCTAGTCTC 59.263 52.381 4.92 0.00 0.00 3.36
215 216 1.467734 CACCGCGTACAAGTCTAGTCT 59.532 52.381 4.92 0.00 0.00 3.24
216 217 1.198637 ACACCGCGTACAAGTCTAGTC 59.801 52.381 4.92 0.00 0.00 2.59
217 218 1.242076 ACACCGCGTACAAGTCTAGT 58.758 50.000 4.92 0.00 0.00 2.57
218 219 2.248487 GAACACCGCGTACAAGTCTAG 58.752 52.381 4.92 0.00 0.00 2.43
219 220 1.400113 CGAACACCGCGTACAAGTCTA 60.400 52.381 4.92 0.00 0.00 2.59
220 221 0.662374 CGAACACCGCGTACAAGTCT 60.662 55.000 4.92 0.00 0.00 3.24
221 222 1.611592 CCGAACACCGCGTACAAGTC 61.612 60.000 4.92 0.00 36.84 3.01
222 223 1.662446 CCGAACACCGCGTACAAGT 60.662 57.895 4.92 0.00 36.84 3.16
223 224 1.662446 ACCGAACACCGCGTACAAG 60.662 57.895 4.92 0.00 36.84 3.16
224 225 1.950130 CACCGAACACCGCGTACAA 60.950 57.895 4.92 0.00 36.84 2.41
225 226 2.354891 CACCGAACACCGCGTACA 60.355 61.111 4.92 0.00 36.84 2.90
226 227 3.770424 GCACCGAACACCGCGTAC 61.770 66.667 4.92 0.00 36.84 3.67
227 228 3.980989 AGCACCGAACACCGCGTA 61.981 61.111 4.92 0.00 36.84 4.42
230 231 3.869473 TACCAGCACCGAACACCGC 62.869 63.158 0.00 0.00 36.84 5.68
231 232 1.736645 CTACCAGCACCGAACACCG 60.737 63.158 0.00 0.00 38.18 4.94
232 233 0.389948 CTCTACCAGCACCGAACACC 60.390 60.000 0.00 0.00 0.00 4.16
233 234 0.317479 ACTCTACCAGCACCGAACAC 59.683 55.000 0.00 0.00 0.00 3.32
234 235 0.601558 GACTCTACCAGCACCGAACA 59.398 55.000 0.00 0.00 0.00 3.18
235 236 0.601558 TGACTCTACCAGCACCGAAC 59.398 55.000 0.00 0.00 0.00 3.95
236 237 1.204704 CATGACTCTACCAGCACCGAA 59.795 52.381 0.00 0.00 0.00 4.30
237 238 0.817654 CATGACTCTACCAGCACCGA 59.182 55.000 0.00 0.00 0.00 4.69
238 239 0.179100 CCATGACTCTACCAGCACCG 60.179 60.000 0.00 0.00 0.00 4.94
239 240 0.179000 CCCATGACTCTACCAGCACC 59.821 60.000 0.00 0.00 0.00 5.01
240 241 0.462759 GCCCATGACTCTACCAGCAC 60.463 60.000 0.00 0.00 0.00 4.40
241 242 1.907739 GCCCATGACTCTACCAGCA 59.092 57.895 0.00 0.00 0.00 4.41
242 243 1.227380 CGCCCATGACTCTACCAGC 60.227 63.158 0.00 0.00 0.00 4.85
243 244 0.179100 CACGCCCATGACTCTACCAG 60.179 60.000 0.00 0.00 0.00 4.00
244 245 1.613317 CCACGCCCATGACTCTACCA 61.613 60.000 0.00 0.00 0.00 3.25
245 246 1.144057 CCACGCCCATGACTCTACC 59.856 63.158 0.00 0.00 0.00 3.18
246 247 0.249398 AACCACGCCCATGACTCTAC 59.751 55.000 0.00 0.00 0.00 2.59
247 248 0.249120 CAACCACGCCCATGACTCTA 59.751 55.000 0.00 0.00 0.00 2.43
248 249 1.003355 CAACCACGCCCATGACTCT 60.003 57.895 0.00 0.00 0.00 3.24
249 250 1.003839 TCAACCACGCCCATGACTC 60.004 57.895 0.00 0.00 0.00 3.36
250 251 1.003355 CTCAACCACGCCCATGACT 60.003 57.895 0.00 0.00 0.00 3.41
251 252 0.392998 ATCTCAACCACGCCCATGAC 60.393 55.000 0.00 0.00 0.00 3.06
252 253 0.327924 AATCTCAACCACGCCCATGA 59.672 50.000 0.00 0.00 0.00 3.07
253 254 0.452987 CAATCTCAACCACGCCCATG 59.547 55.000 0.00 0.00 0.00 3.66
254 255 0.680921 CCAATCTCAACCACGCCCAT 60.681 55.000 0.00 0.00 0.00 4.00
255 256 1.303236 CCAATCTCAACCACGCCCA 60.303 57.895 0.00 0.00 0.00 5.36
256 257 1.303317 ACCAATCTCAACCACGCCC 60.303 57.895 0.00 0.00 0.00 6.13
257 258 0.321653 AGACCAATCTCAACCACGCC 60.322 55.000 0.00 0.00 0.00 5.68
258 259 0.798776 CAGACCAATCTCAACCACGC 59.201 55.000 0.00 0.00 30.42 5.34
259 260 0.798776 GCAGACCAATCTCAACCACG 59.201 55.000 0.00 0.00 30.42 4.94
260 261 1.537202 GTGCAGACCAATCTCAACCAC 59.463 52.381 0.00 0.00 30.42 4.16
261 262 1.142667 TGTGCAGACCAATCTCAACCA 59.857 47.619 0.00 0.00 30.42 3.67
262 263 1.537202 GTGTGCAGACCAATCTCAACC 59.463 52.381 1.72 0.00 30.42 3.77
263 264 2.221169 TGTGTGCAGACCAATCTCAAC 58.779 47.619 12.00 0.00 30.42 3.18
264 265 2.636647 TGTGTGCAGACCAATCTCAA 57.363 45.000 12.00 0.00 30.42 3.02
265 266 2.616256 GGATGTGTGCAGACCAATCTCA 60.616 50.000 12.00 0.00 30.42 3.27
266 267 2.012673 GGATGTGTGCAGACCAATCTC 58.987 52.381 12.00 0.90 30.42 2.75
267 268 1.352017 TGGATGTGTGCAGACCAATCT 59.648 47.619 12.00 0.00 34.08 2.40
268 269 1.470098 GTGGATGTGTGCAGACCAATC 59.530 52.381 12.00 8.52 36.99 2.67
269 270 1.202915 TGTGGATGTGTGCAGACCAAT 60.203 47.619 12.00 0.00 36.99 3.16
270 271 0.182299 TGTGGATGTGTGCAGACCAA 59.818 50.000 12.00 0.00 36.99 3.67
271 272 0.401356 ATGTGGATGTGTGCAGACCA 59.599 50.000 12.00 1.80 34.41 4.02
272 273 0.806868 CATGTGGATGTGTGCAGACC 59.193 55.000 12.00 0.00 0.00 3.85
273 274 0.169672 GCATGTGGATGTGTGCAGAC 59.830 55.000 7.12 7.12 37.52 3.51
274 275 0.961857 GGCATGTGGATGTGTGCAGA 60.962 55.000 0.00 0.00 39.27 4.26
275 276 1.509463 GGCATGTGGATGTGTGCAG 59.491 57.895 0.00 0.00 39.27 4.41
276 277 2.334181 CGGCATGTGGATGTGTGCA 61.334 57.895 0.00 0.00 39.27 4.57
277 278 2.039974 TCGGCATGTGGATGTGTGC 61.040 57.895 0.00 0.00 36.88 4.57
278 279 1.647545 GGTCGGCATGTGGATGTGTG 61.648 60.000 0.00 0.00 31.50 3.82
279 280 1.377202 GGTCGGCATGTGGATGTGT 60.377 57.895 0.00 0.00 31.50 3.72
280 281 1.078214 AGGTCGGCATGTGGATGTG 60.078 57.895 0.00 0.00 31.50 3.21
281 282 1.221840 GAGGTCGGCATGTGGATGT 59.778 57.895 0.00 0.00 31.50 3.06
282 283 1.524621 GGAGGTCGGCATGTGGATG 60.525 63.158 0.00 0.00 0.00 3.51
283 284 1.348008 ATGGAGGTCGGCATGTGGAT 61.348 55.000 0.00 0.00 0.00 3.41
284 285 1.971505 GATGGAGGTCGGCATGTGGA 61.972 60.000 0.00 0.00 0.00 4.02
285 286 1.524621 GATGGAGGTCGGCATGTGG 60.525 63.158 0.00 0.00 0.00 4.17
286 287 0.752658 TAGATGGAGGTCGGCATGTG 59.247 55.000 0.00 0.00 0.00 3.21
287 288 1.620819 GATAGATGGAGGTCGGCATGT 59.379 52.381 0.00 0.00 0.00 3.21
288 289 1.898472 AGATAGATGGAGGTCGGCATG 59.102 52.381 0.00 0.00 0.00 4.06
289 290 2.317371 AGATAGATGGAGGTCGGCAT 57.683 50.000 0.00 0.00 0.00 4.40
290 291 2.088104 AAGATAGATGGAGGTCGGCA 57.912 50.000 0.00 0.00 0.00 5.69
291 292 2.365617 TCAAAGATAGATGGAGGTCGGC 59.634 50.000 0.00 0.00 0.00 5.54
292 293 4.672587 TTCAAAGATAGATGGAGGTCGG 57.327 45.455 0.00 0.00 0.00 4.79
293 294 8.839310 ATTAATTCAAAGATAGATGGAGGTCG 57.161 34.615 0.00 0.00 0.00 4.79
296 297 9.171877 GCCTATTAATTCAAAGATAGATGGAGG 57.828 37.037 0.00 0.00 0.00 4.30
297 298 9.730705 TGCCTATTAATTCAAAGATAGATGGAG 57.269 33.333 0.00 0.00 0.00 3.86
306 307 9.555727 GGTAGTACATGCCTATTAATTCAAAGA 57.444 33.333 2.06 0.00 0.00 2.52
307 308 9.561069 AGGTAGTACATGCCTATTAATTCAAAG 57.439 33.333 2.06 0.00 43.17 2.77
308 309 9.555727 GAGGTAGTACATGCCTATTAATTCAAA 57.444 33.333 2.06 0.00 45.33 2.69
309 310 8.154856 GGAGGTAGTACATGCCTATTAATTCAA 58.845 37.037 2.06 0.00 45.33 2.69
310 311 7.524863 CGGAGGTAGTACATGCCTATTAATTCA 60.525 40.741 2.06 0.00 45.33 2.57
311 312 6.812160 CGGAGGTAGTACATGCCTATTAATTC 59.188 42.308 2.06 0.00 45.33 2.17
312 313 6.269307 ACGGAGGTAGTACATGCCTATTAATT 59.731 38.462 2.06 0.00 45.33 1.40
313 314 5.778750 ACGGAGGTAGTACATGCCTATTAAT 59.221 40.000 2.06 0.00 45.33 1.40
314 315 5.142639 ACGGAGGTAGTACATGCCTATTAA 58.857 41.667 2.06 0.00 45.33 1.40
315 316 4.733165 ACGGAGGTAGTACATGCCTATTA 58.267 43.478 2.06 0.00 45.33 0.98
316 317 3.573110 GACGGAGGTAGTACATGCCTATT 59.427 47.826 2.06 0.00 45.33 1.73
317 318 3.155501 GACGGAGGTAGTACATGCCTAT 58.844 50.000 2.06 0.00 45.33 2.57
318 319 2.579873 GACGGAGGTAGTACATGCCTA 58.420 52.381 2.06 0.00 45.33 3.93
320 321 0.388294 GGACGGAGGTAGTACATGCC 59.612 60.000 2.06 0.00 0.00 4.40
321 322 1.337387 GAGGACGGAGGTAGTACATGC 59.663 57.143 2.06 0.00 0.00 4.06
322 323 1.602851 CGAGGACGGAGGTAGTACATG 59.397 57.143 2.06 0.00 35.72 3.21
323 324 1.211457 ACGAGGACGGAGGTAGTACAT 59.789 52.381 2.06 0.00 44.46 2.29
324 325 0.615331 ACGAGGACGGAGGTAGTACA 59.385 55.000 2.06 0.00 44.46 2.90
325 326 1.743996 AACGAGGACGGAGGTAGTAC 58.256 55.000 0.00 0.00 44.46 2.73
326 327 2.496899 AAACGAGGACGGAGGTAGTA 57.503 50.000 0.00 0.00 44.46 1.82
327 328 2.496899 TAAACGAGGACGGAGGTAGT 57.503 50.000 0.00 0.00 44.46 2.73
328 329 2.032204 CGATAAACGAGGACGGAGGTAG 60.032 54.545 0.00 0.00 45.77 3.18
329 330 1.942657 CGATAAACGAGGACGGAGGTA 59.057 52.381 0.00 0.00 45.77 3.08
330 331 0.737219 CGATAAACGAGGACGGAGGT 59.263 55.000 0.00 0.00 45.77 3.85
331 332 0.030369 CCGATAAACGAGGACGGAGG 59.970 60.000 0.00 0.00 45.31 4.30
332 333 0.737219 ACCGATAAACGAGGACGGAG 59.263 55.000 0.00 0.00 45.31 4.63
333 334 0.734889 GACCGATAAACGAGGACGGA 59.265 55.000 0.00 0.00 45.31 4.69
335 336 0.248784 GGGACCGATAAACGAGGACG 60.249 60.000 0.00 0.00 45.77 4.79
336 337 1.109609 AGGGACCGATAAACGAGGAC 58.890 55.000 0.00 0.00 45.77 3.85
337 338 1.856629 AAGGGACCGATAAACGAGGA 58.143 50.000 0.00 0.00 45.77 3.71
338 339 2.277084 CAAAGGGACCGATAAACGAGG 58.723 52.381 0.00 0.00 45.77 4.63
339 340 2.968675 ACAAAGGGACCGATAAACGAG 58.031 47.619 0.00 0.00 45.77 4.18
340 341 4.533919 TTACAAAGGGACCGATAAACGA 57.466 40.909 0.00 0.00 45.77 3.85
341 342 5.806366 AATTACAAAGGGACCGATAAACG 57.194 39.130 0.00 0.00 42.18 3.60
342 343 6.804783 CACAAATTACAAAGGGACCGATAAAC 59.195 38.462 0.00 0.00 0.00 2.01
343 344 6.490721 ACACAAATTACAAAGGGACCGATAAA 59.509 34.615 0.00 0.00 0.00 1.40
344 345 6.005198 ACACAAATTACAAAGGGACCGATAA 58.995 36.000 0.00 0.00 0.00 1.75
345 346 5.562635 ACACAAATTACAAAGGGACCGATA 58.437 37.500 0.00 0.00 0.00 2.92
346 347 4.403734 ACACAAATTACAAAGGGACCGAT 58.596 39.130 0.00 0.00 0.00 4.18
347 348 3.822940 ACACAAATTACAAAGGGACCGA 58.177 40.909 0.00 0.00 0.00 4.69
348 349 4.577834 AACACAAATTACAAAGGGACCG 57.422 40.909 0.00 0.00 0.00 4.79
349 350 8.896320 AATTTAACACAAATTACAAAGGGACC 57.104 30.769 0.00 0.00 0.00 4.46
389 390 9.926158 TTGACATGCATTGATATTTTGTTAGTT 57.074 25.926 0.00 0.00 0.00 2.24
390 391 9.357652 GTTGACATGCATTGATATTTTGTTAGT 57.642 29.630 0.00 0.00 0.00 2.24
391 392 8.525876 CGTTGACATGCATTGATATTTTGTTAG 58.474 33.333 0.00 0.00 0.00 2.34
392 393 8.239998 TCGTTGACATGCATTGATATTTTGTTA 58.760 29.630 0.00 0.00 0.00 2.41
393 394 7.089538 TCGTTGACATGCATTGATATTTTGTT 58.910 30.769 0.00 0.00 0.00 2.83
394 395 6.619744 TCGTTGACATGCATTGATATTTTGT 58.380 32.000 0.00 0.00 0.00 2.83
395 396 7.509050 TTCGTTGACATGCATTGATATTTTG 57.491 32.000 0.00 0.00 0.00 2.44
396 397 9.970395 ATATTCGTTGACATGCATTGATATTTT 57.030 25.926 0.00 0.00 0.00 1.82
397 398 9.970395 AATATTCGTTGACATGCATTGATATTT 57.030 25.926 0.00 0.00 0.00 1.40
468 469 9.926158 ACAAAATGTCTATGCATGTCATAAAAA 57.074 25.926 10.16 0.00 37.22 1.94
469 470 9.926158 AACAAAATGTCTATGCATGTCATAAAA 57.074 25.926 10.16 0.00 37.22 1.52
470 471 9.926158 AAACAAAATGTCTATGCATGTCATAAA 57.074 25.926 10.16 0.00 37.22 1.40
471 472 9.356433 CAAACAAAATGTCTATGCATGTCATAA 57.644 29.630 10.16 0.00 37.22 1.90
472 473 8.522003 ACAAACAAAATGTCTATGCATGTCATA 58.478 29.630 10.16 8.79 36.63 2.15
473 474 7.380536 ACAAACAAAATGTCTATGCATGTCAT 58.619 30.769 10.16 8.22 39.17 3.06
474 475 6.747125 ACAAACAAAATGTCTATGCATGTCA 58.253 32.000 10.16 6.12 0.00 3.58
475 476 7.642071 AACAAACAAAATGTCTATGCATGTC 57.358 32.000 10.16 0.00 0.00 3.06
476 477 9.539825 TTTAACAAACAAAATGTCTATGCATGT 57.460 25.926 10.16 0.00 0.00 3.21
479 480 9.979578 AGATTTAACAAACAAAATGTCTATGCA 57.020 25.926 0.00 0.00 0.00 3.96
516 517 6.826231 TGATCCTTATTACATTTCAGGCGAAA 59.174 34.615 6.90 6.90 44.99 3.46
517 518 6.353323 TGATCCTTATTACATTTCAGGCGAA 58.647 36.000 0.00 0.00 0.00 4.70
518 519 5.924356 TGATCCTTATTACATTTCAGGCGA 58.076 37.500 0.00 0.00 0.00 5.54
519 520 6.618287 TTGATCCTTATTACATTTCAGGCG 57.382 37.500 0.00 0.00 0.00 5.52
527 528 9.574516 GTCCTGGTTTATTGATCCTTATTACAT 57.425 33.333 0.00 0.00 0.00 2.29
528 529 7.713507 CGTCCTGGTTTATTGATCCTTATTACA 59.286 37.037 0.00 0.00 0.00 2.41
529 530 7.172703 CCGTCCTGGTTTATTGATCCTTATTAC 59.827 40.741 0.00 0.00 0.00 1.89
530 531 7.071447 TCCGTCCTGGTTTATTGATCCTTATTA 59.929 37.037 0.00 0.00 39.52 0.98
531 532 6.062095 CCGTCCTGGTTTATTGATCCTTATT 58.938 40.000 0.00 0.00 0.00 1.40
532 533 5.368523 TCCGTCCTGGTTTATTGATCCTTAT 59.631 40.000 0.00 0.00 39.52 1.73
533 534 4.717778 TCCGTCCTGGTTTATTGATCCTTA 59.282 41.667 0.00 0.00 39.52 2.69
534 535 3.521937 TCCGTCCTGGTTTATTGATCCTT 59.478 43.478 0.00 0.00 39.52 3.36
535 536 3.112263 TCCGTCCTGGTTTATTGATCCT 58.888 45.455 0.00 0.00 39.52 3.24
536 537 3.467803 CTCCGTCCTGGTTTATTGATCC 58.532 50.000 0.00 0.00 39.52 3.36
537 538 3.118371 ACCTCCGTCCTGGTTTATTGATC 60.118 47.826 0.00 0.00 39.52 2.92
538 539 2.844348 ACCTCCGTCCTGGTTTATTGAT 59.156 45.455 0.00 0.00 39.52 2.57
539 540 2.262637 ACCTCCGTCCTGGTTTATTGA 58.737 47.619 0.00 0.00 39.52 2.57
540 541 2.781681 ACCTCCGTCCTGGTTTATTG 57.218 50.000 0.00 0.00 39.52 1.90
541 542 3.447950 ACTACCTCCGTCCTGGTTTATT 58.552 45.455 0.00 0.00 39.52 1.40
542 543 3.111741 ACTACCTCCGTCCTGGTTTAT 57.888 47.619 0.00 0.00 39.52 1.40
543 544 2.610438 ACTACCTCCGTCCTGGTTTA 57.390 50.000 0.00 0.00 39.52 2.01
544 545 2.610438 TACTACCTCCGTCCTGGTTT 57.390 50.000 0.00 0.00 39.52 3.27
545 546 2.292061 ACATACTACCTCCGTCCTGGTT 60.292 50.000 0.00 0.00 39.52 3.67
546 547 1.287146 ACATACTACCTCCGTCCTGGT 59.713 52.381 0.00 0.00 39.52 4.00
547 548 2.068834 ACATACTACCTCCGTCCTGG 57.931 55.000 0.00 0.00 40.09 4.45
548 549 2.100916 CCAACATACTACCTCCGTCCTG 59.899 54.545 0.00 0.00 0.00 3.86
549 550 2.024655 TCCAACATACTACCTCCGTCCT 60.025 50.000 0.00 0.00 0.00 3.85
550 551 2.361438 CTCCAACATACTACCTCCGTCC 59.639 54.545 0.00 0.00 0.00 4.79
551 552 2.223758 GCTCCAACATACTACCTCCGTC 60.224 54.545 0.00 0.00 0.00 4.79
552 553 1.755380 GCTCCAACATACTACCTCCGT 59.245 52.381 0.00 0.00 0.00 4.69
553 554 1.754803 TGCTCCAACATACTACCTCCG 59.245 52.381 0.00 0.00 0.00 4.63
554 555 3.906720 TTGCTCCAACATACTACCTCC 57.093 47.619 0.00 0.00 0.00 4.30
555 556 6.759497 ATTTTTGCTCCAACATACTACCTC 57.241 37.500 0.00 0.00 0.00 3.85
556 557 6.828785 CCTATTTTTGCTCCAACATACTACCT 59.171 38.462 0.00 0.00 0.00 3.08
557 558 6.602009 ACCTATTTTTGCTCCAACATACTACC 59.398 38.462 0.00 0.00 0.00 3.18
558 559 7.120726 ACACCTATTTTTGCTCCAACATACTAC 59.879 37.037 0.00 0.00 0.00 2.73
559 560 7.172342 ACACCTATTTTTGCTCCAACATACTA 58.828 34.615 0.00 0.00 0.00 1.82
560 561 6.010219 ACACCTATTTTTGCTCCAACATACT 58.990 36.000 0.00 0.00 0.00 2.12
561 562 6.267496 ACACCTATTTTTGCTCCAACATAC 57.733 37.500 0.00 0.00 0.00 2.39
562 563 5.123186 CGACACCTATTTTTGCTCCAACATA 59.877 40.000 0.00 0.00 0.00 2.29
563 564 4.082787 CGACACCTATTTTTGCTCCAACAT 60.083 41.667 0.00 0.00 0.00 2.71
564 565 3.252215 CGACACCTATTTTTGCTCCAACA 59.748 43.478 0.00 0.00 0.00 3.33
565 566 3.500680 TCGACACCTATTTTTGCTCCAAC 59.499 43.478 0.00 0.00 0.00 3.77
566 567 3.745799 TCGACACCTATTTTTGCTCCAA 58.254 40.909 0.00 0.00 0.00 3.53
567 568 3.244422 ACTCGACACCTATTTTTGCTCCA 60.244 43.478 0.00 0.00 0.00 3.86
568 569 3.125316 CACTCGACACCTATTTTTGCTCC 59.875 47.826 0.00 0.00 0.00 4.70
569 570 3.125316 CCACTCGACACCTATTTTTGCTC 59.875 47.826 0.00 0.00 0.00 4.26
570 571 3.074412 CCACTCGACACCTATTTTTGCT 58.926 45.455 0.00 0.00 0.00 3.91
571 572 2.812011 ACCACTCGACACCTATTTTTGC 59.188 45.455 0.00 0.00 0.00 3.68
572 573 4.320202 CCAACCACTCGACACCTATTTTTG 60.320 45.833 0.00 0.00 0.00 2.44
573 574 3.818773 CCAACCACTCGACACCTATTTTT 59.181 43.478 0.00 0.00 0.00 1.94
574 575 3.181448 ACCAACCACTCGACACCTATTTT 60.181 43.478 0.00 0.00 0.00 1.82
575 576 2.370849 ACCAACCACTCGACACCTATTT 59.629 45.455 0.00 0.00 0.00 1.40
576 577 1.975680 ACCAACCACTCGACACCTATT 59.024 47.619 0.00 0.00 0.00 1.73
577 578 1.275291 CACCAACCACTCGACACCTAT 59.725 52.381 0.00 0.00 0.00 2.57
578 579 0.677288 CACCAACCACTCGACACCTA 59.323 55.000 0.00 0.00 0.00 3.08
579 580 1.046472 TCACCAACCACTCGACACCT 61.046 55.000 0.00 0.00 0.00 4.00
580 581 0.600255 CTCACCAACCACTCGACACC 60.600 60.000 0.00 0.00 0.00 4.16
581 582 1.222115 GCTCACCAACCACTCGACAC 61.222 60.000 0.00 0.00 0.00 3.67
582 583 1.069090 GCTCACCAACCACTCGACA 59.931 57.895 0.00 0.00 0.00 4.35
583 584 1.668151 GGCTCACCAACCACTCGAC 60.668 63.158 0.00 0.00 35.26 4.20
584 585 2.137528 TGGCTCACCAACCACTCGA 61.138 57.895 0.00 0.00 45.37 4.04
585 586 2.425592 TGGCTCACCAACCACTCG 59.574 61.111 0.00 0.00 45.37 4.18
608 609 1.453745 AATGGGTGCCGTATGCTGG 60.454 57.895 0.00 0.00 42.00 4.85
609 610 0.747644 TCAATGGGTGCCGTATGCTG 60.748 55.000 0.00 0.00 42.00 4.41
610 611 0.748005 GTCAATGGGTGCCGTATGCT 60.748 55.000 0.00 0.00 42.00 3.79
611 612 1.029408 TGTCAATGGGTGCCGTATGC 61.029 55.000 0.00 0.00 41.77 3.14
612 613 1.603802 GATGTCAATGGGTGCCGTATG 59.396 52.381 0.00 0.00 0.00 2.39
613 614 1.810031 CGATGTCAATGGGTGCCGTAT 60.810 52.381 0.00 0.00 0.00 3.06
614 615 0.461163 CGATGTCAATGGGTGCCGTA 60.461 55.000 0.00 0.00 0.00 4.02
615 616 1.745115 CGATGTCAATGGGTGCCGT 60.745 57.895 0.00 0.00 0.00 5.68
616 617 2.472059 CCGATGTCAATGGGTGCCG 61.472 63.158 0.00 0.00 0.00 5.69
617 618 1.077787 TCCGATGTCAATGGGTGCC 60.078 57.895 0.00 0.00 33.54 5.01
618 619 1.097547 CCTCCGATGTCAATGGGTGC 61.098 60.000 0.00 0.00 33.54 5.01
619 620 1.097547 GCCTCCGATGTCAATGGGTG 61.098 60.000 0.00 0.00 33.54 4.61
620 621 1.224592 GCCTCCGATGTCAATGGGT 59.775 57.895 0.00 0.00 33.54 4.51
621 622 0.816825 CAGCCTCCGATGTCAATGGG 60.817 60.000 0.00 0.00 33.08 4.00
622 623 0.816825 CCAGCCTCCGATGTCAATGG 60.817 60.000 0.00 0.00 0.00 3.16
623 624 0.816825 CCCAGCCTCCGATGTCAATG 60.817 60.000 0.00 0.00 0.00 2.82
624 625 0.982852 TCCCAGCCTCCGATGTCAAT 60.983 55.000 0.00 0.00 0.00 2.57
625 626 1.198094 TTCCCAGCCTCCGATGTCAA 61.198 55.000 0.00 0.00 0.00 3.18
626 627 1.612146 TTCCCAGCCTCCGATGTCA 60.612 57.895 0.00 0.00 0.00 3.58
627 628 1.153349 GTTCCCAGCCTCCGATGTC 60.153 63.158 0.00 0.00 0.00 3.06
628 629 2.990479 GTTCCCAGCCTCCGATGT 59.010 61.111 0.00 0.00 0.00 3.06
629 630 2.202932 CGTTCCCAGCCTCCGATG 60.203 66.667 0.00 0.00 0.00 3.84
630 631 4.162690 GCGTTCCCAGCCTCCGAT 62.163 66.667 0.00 0.00 0.00 4.18
637 638 4.090057 GAAGCACGCGTTCCCAGC 62.090 66.667 10.22 10.22 0.00 4.85
638 639 1.901650 GAAGAAGCACGCGTTCCCAG 61.902 60.000 10.22 0.00 0.00 4.45
639 640 1.959226 GAAGAAGCACGCGTTCCCA 60.959 57.895 10.22 0.00 0.00 4.37
640 641 2.677979 GGAAGAAGCACGCGTTCCC 61.678 63.158 10.22 0.09 33.60 3.97
641 642 2.861006 GGAAGAAGCACGCGTTCC 59.139 61.111 10.22 9.75 32.08 3.62
642 643 2.019951 TCGGAAGAAGCACGCGTTC 61.020 57.895 10.22 4.20 37.03 3.95
643 644 2.028484 TCGGAAGAAGCACGCGTT 59.972 55.556 10.22 0.00 37.03 4.84
644 645 2.733593 GTCGGAAGAAGCACGCGT 60.734 61.111 5.58 5.58 45.01 6.01
645 646 3.827784 CGTCGGAAGAAGCACGCG 61.828 66.667 3.53 3.53 45.01 6.01
646 647 2.430244 TCGTCGGAAGAAGCACGC 60.430 61.111 0.00 0.00 45.01 5.34
647 648 1.801913 CCTCGTCGGAAGAAGCACG 60.802 63.158 0.00 0.00 45.01 5.34
648 649 1.446272 CCCTCGTCGGAAGAAGCAC 60.446 63.158 0.00 0.00 45.01 4.40
649 650 1.605451 TCCCTCGTCGGAAGAAGCA 60.605 57.895 0.00 0.00 45.01 3.91
650 651 1.153804 GTCCCTCGTCGGAAGAAGC 60.154 63.158 0.00 0.00 45.01 3.86
651 652 1.136984 CGTCCCTCGTCGGAAGAAG 59.863 63.158 0.00 0.00 45.01 2.85
652 653 1.302752 TCGTCCCTCGTCGGAAGAA 60.303 57.895 6.68 0.00 45.01 2.52
653 654 2.037136 GTCGTCCCTCGTCGGAAGA 61.037 63.158 5.39 5.39 37.98 2.87
654 655 2.484203 GTCGTCCCTCGTCGGAAG 59.516 66.667 0.00 0.00 40.80 3.46
655 656 2.184020 TAGGTCGTCCCTCGTCGGAA 62.184 60.000 0.00 0.00 44.81 4.30
656 657 2.584261 CTAGGTCGTCCCTCGTCGGA 62.584 65.000 0.00 0.00 44.81 4.55
657 658 2.124983 TAGGTCGTCCCTCGTCGG 60.125 66.667 0.00 0.00 44.81 4.79
658 659 2.821688 GCTAGGTCGTCCCTCGTCG 61.822 68.421 0.00 0.00 44.81 5.12
659 660 2.479750 GGCTAGGTCGTCCCTCGTC 61.480 68.421 0.00 0.00 44.81 4.20
660 661 2.439883 GGCTAGGTCGTCCCTCGT 60.440 66.667 0.00 0.00 44.81 4.18
661 662 1.601419 TTTGGCTAGGTCGTCCCTCG 61.601 60.000 0.00 0.00 44.81 4.63
662 663 0.611714 TTTTGGCTAGGTCGTCCCTC 59.388 55.000 0.00 0.00 44.81 4.30
664 665 1.065709 TCATTTTGGCTAGGTCGTCCC 60.066 52.381 0.00 0.00 0.00 4.46
665 666 2.396590 TCATTTTGGCTAGGTCGTCC 57.603 50.000 0.00 0.00 0.00 4.79
666 667 3.751698 ACTTTCATTTTGGCTAGGTCGTC 59.248 43.478 0.00 0.00 0.00 4.20
667 668 3.751518 ACTTTCATTTTGGCTAGGTCGT 58.248 40.909 0.00 0.00 0.00 4.34
668 669 4.766404 AACTTTCATTTTGGCTAGGTCG 57.234 40.909 0.00 0.00 0.00 4.79
669 670 7.923878 TGTTTTAACTTTCATTTTGGCTAGGTC 59.076 33.333 0.00 0.00 0.00 3.85
670 671 7.787028 TGTTTTAACTTTCATTTTGGCTAGGT 58.213 30.769 0.00 0.00 0.00 3.08
671 672 8.831715 ATGTTTTAACTTTCATTTTGGCTAGG 57.168 30.769 0.00 0.00 0.00 3.02
672 673 8.638565 CGATGTTTTAACTTTCATTTTGGCTAG 58.361 33.333 0.00 0.00 0.00 3.42
673 674 7.115663 GCGATGTTTTAACTTTCATTTTGGCTA 59.884 33.333 0.00 0.00 0.00 3.93
674 675 6.073819 GCGATGTTTTAACTTTCATTTTGGCT 60.074 34.615 0.00 0.00 0.00 4.75
675 676 6.070829 GCGATGTTTTAACTTTCATTTTGGC 58.929 36.000 0.00 0.00 0.00 4.52
676 677 6.423604 AGGCGATGTTTTAACTTTCATTTTGG 59.576 34.615 0.00 0.00 0.00 3.28
677 678 7.382218 AGAGGCGATGTTTTAACTTTCATTTTG 59.618 33.333 0.00 0.00 0.00 2.44
678 679 7.382218 CAGAGGCGATGTTTTAACTTTCATTTT 59.618 33.333 0.00 0.00 0.00 1.82
679 680 6.863126 CAGAGGCGATGTTTTAACTTTCATTT 59.137 34.615 0.00 0.00 0.00 2.32
680 681 6.206634 TCAGAGGCGATGTTTTAACTTTCATT 59.793 34.615 0.00 0.00 0.00 2.57
681 682 5.705441 TCAGAGGCGATGTTTTAACTTTCAT 59.295 36.000 0.00 0.00 0.00 2.57
682 683 5.060506 TCAGAGGCGATGTTTTAACTTTCA 58.939 37.500 0.00 0.00 0.00 2.69
683 684 5.607119 TCAGAGGCGATGTTTTAACTTTC 57.393 39.130 0.00 0.00 0.00 2.62
684 685 5.940470 AGATCAGAGGCGATGTTTTAACTTT 59.060 36.000 0.00 0.00 0.00 2.66
685 686 5.491982 AGATCAGAGGCGATGTTTTAACTT 58.508 37.500 0.00 0.00 0.00 2.66
686 687 5.091261 AGATCAGAGGCGATGTTTTAACT 57.909 39.130 0.00 0.00 0.00 2.24
687 688 4.271291 GGAGATCAGAGGCGATGTTTTAAC 59.729 45.833 0.00 0.00 0.00 2.01
688 689 4.442706 GGAGATCAGAGGCGATGTTTTAA 58.557 43.478 0.00 0.00 0.00 1.52
689 690 3.181465 GGGAGATCAGAGGCGATGTTTTA 60.181 47.826 0.00 0.00 0.00 1.52
690 691 2.420687 GGGAGATCAGAGGCGATGTTTT 60.421 50.000 0.00 0.00 0.00 2.43
691 692 1.139853 GGGAGATCAGAGGCGATGTTT 59.860 52.381 0.00 0.00 0.00 2.83
692 693 0.755686 GGGAGATCAGAGGCGATGTT 59.244 55.000 0.00 0.00 0.00 2.71
693 694 0.105760 AGGGAGATCAGAGGCGATGT 60.106 55.000 0.00 0.00 0.00 3.06
694 695 0.602562 GAGGGAGATCAGAGGCGATG 59.397 60.000 0.00 0.00 0.00 3.84
695 696 0.187117 TGAGGGAGATCAGAGGCGAT 59.813 55.000 0.00 0.00 0.00 4.58
696 697 0.753479 GTGAGGGAGATCAGAGGCGA 60.753 60.000 0.00 0.00 0.00 5.54
697 698 0.754957 AGTGAGGGAGATCAGAGGCG 60.755 60.000 0.00 0.00 0.00 5.52
698 699 1.039856 GAGTGAGGGAGATCAGAGGC 58.960 60.000 0.00 0.00 0.00 4.70
699 700 2.175499 AGAGAGTGAGGGAGATCAGAGG 59.825 54.545 0.00 0.00 0.00 3.69
700 701 3.582998 AGAGAGTGAGGGAGATCAGAG 57.417 52.381 0.00 0.00 0.00 3.35
701 702 3.137544 GGTAGAGAGTGAGGGAGATCAGA 59.862 52.174 0.00 0.00 0.00 3.27
702 703 3.138283 AGGTAGAGAGTGAGGGAGATCAG 59.862 52.174 0.00 0.00 0.00 2.90
703 704 3.127250 AGGTAGAGAGTGAGGGAGATCA 58.873 50.000 0.00 0.00 0.00 2.92
704 705 3.751518 GAGGTAGAGAGTGAGGGAGATC 58.248 54.545 0.00 0.00 0.00 2.75
705 706 2.105821 CGAGGTAGAGAGTGAGGGAGAT 59.894 54.545 0.00 0.00 0.00 2.75
706 707 1.487142 CGAGGTAGAGAGTGAGGGAGA 59.513 57.143 0.00 0.00 0.00 3.71
707 708 1.961793 CGAGGTAGAGAGTGAGGGAG 58.038 60.000 0.00 0.00 0.00 4.30
708 709 0.107116 GCGAGGTAGAGAGTGAGGGA 60.107 60.000 0.00 0.00 0.00 4.20
709 710 1.104577 GGCGAGGTAGAGAGTGAGGG 61.105 65.000 0.00 0.00 0.00 4.30
710 711 1.104577 GGGCGAGGTAGAGAGTGAGG 61.105 65.000 0.00 0.00 0.00 3.86
711 712 1.104577 GGGGCGAGGTAGAGAGTGAG 61.105 65.000 0.00 0.00 0.00 3.51
712 713 1.076923 GGGGCGAGGTAGAGAGTGA 60.077 63.158 0.00 0.00 0.00 3.41
713 714 0.684805 AAGGGGCGAGGTAGAGAGTG 60.685 60.000 0.00 0.00 0.00 3.51
714 715 0.684805 CAAGGGGCGAGGTAGAGAGT 60.685 60.000 0.00 0.00 0.00 3.24
715 716 2.022240 GCAAGGGGCGAGGTAGAGAG 62.022 65.000 0.00 0.00 0.00 3.20
716 717 2.058595 GCAAGGGGCGAGGTAGAGA 61.059 63.158 0.00 0.00 0.00 3.10
717 718 2.501610 GCAAGGGGCGAGGTAGAG 59.498 66.667 0.00 0.00 0.00 2.43
740 741 5.659440 TGCTGTGTCCTTTTCTTCTTTTT 57.341 34.783 0.00 0.00 0.00 1.94
741 742 5.506317 CGATGCTGTGTCCTTTTCTTCTTTT 60.506 40.000 0.00 0.00 0.00 2.27
742 743 4.023707 CGATGCTGTGTCCTTTTCTTCTTT 60.024 41.667 0.00 0.00 0.00 2.52
743 744 3.499918 CGATGCTGTGTCCTTTTCTTCTT 59.500 43.478 0.00 0.00 0.00 2.52
744 745 3.070018 CGATGCTGTGTCCTTTTCTTCT 58.930 45.455 0.00 0.00 0.00 2.85
745 746 2.808543 ACGATGCTGTGTCCTTTTCTTC 59.191 45.455 0.00 0.00 0.00 2.87
746 747 2.549754 CACGATGCTGTGTCCTTTTCTT 59.450 45.455 0.00 0.00 35.12 2.52
747 748 2.146342 CACGATGCTGTGTCCTTTTCT 58.854 47.619 0.00 0.00 35.12 2.52
748 749 1.400242 GCACGATGCTGTGTCCTTTTC 60.400 52.381 0.00 0.00 40.96 2.29
749 750 0.593128 GCACGATGCTGTGTCCTTTT 59.407 50.000 0.00 0.00 40.96 2.27
750 751 1.237285 GGCACGATGCTGTGTCCTTT 61.237 55.000 9.31 0.00 44.28 3.11
751 752 1.672356 GGCACGATGCTGTGTCCTT 60.672 57.895 9.31 0.00 44.28 3.36
752 753 2.046892 GGCACGATGCTGTGTCCT 60.047 61.111 9.31 0.00 44.28 3.85
754 755 1.639298 GAAGGGCACGATGCTGTGTC 61.639 60.000 9.31 3.80 44.28 3.67
755 756 1.672356 GAAGGGCACGATGCTGTGT 60.672 57.895 9.31 0.00 44.28 3.72
756 757 2.743752 CGAAGGGCACGATGCTGTG 61.744 63.158 9.31 0.74 44.28 3.66
757 758 2.434884 CGAAGGGCACGATGCTGT 60.435 61.111 9.31 0.00 44.28 4.40
758 759 2.434884 ACGAAGGGCACGATGCTG 60.435 61.111 9.31 0.00 44.28 4.41
759 760 2.125512 GACGAAGGGCACGATGCT 60.126 61.111 9.31 0.00 44.28 3.79
760 761 2.125512 AGACGAAGGGCACGATGC 60.126 61.111 0.00 0.00 44.08 3.91
761 762 1.519455 GGAGACGAAGGGCACGATG 60.519 63.158 0.00 0.00 34.70 3.84
762 763 1.982395 TGGAGACGAAGGGCACGAT 60.982 57.895 0.00 0.00 34.70 3.73
763 764 2.599281 TGGAGACGAAGGGCACGA 60.599 61.111 0.00 0.00 34.70 4.35
764 765 2.432628 GTGGAGACGAAGGGCACG 60.433 66.667 0.00 0.00 0.00 5.34
765 766 1.374758 CTGTGGAGACGAAGGGCAC 60.375 63.158 0.00 0.00 0.00 5.01
766 767 3.059982 CTGTGGAGACGAAGGGCA 58.940 61.111 0.00 0.00 0.00 5.36
767 768 2.435059 GCTGTGGAGACGAAGGGC 60.435 66.667 0.00 0.00 0.00 5.19
768 769 1.374758 GTGCTGTGGAGACGAAGGG 60.375 63.158 0.00 0.00 0.00 3.95
769 770 1.374758 GGTGCTGTGGAGACGAAGG 60.375 63.158 0.00 0.00 0.00 3.46
770 771 1.734477 CGGTGCTGTGGAGACGAAG 60.734 63.158 0.00 0.00 0.00 3.79
771 772 2.338620 CGGTGCTGTGGAGACGAA 59.661 61.111 0.00 0.00 0.00 3.85
772 773 4.357947 GCGGTGCTGTGGAGACGA 62.358 66.667 0.00 0.00 0.00 4.20
787 788 4.764336 CATGGGTTGTGCTGCGCG 62.764 66.667 0.00 0.00 0.00 6.86
788 789 4.424566 CCATGGGTTGTGCTGCGC 62.425 66.667 2.85 6.19 0.00 6.09
789 790 4.424566 GCCATGGGTTGTGCTGCG 62.425 66.667 15.13 0.00 0.00 5.18
790 791 4.424566 CGCCATGGGTTGTGCTGC 62.425 66.667 15.13 0.00 0.00 5.25
791 792 2.672651 TCGCCATGGGTTGTGCTG 60.673 61.111 15.13 0.00 0.00 4.41
792 793 1.836999 TAGTCGCCATGGGTTGTGCT 61.837 55.000 15.13 0.00 0.00 4.40
793 794 1.376683 TAGTCGCCATGGGTTGTGC 60.377 57.895 15.13 0.00 0.00 4.57
794 795 1.024579 GGTAGTCGCCATGGGTTGTG 61.025 60.000 15.13 0.00 0.00 3.33
795 796 1.198759 AGGTAGTCGCCATGGGTTGT 61.199 55.000 15.13 0.00 0.00 3.32
796 797 0.828022 TAGGTAGTCGCCATGGGTTG 59.172 55.000 15.13 0.00 0.00 3.77
797 798 1.416401 CATAGGTAGTCGCCATGGGTT 59.584 52.381 15.13 0.31 0.00 4.11
798 799 1.048601 CATAGGTAGTCGCCATGGGT 58.951 55.000 15.13 0.00 0.00 4.51
799 800 1.048601 ACATAGGTAGTCGCCATGGG 58.951 55.000 15.13 3.69 0.00 4.00
800 801 2.910688 AACATAGGTAGTCGCCATGG 57.089 50.000 7.63 7.63 0.00 3.66
801 802 4.152402 GCAATAACATAGGTAGTCGCCATG 59.848 45.833 0.00 0.00 0.00 3.66
802 803 4.315803 GCAATAACATAGGTAGTCGCCAT 58.684 43.478 0.00 0.00 0.00 4.40
803 804 3.493699 GGCAATAACATAGGTAGTCGCCA 60.494 47.826 6.19 0.00 35.86 5.69
804 805 3.064931 GGCAATAACATAGGTAGTCGCC 58.935 50.000 0.00 0.00 0.00 5.54
805 806 3.988517 GAGGCAATAACATAGGTAGTCGC 59.011 47.826 0.00 0.00 0.00 5.19
806 807 5.455056 AGAGGCAATAACATAGGTAGTCG 57.545 43.478 0.00 0.00 0.00 4.18
807 808 7.819900 CCAATAGAGGCAATAACATAGGTAGTC 59.180 40.741 0.00 0.00 0.00 2.59
808 809 7.680730 CCAATAGAGGCAATAACATAGGTAGT 58.319 38.462 0.00 0.00 0.00 2.73
845 846 2.742372 CGAACCAGCCAAGGACGG 60.742 66.667 0.00 0.00 0.00 4.79
849 850 3.365265 GCCACGAACCAGCCAAGG 61.365 66.667 0.00 0.00 0.00 3.61
850 851 3.726517 CGCCACGAACCAGCCAAG 61.727 66.667 0.00 0.00 0.00 3.61
865 866 1.744320 AAAAAGTTGAGGGTGGGCGC 61.744 55.000 0.00 0.00 0.00 6.53
870 871 2.034179 GGGAACGAAAAAGTTGAGGGTG 59.966 50.000 0.00 0.00 34.00 4.61
871 872 2.304092 GGGAACGAAAAAGTTGAGGGT 58.696 47.619 0.00 0.00 34.00 4.34
872 873 2.303175 TGGGAACGAAAAAGTTGAGGG 58.697 47.619 0.00 0.00 34.00 4.30
874 875 4.893424 TCTTGGGAACGAAAAAGTTGAG 57.107 40.909 0.00 0.00 34.00 3.02
878 879 3.154710 GGGATCTTGGGAACGAAAAAGT 58.845 45.455 0.00 0.00 0.00 2.66
882 883 2.290705 GGAAGGGATCTTGGGAACGAAA 60.291 50.000 0.00 0.00 32.52 3.46
883 884 1.280998 GGAAGGGATCTTGGGAACGAA 59.719 52.381 0.00 0.00 32.52 3.85
886 887 2.426842 CAGGAAGGGATCTTGGGAAC 57.573 55.000 0.00 0.00 31.74 3.62
899 900 2.818714 CGCAGCTGAGCCAGGAAG 60.819 66.667 20.43 0.00 31.21 3.46
906 907 3.474034 GACACGTCGCAGCTGAGC 61.474 66.667 20.43 9.81 0.00 4.26
909 910 2.661537 TTGGACACGTCGCAGCTG 60.662 61.111 10.11 10.11 0.00 4.24
910 911 2.356313 CTTGGACACGTCGCAGCT 60.356 61.111 0.00 0.00 0.00 4.24
912 913 1.891060 GCTTCTTGGACACGTCGCAG 61.891 60.000 0.00 0.00 0.00 5.18
914 915 1.618640 GAGCTTCTTGGACACGTCGC 61.619 60.000 0.00 0.00 0.00 5.19
918 919 1.738099 CCGGAGCTTCTTGGACACG 60.738 63.158 0.00 0.00 0.00 4.49
920 921 1.535444 TCCCGGAGCTTCTTGGACA 60.535 57.895 0.73 0.00 0.00 4.02
922 923 3.713650 CTCCCGGAGCTTCTTGGA 58.286 61.111 0.73 0.61 0.00 3.53
942 943 1.833630 TCCGGCATGATATGGATCTCC 59.166 52.381 0.00 0.00 32.79 3.71
944 945 1.209019 GCTCCGGCATGATATGGATCT 59.791 52.381 0.00 0.00 38.54 2.75
949 950 2.757314 TCTCTAGCTCCGGCATGATATG 59.243 50.000 0.00 0.00 41.70 1.78
950 951 3.093057 TCTCTAGCTCCGGCATGATAT 57.907 47.619 0.00 0.00 41.70 1.63
951 952 2.586648 TCTCTAGCTCCGGCATGATA 57.413 50.000 0.00 0.00 41.70 2.15
960 961 1.411977 TGCAGCATCTTCTCTAGCTCC 59.588 52.381 0.00 0.00 34.61 4.70
964 965 1.540797 GGCCTGCAGCATCTTCTCTAG 60.541 57.143 8.66 0.00 46.50 2.43
966 967 1.224039 GGCCTGCAGCATCTTCTCT 59.776 57.895 8.66 0.00 46.50 3.10
972 973 0.308993 GATAAACGGCCTGCAGCATC 59.691 55.000 8.66 0.00 46.50 3.91
974 975 0.607762 TTGATAAACGGCCTGCAGCA 60.608 50.000 8.66 0.00 46.50 4.41
980 981 2.467880 TCCTCTCTTGATAAACGGCCT 58.532 47.619 0.00 0.00 0.00 5.19
987 988 9.087871 CCTCTCTTTATCATCCTCTCTTGATAA 57.912 37.037 2.17 2.17 40.99 1.75
988 989 8.452056 TCCTCTCTTTATCATCCTCTCTTGATA 58.548 37.037 0.00 0.00 34.52 2.15
993 994 6.529084 TCTCCTCTCTTTATCATCCTCTCT 57.471 41.667 0.00 0.00 0.00 3.10
1005 1006 5.599656 CCTTCTCATCTCATCTCCTCTCTTT 59.400 44.000 0.00 0.00 0.00 2.52
1006 1007 5.103558 TCCTTCTCATCTCATCTCCTCTCTT 60.104 44.000 0.00 0.00 0.00 2.85
1007 1008 4.416513 TCCTTCTCATCTCATCTCCTCTCT 59.583 45.833 0.00 0.00 0.00 3.10
1015 1016 4.987912 GTCGGATTTCCTTCTCATCTCATC 59.012 45.833 0.00 0.00 0.00 2.92
1017 1018 3.181486 CGTCGGATTTCCTTCTCATCTCA 60.181 47.826 0.00 0.00 0.00 3.27
1018 1019 3.181485 ACGTCGGATTTCCTTCTCATCTC 60.181 47.826 0.00 0.00 0.00 2.75
1020 1021 2.860735 CACGTCGGATTTCCTTCTCATC 59.139 50.000 0.00 0.00 0.00 2.92
1021 1022 2.418746 CCACGTCGGATTTCCTTCTCAT 60.419 50.000 0.00 0.00 36.56 2.90
1022 1023 1.067142 CCACGTCGGATTTCCTTCTCA 60.067 52.381 0.00 0.00 36.56 3.27
1023 1024 1.641577 CCACGTCGGATTTCCTTCTC 58.358 55.000 0.00 0.00 36.56 2.87
1025 1026 1.693083 CGCCACGTCGGATTTCCTTC 61.693 60.000 8.04 0.00 36.56 3.46
1026 1027 1.740296 CGCCACGTCGGATTTCCTT 60.740 57.895 8.04 0.00 36.56 3.36
1027 1028 2.125673 CGCCACGTCGGATTTCCT 60.126 61.111 8.04 0.00 36.56 3.36
1044 1045 2.440980 GCCATCTTGTCCAGGGCC 60.441 66.667 0.00 0.00 38.70 5.80
1047 1048 2.825836 GCCGCCATCTTGTCCAGG 60.826 66.667 0.00 0.00 0.00 4.45
1092 1093 4.133078 GGTGATCATCCAAGATGTCTTCC 58.867 47.826 0.00 5.77 33.11 3.46
1095 1096 3.136077 CCTGGTGATCATCCAAGATGTCT 59.864