Multiple sequence alignment - TraesCS1A01G441700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G441700 chr1A 100.000 2517 0 0 1 2517 590542933 590540417 0.000000e+00 4649
1 TraesCS1A01G441700 chr3A 98.411 2517 39 1 1 2517 719105222 719102707 0.000000e+00 4425
2 TraesCS1A01G441700 chr3A 89.166 2123 198 14 398 2517 562975755 562973662 0.000000e+00 2617
3 TraesCS1A01G441700 chr5B 95.255 2529 105 8 1 2517 220892705 220890180 0.000000e+00 3991
4 TraesCS1A01G441700 chr6B 95.133 2527 111 5 1 2517 579363641 579366165 0.000000e+00 3975
5 TraesCS1A01G441700 chr7A 93.399 2530 146 15 1 2517 40299851 40302372 0.000000e+00 3727
6 TraesCS1A01G441700 chr7B 95.811 2244 81 6 1 2233 17674428 17676669 0.000000e+00 3611
7 TraesCS1A01G441700 chr6A 97.817 1924 40 2 595 2517 28767841 28765919 0.000000e+00 3319
8 TraesCS1A01G441700 chr6A 92.037 540 25 9 1 536 28768376 28767851 0.000000e+00 743
9 TraesCS1A01G441700 chr4A 92.402 2119 156 5 401 2517 718629626 718631741 0.000000e+00 3016
10 TraesCS1A01G441700 chr4A 86.632 389 49 1 1 389 718629172 718629557 6.430000e-116 427
11 TraesCS1A01G441700 chr3B 91.271 2085 176 6 436 2517 750393829 750391748 0.000000e+00 2837


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G441700 chr1A 590540417 590542933 2516 True 4649.0 4649 100.000 1 2517 1 chr1A.!!$R1 2516
1 TraesCS1A01G441700 chr3A 719102707 719105222 2515 True 4425.0 4425 98.411 1 2517 1 chr3A.!!$R2 2516
2 TraesCS1A01G441700 chr3A 562973662 562975755 2093 True 2617.0 2617 89.166 398 2517 1 chr3A.!!$R1 2119
3 TraesCS1A01G441700 chr5B 220890180 220892705 2525 True 3991.0 3991 95.255 1 2517 1 chr5B.!!$R1 2516
4 TraesCS1A01G441700 chr6B 579363641 579366165 2524 False 3975.0 3975 95.133 1 2517 1 chr6B.!!$F1 2516
5 TraesCS1A01G441700 chr7A 40299851 40302372 2521 False 3727.0 3727 93.399 1 2517 1 chr7A.!!$F1 2516
6 TraesCS1A01G441700 chr7B 17674428 17676669 2241 False 3611.0 3611 95.811 1 2233 1 chr7B.!!$F1 2232
7 TraesCS1A01G441700 chr6A 28765919 28768376 2457 True 2031.0 3319 94.927 1 2517 2 chr6A.!!$R1 2516
8 TraesCS1A01G441700 chr4A 718629172 718631741 2569 False 1721.5 3016 89.517 1 2517 2 chr4A.!!$F1 2516
9 TraesCS1A01G441700 chr3B 750391748 750393829 2081 True 2837.0 2837 91.271 436 2517 1 chr3B.!!$R1 2081

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
955 1016 0.325671 TCTCGCAATCCCCCTCTCTT 60.326 55.0 0.0 0.0 0.0 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2333 2396 0.249489 GACAGAGACGCACAACCTGT 60.249 55.0 0.0 0.0 40.37 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 269 1.536284 GGTAACCGAGGAAGATCGCAG 60.536 57.143 0.00 0.00 41.37 5.18
351 352 7.106239 AGAATCAAGTGAAAATCTACGGATGT 58.894 34.615 0.00 0.00 31.75 3.06
955 1016 0.325671 TCTCGCAATCCCCCTCTCTT 60.326 55.000 0.00 0.00 0.00 2.85
1049 1110 8.148351 CCCTGGTATGTAATCGATTTTCTTCTA 58.852 37.037 17.19 2.64 0.00 2.10
1363 1425 1.407258 GACGAGGAAGCTAGCATGACT 59.593 52.381 18.83 9.19 0.00 3.41
2161 2224 0.392461 GCGAACTAGGTTGGCATCCA 60.392 55.000 16.58 2.56 44.46 3.41
2333 2396 3.627395 ATCGTGTGCAGAGGGAAATAA 57.373 42.857 3.52 0.00 0.00 1.40
2472 2535 3.190744 ACGTTAAGATTGAGAGCTGTCGA 59.809 43.478 2.77 2.77 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 269 9.935241 TCCTAAGTGCATTTATATGATCTCTTC 57.065 33.333 1.76 0.0 33.37 2.87
462 523 3.772572 TCTTCTCGGACCCAACAATGATA 59.227 43.478 0.00 0.0 0.00 2.15
576 637 2.391926 TAGGGATATCAGCCGTGGAA 57.608 50.000 4.83 0.0 0.00 3.53
732 793 5.892119 TCTATCATCAACCGTTAGTTCCTCT 59.108 40.000 0.00 0.0 36.18 3.69
955 1016 2.923426 GAATCATCGTCGGCAGCCCA 62.923 60.000 5.63 0.0 0.00 5.36
1049 1110 3.682696 TGCTGAGAAGTTGCATCAGAAT 58.317 40.909 16.58 0.0 42.48 2.40
1363 1425 5.984725 TCAACCTCGCCAGATATAAAAGAA 58.015 37.500 0.00 0.0 0.00 2.52
1514 1577 3.444742 TCCGGTTGTTTAAGCTCGATCTA 59.555 43.478 0.00 0.0 32.23 1.98
1607 1670 2.230992 CGAAATGCCCATTGAAGAACCA 59.769 45.455 0.00 0.0 0.00 3.67
2161 2224 8.562052 CAAGGAACATTACGTTTAGGTAGTTTT 58.438 33.333 0.00 0.0 38.19 2.43
2333 2396 0.249489 GACAGAGACGCACAACCTGT 60.249 55.000 0.00 0.0 40.37 4.00
2472 2535 3.009143 GGTTCTTCCTGTACCACCTCAAT 59.991 47.826 0.00 0.0 36.31 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.