Multiple sequence alignment - TraesCS1A01G435700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G435700 chr1A 100.000 5233 0 0 1 5233 586319153 586313921 0.000000e+00 9664.0
1 TraesCS1A01G435700 chr1A 99.485 5045 11 6 1 5032 586349551 586344509 0.000000e+00 9158.0
2 TraesCS1A01G435700 chr1A 85.362 1421 167 24 3833 5218 586429430 586428016 0.000000e+00 1434.0
3 TraesCS1A01G435700 chr1A 82.489 1639 161 48 604 2167 586520660 586519073 0.000000e+00 1321.0
4 TraesCS1A01G435700 chr1A 78.377 2021 348 58 2921 4912 586924519 586922559 0.000000e+00 1229.0
5 TraesCS1A01G435700 chr1A 76.956 2096 399 64 2921 4964 586518526 586516463 0.000000e+00 1118.0
6 TraesCS1A01G435700 chr1A 76.150 2239 435 73 2716 4912 586410380 586408199 0.000000e+00 1085.0
7 TraesCS1A01G435700 chr1A 83.524 1135 128 27 1099 2174 586714482 586713348 0.000000e+00 1005.0
8 TraesCS1A01G435700 chr1A 76.117 2081 388 77 2579 4607 586712825 586710802 0.000000e+00 989.0
9 TraesCS1A01G435700 chr1A 85.323 804 113 5 1374 2173 586366340 586365538 0.000000e+00 826.0
10 TraesCS1A01G435700 chr1A 81.896 939 157 10 1362 2290 586403487 586402552 0.000000e+00 780.0
11 TraesCS1A01G435700 chr1A 95.455 198 9 0 5031 5228 586344427 586344230 3.040000e-82 316.0
12 TraesCS1A01G435700 chr1A 90.698 43 2 1 973 1015 586926683 586926643 7.320000e-04 56.5
13 TraesCS1A01G435700 chr1D 89.474 2698 219 27 2578 5228 487840560 487837881 0.000000e+00 3349.0
14 TraesCS1A01G435700 chr1D 86.214 2002 154 66 622 2584 487842512 487840594 0.000000e+00 2056.0
15 TraesCS1A01G435700 chr1D 77.421 2117 396 56 2833 4917 488484080 488486146 0.000000e+00 1186.0
16 TraesCS1A01G435700 chr1B 91.821 2262 172 8 2715 4967 679654857 679652600 0.000000e+00 3140.0
17 TraesCS1A01G435700 chr1B 89.545 2152 118 48 604 2699 679657231 679655131 0.000000e+00 2628.0
18 TraesCS1A01G435700 chr1B 77.194 2131 394 70 2835 4917 679709275 679707189 0.000000e+00 1158.0
19 TraesCS1A01G435700 chr1B 85.556 810 114 3 1363 2169 679710581 679709772 0.000000e+00 845.0
20 TraesCS1A01G435700 chr1B 85.208 818 115 4 1362 2173 679701926 679701109 0.000000e+00 835.0
21 TraesCS1A01G435700 chrUn 77.589 2115 393 52 2833 4917 8844812 8842749 0.000000e+00 1205.0
22 TraesCS1A01G435700 chrUn 83.497 915 132 12 1363 2261 8846044 8845133 0.000000e+00 835.0
23 TraesCS1A01G435700 chrUn 90.343 321 29 2 271 589 50866138 50866458 2.250000e-113 420.0
24 TraesCS1A01G435700 chrUn 90.343 321 29 2 271 589 286938451 286938771 2.250000e-113 420.0
25 TraesCS1A01G435700 chr2A 95.597 318 13 1 273 589 759580244 759580561 4.680000e-140 508.0
26 TraesCS1A01G435700 chr7D 76.966 890 188 13 3001 3881 10471081 10470200 4.710000e-135 492.0
27 TraesCS1A01G435700 chr2D 93.396 318 20 1 273 589 525723662 525723345 2.210000e-128 470.0
28 TraesCS1A01G435700 chr3B 91.509 318 26 1 273 589 686336244 686336561 2.240000e-118 436.0
29 TraesCS1A01G435700 chr3A 90.683 322 28 2 269 589 74454921 74454601 1.350000e-115 427.0
30 TraesCS1A01G435700 chr2B 90.909 319 27 2 273 589 366027317 366026999 1.350000e-115 427.0
31 TraesCS1A01G435700 chr4A 90.343 321 29 2 271 589 714256966 714256646 2.250000e-113 420.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G435700 chr1A 586313921 586319153 5232 True 9664.00 9664 100.0000 1 5233 1 chr1A.!!$R1 5232
1 TraesCS1A01G435700 chr1A 586344230 586349551 5321 True 4737.00 9158 97.4700 1 5228 2 chr1A.!!$R6 5227
2 TraesCS1A01G435700 chr1A 586428016 586429430 1414 True 1434.00 1434 85.3620 3833 5218 1 chr1A.!!$R5 1385
3 TraesCS1A01G435700 chr1A 586516463 586520660 4197 True 1219.50 1321 79.7225 604 4964 2 chr1A.!!$R7 4360
4 TraesCS1A01G435700 chr1A 586408199 586410380 2181 True 1085.00 1085 76.1500 2716 4912 1 chr1A.!!$R4 2196
5 TraesCS1A01G435700 chr1A 586710802 586714482 3680 True 997.00 1005 79.8205 1099 4607 2 chr1A.!!$R8 3508
6 TraesCS1A01G435700 chr1A 586365538 586366340 802 True 826.00 826 85.3230 1374 2173 1 chr1A.!!$R2 799
7 TraesCS1A01G435700 chr1A 586402552 586403487 935 True 780.00 780 81.8960 1362 2290 1 chr1A.!!$R3 928
8 TraesCS1A01G435700 chr1A 586922559 586926683 4124 True 642.75 1229 84.5375 973 4912 2 chr1A.!!$R9 3939
9 TraesCS1A01G435700 chr1D 487837881 487842512 4631 True 2702.50 3349 87.8440 622 5228 2 chr1D.!!$R1 4606
10 TraesCS1A01G435700 chr1D 488484080 488486146 2066 False 1186.00 1186 77.4210 2833 4917 1 chr1D.!!$F1 2084
11 TraesCS1A01G435700 chr1B 679652600 679657231 4631 True 2884.00 3140 90.6830 604 4967 2 chr1B.!!$R2 4363
12 TraesCS1A01G435700 chr1B 679707189 679710581 3392 True 1001.50 1158 81.3750 1363 4917 2 chr1B.!!$R3 3554
13 TraesCS1A01G435700 chr1B 679701109 679701926 817 True 835.00 835 85.2080 1362 2173 1 chr1B.!!$R1 811
14 TraesCS1A01G435700 chrUn 8842749 8846044 3295 True 1020.00 1205 80.5430 1363 4917 2 chrUn.!!$R1 3554
15 TraesCS1A01G435700 chr7D 10470200 10471081 881 True 492.00 492 76.9660 3001 3881 1 chr7D.!!$R1 880

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
382 388 1.746991 GGAGGGAAAGCTGAAGCCG 60.747 63.158 0.0 0.0 43.38 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
5116 6615 7.275183 CACATTCCACTACTGAAATCATAGGA 58.725 38.462 0.0 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 76 7.678194 TCAGCAAACTTTCACTTAAAATTCG 57.322 32.000 0.00 0.00 0.00 3.34
302 308 9.457436 TTTAGGTGAACTAGGGATTTATTCAAC 57.543 33.333 0.00 0.00 37.27 3.18
382 388 1.746991 GGAGGGAAAGCTGAAGCCG 60.747 63.158 0.00 0.00 43.38 5.52
5090 6589 4.263677 GCATATTAATTTCCGCATGCATCG 59.736 41.667 19.57 3.78 38.84 3.84
5112 6611 2.635915 TGAGGGTTACACCGAACTGAAT 59.364 45.455 0.00 0.00 39.83 2.57
5116 6615 4.891168 AGGGTTACACCGAACTGAATTTTT 59.109 37.500 0.00 0.00 39.83 1.94
5142 6641 6.484643 CCTATGATTTCAGTAGTGGAATGTGG 59.515 42.308 8.91 2.43 31.32 4.17
5143 6642 5.241403 TGATTTCAGTAGTGGAATGTGGT 57.759 39.130 8.91 0.00 31.32 4.16
5228 6727 7.663081 AGTTCACAGTGATTAGAACACATGATT 59.337 33.333 3.45 0.00 42.01 2.57
5229 6728 7.368480 TCACAGTGATTAGAACACATGATTG 57.632 36.000 0.00 0.00 40.25 2.67
5230 6729 6.936335 TCACAGTGATTAGAACACATGATTGT 59.064 34.615 0.00 0.00 40.25 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
302 308 2.095969 TGTATTGCTTCGGCTTTGAACG 60.096 45.455 0.00 0.00 42.37 3.95
5112 6611 9.753674 ATTCCACTACTGAAATCATAGGAAAAA 57.246 29.630 0.00 0.00 36.36 1.94
5116 6615 7.275183 CACATTCCACTACTGAAATCATAGGA 58.725 38.462 0.00 0.00 0.00 2.94
5206 6705 7.137490 ACAATCATGTGTTCTAATCACTGTG 57.863 36.000 0.17 0.17 38.69 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.