Multiple sequence alignment - TraesCS1A01G422200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G422200 chr1A 100.000 4109 0 0 1 4109 577872974 577868866 0.000000e+00 7589
1 TraesCS1A01G422200 chr1A 98.807 4109 44 2 1 4109 534055780 534059883 0.000000e+00 7312
2 TraesCS1A01G422200 chr5B 99.075 4109 37 1 1 4109 370076120 370072013 0.000000e+00 7376
3 TraesCS1A01G422200 chr5B 98.924 3439 37 0 1 3439 91894559 91891121 0.000000e+00 6146
4 TraesCS1A01G422200 chr5B 96.750 1723 36 8 1 1722 648302196 648303899 0.000000e+00 2854
5 TraesCS1A01G422200 chr5B 95.190 1372 29 6 2758 4109 648303896 648305250 0.000000e+00 2134
6 TraesCS1A01G422200 chr3B 98.807 4109 44 2 1 4109 49391884 49395987 0.000000e+00 7312
7 TraesCS1A01G422200 chr4A 98.759 4108 48 2 4 4109 646968260 646964154 0.000000e+00 7300
8 TraesCS1A01G422200 chr5A 96.659 4130 78 18 1 4109 1214070 1218160 0.000000e+00 6807
9 TraesCS1A01G422200 chr2D 95.734 3657 95 16 373 4006 608731594 608727976 0.000000e+00 5832
10 TraesCS1A01G422200 chr2D 85.185 378 16 15 1 357 608731878 608731520 6.540000e-93 351
11 TraesCS1A01G422200 chr2D 93.277 119 8 0 3991 4109 608727958 608727840 4.220000e-40 176
12 TraesCS1A01G422200 chr7D 94.755 3394 110 15 282 3634 622369559 622366193 0.000000e+00 5219
13 TraesCS1A01G422200 chr7D 93.519 432 23 4 3675 4106 622366181 622365755 4.480000e-179 638
14 TraesCS1A01G422200 chr6D 94.842 3218 114 15 282 3474 467003091 466999901 0.000000e+00 4975
15 TraesCS1A01G422200 chr5D 94.814 2989 99 17 282 3244 3625913 3628871 0.000000e+00 4610
16 TraesCS1A01G422200 chr5D 91.459 281 16 3 3828 4101 3628883 3629162 3.000000e-101 379
17 TraesCS1A01G422200 chr2B 96.591 2024 49 6 1 2023 793904558 793902554 0.000000e+00 3338
18 TraesCS1A01G422200 chr3D 86.786 2013 220 30 1932 3928 604830957 604828975 0.000000e+00 2202
19 TraesCS1A01G422200 chr1B 83.034 1668 226 34 2281 3929 66338179 66336550 0.000000e+00 1459


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G422200 chr1A 577868866 577872974 4108 True 7589.000000 7589 100.000000 1 4109 1 chr1A.!!$R1 4108
1 TraesCS1A01G422200 chr1A 534055780 534059883 4103 False 7312.000000 7312 98.807000 1 4109 1 chr1A.!!$F1 4108
2 TraesCS1A01G422200 chr5B 370072013 370076120 4107 True 7376.000000 7376 99.075000 1 4109 1 chr5B.!!$R2 4108
3 TraesCS1A01G422200 chr5B 91891121 91894559 3438 True 6146.000000 6146 98.924000 1 3439 1 chr5B.!!$R1 3438
4 TraesCS1A01G422200 chr5B 648302196 648305250 3054 False 2494.000000 2854 95.970000 1 4109 2 chr5B.!!$F1 4108
5 TraesCS1A01G422200 chr3B 49391884 49395987 4103 False 7312.000000 7312 98.807000 1 4109 1 chr3B.!!$F1 4108
6 TraesCS1A01G422200 chr4A 646964154 646968260 4106 True 7300.000000 7300 98.759000 4 4109 1 chr4A.!!$R1 4105
7 TraesCS1A01G422200 chr5A 1214070 1218160 4090 False 6807.000000 6807 96.659000 1 4109 1 chr5A.!!$F1 4108
8 TraesCS1A01G422200 chr2D 608727840 608731878 4038 True 2119.666667 5832 91.398667 1 4109 3 chr2D.!!$R1 4108
9 TraesCS1A01G422200 chr7D 622365755 622369559 3804 True 2928.500000 5219 94.137000 282 4106 2 chr7D.!!$R1 3824
10 TraesCS1A01G422200 chr6D 466999901 467003091 3190 True 4975.000000 4975 94.842000 282 3474 1 chr6D.!!$R1 3192
11 TraesCS1A01G422200 chr5D 3625913 3629162 3249 False 2494.500000 4610 93.136500 282 4101 2 chr5D.!!$F1 3819
12 TraesCS1A01G422200 chr2B 793902554 793904558 2004 True 3338.000000 3338 96.591000 1 2023 1 chr2B.!!$R1 2022
13 TraesCS1A01G422200 chr3D 604828975 604830957 1982 True 2202.000000 2202 86.786000 1932 3928 1 chr3D.!!$R1 1996
14 TraesCS1A01G422200 chr1B 66336550 66338179 1629 True 1459.000000 1459 83.034000 2281 3929 1 chr1B.!!$R1 1648

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
284 306 0.609957 ACCGGTGATCTGTACGTGGA 60.610 55.000 6.12 0.0 0.00 4.02 F
2014 2104 3.133003 AGACGAGGATGGACCAAATGTAG 59.867 47.826 0.00 0.0 42.04 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2272 2362 2.551270 TCCTTGCACAACCCTCTCTAT 58.449 47.619 0.0 0.0 0.0 1.98 R
3517 3637 2.739913 GGAAATGACGACCAATCAACGA 59.260 45.455 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
284 306 0.609957 ACCGGTGATCTGTACGTGGA 60.610 55.000 6.12 0.00 0.00 4.02
407 429 5.010708 TCCCTTTTGCCCTATCTTTCTTT 57.989 39.130 0.00 0.00 0.00 2.52
2014 2104 3.133003 AGACGAGGATGGACCAAATGTAG 59.867 47.826 0.00 0.00 42.04 2.74
2163 2253 3.998913 TGGGCAAGATGTTACATGAGA 57.001 42.857 1.24 0.00 0.00 3.27
2272 2362 2.370349 TCCTTCGGTTTTTCAAGCACA 58.630 42.857 0.00 0.00 0.00 4.57
2482 2572 9.089601 CATCGGTACAACACAATGTTTATACTA 57.910 33.333 0.00 3.75 38.77 1.82
2504 2594 0.874390 GCGATTGCAAGTCTTGACCA 59.126 50.000 16.99 2.84 42.15 4.02
3081 3182 6.703319 TCAAACTCATCCGGTAAATGTCTTA 58.297 36.000 0.00 0.00 0.00 2.10
3093 3194 8.365647 CCGGTAAATGTCTTACACCTATCTAAT 58.634 37.037 0.00 0.00 0.00 1.73
3477 3597 4.603989 AGATCGACAGATGATGCAGAAT 57.396 40.909 0.00 0.00 37.19 2.40
3517 3637 3.065786 CACATAAGGCGCAATCAGTTGAT 59.934 43.478 10.83 0.00 37.53 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
284 306 2.165998 GCAAAAGGGAGTTGATCTGCT 58.834 47.619 0.00 0.00 34.83 4.24
407 429 2.831526 TCTGAACATGGAGGACGATCAA 59.168 45.455 0.00 0.00 0.00 2.57
2163 2253 6.830912 TCTCATGCCTATAGTGTAAGCATTT 58.169 36.000 9.81 0.00 42.04 2.32
2272 2362 2.551270 TCCTTGCACAACCCTCTCTAT 58.449 47.619 0.00 0.00 0.00 1.98
2504 2594 9.017509 TGCACTCTTCTTCATATGAAAATTCTT 57.982 29.630 18.47 0.79 33.07 2.52
2810 2900 7.516198 ACTAGTTTGATGCACTCTTTTGATT 57.484 32.000 0.00 0.00 0.00 2.57
3081 3182 6.836527 AGCAAGTACTCTCATTAGATAGGTGT 59.163 38.462 0.00 0.00 0.00 4.16
3477 3597 3.615155 TGTGTGCCGATTCAATTATCCA 58.385 40.909 0.00 0.00 0.00 3.41
3517 3637 2.739913 GGAAATGACGACCAATCAACGA 59.260 45.455 0.00 0.00 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.