Multiple sequence alignment - TraesCS1A01G404000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G404000 chr1A 100.000 2504 0 0 1 2504 567462860 567465363 0.000000e+00 4625
1 TraesCS1A01G404000 chr2A 98.857 2450 13 6 66 2504 43392611 43390166 0.000000e+00 4355
2 TraesCS1A01G404000 chr2A 98.816 2450 15 6 66 2504 719466109 719463663 0.000000e+00 4351
3 TraesCS1A01G404000 chr2A 96.000 75 2 1 1 75 43392742 43392669 1.220000e-23 121
4 TraesCS1A01G404000 chr5B 98.816 2450 15 6 66 2504 179239775 179237329 0.000000e+00 4351
5 TraesCS1A01G404000 chr5B 98.449 2450 23 7 66 2504 406858300 406860745 0.000000e+00 4300
6 TraesCS1A01G404000 chr5B 94.667 75 3 1 1 75 179239906 179239833 5.660000e-22 115
7 TraesCS1A01G404000 chr5B 94.667 75 3 1 1 75 420729651 420729578 5.660000e-22 115
8 TraesCS1A01G404000 chr6B 98.734 2449 18 5 66 2504 408674280 408671835 0.000000e+00 4338
9 TraesCS1A01G404000 chr6B 98.490 2450 23 6 66 2504 704838359 704840805 0.000000e+00 4307
10 TraesCS1A01G404000 chr6B 96.000 75 2 1 1 75 408674411 408674338 1.220000e-23 121
11 TraesCS1A01G404000 chr6B 95.833 72 2 1 1 72 704838228 704838298 5.660000e-22 115
12 TraesCS1A01G404000 chr7B 98.572 2451 21 6 66 2504 528912415 528909967 0.000000e+00 4320
13 TraesCS1A01G404000 chr7B 94.667 75 3 1 1 75 528912546 528912473 5.660000e-22 115
14 TraesCS1A01G404000 chr7A 98.408 2450 26 5 66 2504 171430954 171428507 0.000000e+00 4296
15 TraesCS1A01G404000 chr7A 94.667 75 3 1 1 75 171431085 171431012 5.660000e-22 115
16 TraesCS1A01G404000 chr3B 98.447 2447 24 5 66 2501 552490451 552488008 0.000000e+00 4296
17 TraesCS1A01G404000 chr3B 94.667 75 3 1 1 75 552490582 552490509 5.660000e-22 115
18 TraesCS1A01G404000 chr4B 98.082 2450 33 7 66 2504 194231443 194228997 0.000000e+00 4252
19 TraesCS1A01G404000 chr4B 94.667 75 3 1 1 75 194231574 194231501 5.660000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G404000 chr1A 567462860 567465363 2503 False 4625.0 4625 100.0000 1 2504 1 chr1A.!!$F1 2503
1 TraesCS1A01G404000 chr2A 719463663 719466109 2446 True 4351.0 4351 98.8160 66 2504 1 chr2A.!!$R1 2438
2 TraesCS1A01G404000 chr2A 43390166 43392742 2576 True 2238.0 4355 97.4285 1 2504 2 chr2A.!!$R2 2503
3 TraesCS1A01G404000 chr5B 406858300 406860745 2445 False 4300.0 4300 98.4490 66 2504 1 chr5B.!!$F1 2438
4 TraesCS1A01G404000 chr5B 179237329 179239906 2577 True 2233.0 4351 96.7415 1 2504 2 chr5B.!!$R2 2503
5 TraesCS1A01G404000 chr6B 408671835 408674411 2576 True 2229.5 4338 97.3670 1 2504 2 chr6B.!!$R1 2503
6 TraesCS1A01G404000 chr6B 704838228 704840805 2577 False 2211.0 4307 97.1615 1 2504 2 chr6B.!!$F1 2503
7 TraesCS1A01G404000 chr7B 528909967 528912546 2579 True 2217.5 4320 96.6195 1 2504 2 chr7B.!!$R1 2503
8 TraesCS1A01G404000 chr7A 171428507 171431085 2578 True 2205.5 4296 96.5375 1 2504 2 chr7A.!!$R1 2503
9 TraesCS1A01G404000 chr3B 552488008 552490582 2574 True 2205.5 4296 96.5570 1 2501 2 chr3B.!!$R1 2500
10 TraesCS1A01G404000 chr4B 194228997 194231574 2577 True 2183.5 4252 96.3745 1 2504 2 chr4B.!!$R1 2503

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1197 1279 8.310122 AGGCAATGTTCAGGATTTACAATATT 57.69 30.769 0.0 0.0 0.0 1.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2179 2265 4.046286 AGGAAACCATCAAGTTGCCATA 57.954 40.909 4.3 0.0 46.71 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1197 1279 8.310122 AGGCAATGTTCAGGATTTACAATATT 57.690 30.769 0.00 0.00 0.00 1.28
1223 1305 7.000472 ACTTCAAAGAATTCACCATCTCTCAA 59.000 34.615 8.44 0.00 0.00 3.02
1658 1740 4.515567 GGTACCAAGAGTTTCAGTTTGGAG 59.484 45.833 7.15 0.00 42.05 3.86
2091 2176 1.587547 GGGCAGTTATAGCAGCTGAC 58.412 55.000 20.43 9.11 42.63 3.51
2404 2490 9.830975 AACTAAAAATGGCAGTTAAATCAAAGT 57.169 25.926 0.00 0.00 30.89 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 8.644432 ATTCTATATCTACCCATGGCCTTATT 57.356 34.615 6.09 0.0 0.00 1.40
227 297 9.356433 CACATAAAATGCATGATCACACTAAAA 57.644 29.630 0.00 0.0 0.00 1.52
228 298 8.522003 ACACATAAAATGCATGATCACACTAAA 58.478 29.630 0.00 0.0 0.00 1.85
229 299 7.969508 CACACATAAAATGCATGATCACACTAA 59.030 33.333 0.00 0.0 0.00 2.24
232 302 6.094719 ACACACATAAAATGCATGATCACAC 58.905 36.000 0.00 0.0 0.00 3.82
1197 1279 7.679783 TGAGAGATGGTGAATTCTTTGAAGTA 58.320 34.615 7.05 0.0 0.00 2.24
1223 1305 2.730382 TGATCATCTTGCACCATGCTT 58.270 42.857 2.02 0.0 45.31 3.91
1658 1740 5.382618 AACTCTTGCCATCAAATCTGAAC 57.617 39.130 0.00 0.0 34.49 3.18
2179 2265 4.046286 AGGAAACCATCAAGTTGCCATA 57.954 40.909 4.30 0.0 46.71 2.74
2231 2317 7.021196 GCATGTAGAATCGCTTAGTTTTTCAA 58.979 34.615 0.00 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.