Multiple sequence alignment - TraesCS1A01G400100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G400100 chr1A 100.000 1566 0 0 1 1566 564261206 564259641 0.000000e+00 2892
1 TraesCS1A01G400100 chr1A 93.760 1234 45 2 356 1566 564251072 564252296 0.000000e+00 1823
2 TraesCS1A01G400100 chr1A 90.863 1182 73 16 355 1509 514986824 514985651 0.000000e+00 1552
3 TraesCS1A01G400100 chr1A 100.000 349 0 0 1922 2270 564259285 564258937 0.000000e+00 645
4 TraesCS1A01G400100 chr1A 95.556 360 15 1 3 362 564250687 564251045 1.960000e-160 575
5 TraesCS1A01G400100 chr1A 94.556 349 15 3 1922 2270 564252344 564252688 9.230000e-149 536
6 TraesCS1A01G400100 chr1A 92.623 366 21 4 3 362 588666495 588666130 2.580000e-144 521
7 TraesCS1A01G400100 chr1A 92.571 350 15 7 1922 2270 515250370 515250031 2.030000e-135 492
8 TraesCS1A01G400100 chr1A 90.000 350 23 8 1922 2270 514985519 514985181 2.070000e-120 442
9 TraesCS1A01G400100 chr3A 91.182 1633 69 38 3 1566 702488570 702486944 0.000000e+00 2148
10 TraesCS1A01G400100 chr3A 92.177 1240 62 16 355 1566 737723059 737721827 0.000000e+00 1720
11 TraesCS1A01G400100 chr3A 91.040 1183 73 5 355 1509 80569658 80570835 0.000000e+00 1567
12 TraesCS1A01G400100 chr3A 90.313 351 20 6 1922 2270 700689096 700688758 4.450000e-122 448
13 TraesCS1A01G400100 chr3A 89.429 350 28 7 1922 2270 80570818 80571159 1.250000e-117 433
14 TraesCS1A01G400100 chr3A 91.429 315 22 3 1957 2270 702487009 702486699 5.790000e-116 427
15 TraesCS1A01G400100 chr7A 92.308 1235 68 6 355 1566 735979811 735978581 0.000000e+00 1729
16 TraesCS1A01G400100 chr7A 94.722 360 19 0 3 362 118423879 118424238 5.480000e-156 560
17 TraesCS1A01G400100 chr7A 92.896 366 20 4 3 362 58357777 58358142 5.550000e-146 527
18 TraesCS1A01G400100 chr7A 93.590 312 12 4 355 660 5751598 5751289 2.050000e-125 459
19 TraesCS1A01G400100 chr7A 89.802 353 19 7 1922 2270 118425399 118425738 9.630000e-119 436
20 TraesCS1A01G400100 chr2A 92.470 1235 47 8 355 1566 52605335 52604124 0.000000e+00 1724
21 TraesCS1A01G400100 chr2A 90.768 1289 31 28 355 1565 161588580 161587302 0.000000e+00 1640
22 TraesCS1A01G400100 chr2A 90.380 1185 80 6 355 1509 767477719 767476539 0.000000e+00 1526
23 TraesCS1A01G400100 chr4A 91.329 1257 53 9 355 1565 556010663 556009417 0.000000e+00 1666
24 TraesCS1A01G400100 chr4A 92.333 900 60 3 615 1509 66536002 66536897 0.000000e+00 1271
25 TraesCS1A01G400100 chr4A 95.014 361 16 2 3 362 556011049 556010690 1.180000e-157 566
26 TraesCS1A01G400100 chr5A 91.040 1183 74 5 355 1509 459479195 459478017 0.000000e+00 1568
27 TraesCS1A01G400100 chr5A 93.093 333 20 3 33 362 573790813 573791145 3.390000e-133 484
28 TraesCS1A01G400100 chr5A 89.946 368 27 6 3 362 459479587 459479222 1.230000e-127 466
29 TraesCS1A01G400100 chr5A 90.598 351 24 4 1922 2270 573792321 573792664 7.390000e-125 457
30 TraesCS1A01G400100 chr3D 89.174 545 35 2 355 876 2337843 2337300 0.000000e+00 658
31 TraesCS1A01G400100 chr3D 82.785 790 61 30 2 749 447497034 447496278 8.840000e-179 636
32 TraesCS1A01G400100 chr2B 81.965 682 97 17 220 880 693253714 693254390 2.550000e-154 555
33 TraesCS1A01G400100 chr6A 93.611 360 23 0 3 362 21600910 21601269 2.570000e-149 538
34 TraesCS1A01G400100 chr7D 87.395 238 20 7 2034 2270 54727334 54727106 4.810000e-67 265


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G400100 chr1A 564258937 564261206 2269 True 1768.5 2892 100.0000 1 2270 2 chr1A.!!$R4 2269
1 TraesCS1A01G400100 chr1A 514985181 514986824 1643 True 997.0 1552 90.4315 355 2270 2 chr1A.!!$R3 1915
2 TraesCS1A01G400100 chr1A 564250687 564252688 2001 False 978.0 1823 94.6240 3 2270 3 chr1A.!!$F1 2267
3 TraesCS1A01G400100 chr3A 737721827 737723059 1232 True 1720.0 1720 92.1770 355 1566 1 chr3A.!!$R2 1211
4 TraesCS1A01G400100 chr3A 702486699 702488570 1871 True 1287.5 2148 91.3055 3 2270 2 chr3A.!!$R3 2267
5 TraesCS1A01G400100 chr3A 80569658 80571159 1501 False 1000.0 1567 90.2345 355 2270 2 chr3A.!!$F1 1915
6 TraesCS1A01G400100 chr7A 735978581 735979811 1230 True 1729.0 1729 92.3080 355 1566 1 chr7A.!!$R2 1211
7 TraesCS1A01G400100 chr7A 118423879 118425738 1859 False 498.0 560 92.2620 3 2270 2 chr7A.!!$F2 2267
8 TraesCS1A01G400100 chr2A 52604124 52605335 1211 True 1724.0 1724 92.4700 355 1566 1 chr2A.!!$R1 1211
9 TraesCS1A01G400100 chr2A 161587302 161588580 1278 True 1640.0 1640 90.7680 355 1565 1 chr2A.!!$R2 1210
10 TraesCS1A01G400100 chr2A 767476539 767477719 1180 True 1526.0 1526 90.3800 355 1509 1 chr2A.!!$R3 1154
11 TraesCS1A01G400100 chr4A 66536002 66536897 895 False 1271.0 1271 92.3330 615 1509 1 chr4A.!!$F1 894
12 TraesCS1A01G400100 chr4A 556009417 556011049 1632 True 1116.0 1666 93.1715 3 1565 2 chr4A.!!$R1 1562
13 TraesCS1A01G400100 chr5A 459478017 459479587 1570 True 1017.0 1568 90.4930 3 1509 2 chr5A.!!$R1 1506
14 TraesCS1A01G400100 chr5A 573790813 573792664 1851 False 470.5 484 91.8455 33 2270 2 chr5A.!!$F1 2237
15 TraesCS1A01G400100 chr3D 2337300 2337843 543 True 658.0 658 89.1740 355 876 1 chr3D.!!$R1 521
16 TraesCS1A01G400100 chr3D 447496278 447497034 756 True 636.0 636 82.7850 2 749 1 chr3D.!!$R2 747
17 TraesCS1A01G400100 chr2B 693253714 693254390 676 False 555.0 555 81.9650 220 880 1 chr2B.!!$F1 660

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
319 345 4.003788 CCCTTCACCACCTCGCGT 62.004 66.667 5.77 0.0 0.0 6.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2218 2650 1.481363 GGGAGCGACTTACTAAGCCTT 59.519 52.381 0.0 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 187 4.749310 CTTGACCGCTCGGCTGCT 62.749 66.667 8.41 0.0 39.32 4.24
319 345 4.003788 CCCTTCACCACCTCGCGT 62.004 66.667 5.77 0.0 0.00 6.01
1196 1305 2.807045 CCTCGACGACAGCAGCAC 60.807 66.667 0.00 0.0 0.00 4.40
1403 1534 7.275183 TGAAATATCGAGTGTCTGAATGGATT 58.725 34.615 0.00 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.799755 GCGGTGGCGTGTGAATCC 61.800 66.667 0.00 0.00 0.00 3.01
164 187 2.513666 GGCGATCAATGCCGGTGA 60.514 61.111 1.90 0.00 43.70 4.02
319 345 4.704103 AGAGGGAGAGGCACGGCA 62.704 66.667 0.00 0.00 0.00 5.69
757 840 3.737172 GTGCATGGCGCCGAAGTT 61.737 61.111 23.90 0.26 41.33 2.66
992 1092 1.454295 TAGCCCGGCATGTCGTCTA 60.454 57.895 19.75 15.73 0.00 2.59
1111 1211 1.558294 GTGATACCCGGGAAAGTCCTT 59.442 52.381 32.02 3.84 36.57 3.36
2203 2635 4.069232 CTTGCTCGGCTCCGTGGA 62.069 66.667 8.28 4.32 40.74 4.02
2218 2650 1.481363 GGGAGCGACTTACTAAGCCTT 59.519 52.381 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.