Multiple sequence alignment - TraesCS1A01G388200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G388200 chr1A 100.000 3026 0 0 1 3026 556823292 556820267 0.000000e+00 5589
1 TraesCS1A01G388200 chr1A 98.573 2874 37 4 153 3026 556830952 556833821 0.000000e+00 5077
2 TraesCS1A01G388200 chr1A 98.472 2880 34 6 148 3026 555947316 555944446 0.000000e+00 5066
3 TraesCS1A01G388200 chr1A 98.434 2874 41 4 153 3026 553062197 553065066 0.000000e+00 5055
4 TraesCS1A01G388200 chr1A 93.832 2351 125 9 677 3026 8022946 8025277 0.000000e+00 3520
5 TraesCS1A01G388200 chr7A 98.782 2874 29 5 153 3026 589768005 589765138 0.000000e+00 5108
6 TraesCS1A01G388200 chr3D 97.878 2875 53 6 153 3026 104031944 104034811 0.000000e+00 4964
7 TraesCS1A01G388200 chr2A 92.294 2907 152 35 149 3026 3770342 3767479 0.000000e+00 4061
8 TraesCS1A01G388200 chr2A 98.464 2084 30 2 944 3026 766840021 766842103 0.000000e+00 3670
9 TraesCS1A01G388200 chr4A 91.068 2922 180 35 147 3026 16989631 16992513 0.000000e+00 3875
10 TraesCS1A01G388200 chr2B 89.177 2929 224 57 151 3026 175446710 175443822 0.000000e+00 3567
11 TraesCS1A01G388200 chr2B 84.259 540 75 8 746 1284 98778308 98777778 4.470000e-143 518
12 TraesCS1A01G388200 chr6B 82.210 1068 111 35 153 1184 479296661 479297685 0.000000e+00 846
13 TraesCS1A01G388200 chr7D 94.090 423 24 1 152 574 546635014 546634593 2.540000e-180 641
14 TraesCS1A01G388200 chr5D 84.603 617 72 14 677 1275 443247577 443248188 2.600000e-165 592
15 TraesCS1A01G388200 chr1D 85.172 580 70 7 686 1252 442783607 442783031 5.620000e-162 580
16 TraesCS1A01G388200 chr1D 96.732 153 5 0 1 153 464396903 464396751 3.870000e-64 255
17 TraesCS1A01G388200 chr1B 79.517 786 96 31 153 902 373112336 373111580 1.620000e-137 499
18 TraesCS1A01G388200 chr1B 78.508 898 94 47 153 980 684285959 684286827 5.830000e-137 497
19 TraesCS1A01G388200 chr1B 94.118 153 9 0 1 153 640600568 640600416 1.810000e-57 233
20 TraesCS1A01G388200 chr2D 81.055 512 69 16 153 653 599806382 599805888 1.700000e-102 383


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G388200 chr1A 556820267 556823292 3025 True 5589 5589 100.000 1 3026 1 chr1A.!!$R2 3025
1 TraesCS1A01G388200 chr1A 556830952 556833821 2869 False 5077 5077 98.573 153 3026 1 chr1A.!!$F3 2873
2 TraesCS1A01G388200 chr1A 555944446 555947316 2870 True 5066 5066 98.472 148 3026 1 chr1A.!!$R1 2878
3 TraesCS1A01G388200 chr1A 553062197 553065066 2869 False 5055 5055 98.434 153 3026 1 chr1A.!!$F2 2873
4 TraesCS1A01G388200 chr1A 8022946 8025277 2331 False 3520 3520 93.832 677 3026 1 chr1A.!!$F1 2349
5 TraesCS1A01G388200 chr7A 589765138 589768005 2867 True 5108 5108 98.782 153 3026 1 chr7A.!!$R1 2873
6 TraesCS1A01G388200 chr3D 104031944 104034811 2867 False 4964 4964 97.878 153 3026 1 chr3D.!!$F1 2873
7 TraesCS1A01G388200 chr2A 3767479 3770342 2863 True 4061 4061 92.294 149 3026 1 chr2A.!!$R1 2877
8 TraesCS1A01G388200 chr2A 766840021 766842103 2082 False 3670 3670 98.464 944 3026 1 chr2A.!!$F1 2082
9 TraesCS1A01G388200 chr4A 16989631 16992513 2882 False 3875 3875 91.068 147 3026 1 chr4A.!!$F1 2879
10 TraesCS1A01G388200 chr2B 175443822 175446710 2888 True 3567 3567 89.177 151 3026 1 chr2B.!!$R2 2875
11 TraesCS1A01G388200 chr2B 98777778 98778308 530 True 518 518 84.259 746 1284 1 chr2B.!!$R1 538
12 TraesCS1A01G388200 chr6B 479296661 479297685 1024 False 846 846 82.210 153 1184 1 chr6B.!!$F1 1031
13 TraesCS1A01G388200 chr5D 443247577 443248188 611 False 592 592 84.603 677 1275 1 chr5D.!!$F1 598
14 TraesCS1A01G388200 chr1D 442783031 442783607 576 True 580 580 85.172 686 1252 1 chr1D.!!$R1 566
15 TraesCS1A01G388200 chr1B 373111580 373112336 756 True 499 499 79.517 153 902 1 chr1B.!!$R1 749
16 TraesCS1A01G388200 chr1B 684285959 684286827 868 False 497 497 78.508 153 980 1 chr1B.!!$F1 827

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
305 315 0.242825 TCAGCGTCGGTCGATCTTTT 59.757 50.0 0.0 0.0 42.86 2.27 F
308 318 0.734942 GCGTCGGTCGATCTTTTCCA 60.735 55.0 0.0 0.0 42.86 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1586 1746 2.489938 TCCACGAAAAGCCAAGCTAT 57.51 45.000 0.0 0.0 38.25 2.97 R
2561 2731 4.519540 ACTGCATTACGCCTTCAATTTT 57.48 36.364 0.0 0.0 41.33 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 4.493747 CTTCTCCCGGACGACGCC 62.494 72.222 0.73 0.00 42.52 5.68
34 35 4.194720 CCCTCTCGGCCGTCTTCG 62.195 72.222 27.15 9.92 0.00 3.79
35 36 4.856607 CCTCTCGGCCGTCTTCGC 62.857 72.222 27.15 0.00 35.54 4.70
63 64 2.654404 GGCTATGCCGACGTCGTC 60.654 66.667 33.49 24.43 39.62 4.20
64 65 2.654404 GCTATGCCGACGTCGTCC 60.654 66.667 33.49 24.24 37.74 4.79
65 66 2.352001 CTATGCCGACGTCGTCCG 60.352 66.667 33.49 20.86 44.03 4.79
283 289 1.823976 CGAGAGTAAAGAGGGCCCC 59.176 63.158 21.43 10.60 0.00 5.80
305 315 0.242825 TCAGCGTCGGTCGATCTTTT 59.757 50.000 0.00 0.00 42.86 2.27
308 318 0.734942 GCGTCGGTCGATCTTTTCCA 60.735 55.000 0.00 0.00 42.86 3.53
501 542 1.942776 TCAGCTGGACATTGGAGAGA 58.057 50.000 15.13 0.00 0.00 3.10
510 551 1.971357 ACATTGGAGAGAAGACGGTGT 59.029 47.619 0.00 0.00 0.00 4.16
581 631 3.952799 GAGGTGCCCTCCCCCTCTT 62.953 68.421 9.46 0.00 44.36 2.85
629 687 3.505808 GCTCTTCAGACTTGAGCGT 57.494 52.632 0.00 0.00 42.70 5.07
856 984 3.256879 GCCAAAAGGAAGAGAAAGAAGGG 59.743 47.826 0.00 0.00 0.00 3.95
880 1008 6.663523 GGAAAAGATGAAGAGGTAAAATCCCA 59.336 38.462 0.00 0.00 0.00 4.37
1493 1653 5.069318 ACCAGCCAAAAATAAAACCATTGG 58.931 37.500 0.00 0.00 42.68 3.16
1586 1746 9.030452 AGCCATTGTTAAATATCTTGGTAAACA 57.970 29.630 0.00 0.00 0.00 2.83
2009 2171 7.602644 TGTACTTCTTGACGCAATAGATTCTTT 59.397 33.333 0.00 0.00 0.00 2.52
2010 2172 7.440523 ACTTCTTGACGCAATAGATTCTTTT 57.559 32.000 0.00 0.00 0.00 2.27
2475 2641 5.860941 TTTGAGTTTTTACTTGGCATGGA 57.139 34.783 5.31 0.00 0.00 3.41
2561 2731 1.540267 GTGTCGACTCTACCTTGCAGA 59.460 52.381 17.92 0.00 0.00 4.26
2630 2800 6.660521 AGGATTTGCATCTTGTTTGACTATCA 59.339 34.615 0.00 0.00 0.00 2.15
2809 2979 4.836125 TGCAAATGTCTCTCTGAAAACC 57.164 40.909 0.00 0.00 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
305 315 0.537188 GAGGAAACGAGGAGCATGGA 59.463 55.000 0.00 0.0 0.00 3.41
308 318 1.208293 GGAAGAGGAAACGAGGAGCAT 59.792 52.381 0.00 0.0 0.00 3.79
501 542 2.981859 AGAAGAACACACACCGTCTT 57.018 45.000 0.00 0.0 0.00 3.01
510 551 4.461198 GAGGGGAAGAAAAGAAGAACACA 58.539 43.478 0.00 0.0 0.00 3.72
581 631 5.723672 AAGAAGAAAGATGTGGAGTCGTA 57.276 39.130 0.00 0.0 0.00 3.43
629 687 5.483937 TCTCCCAAGCACTCAAACTTAGATA 59.516 40.000 0.00 0.0 0.00 1.98
709 821 2.753966 CCAAATCAGCAGACCCGCG 61.754 63.158 0.00 0.0 36.85 6.46
856 984 7.703058 TGGGATTTTACCTCTTCATCTTTTC 57.297 36.000 0.00 0.0 0.00 2.29
1370 1530 6.183360 GCTAAGATGCTTCCAATCACTCAATT 60.183 38.462 0.00 0.0 0.00 2.32
1586 1746 2.489938 TCCACGAAAAGCCAAGCTAT 57.510 45.000 0.00 0.0 38.25 2.97
2561 2731 4.519540 ACTGCATTACGCCTTCAATTTT 57.480 36.364 0.00 0.0 41.33 1.82
2630 2800 2.435372 TCAACTGCAAGACCTTTGGT 57.565 45.000 0.00 0.0 39.44 3.67
2809 2979 7.475015 TGAACACTTTGAGTTCTTTGAATCTG 58.525 34.615 7.47 0.0 44.30 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.