Multiple sequence alignment - TraesCS1A01G388100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G388100 chr1A 100.000 2657 0 0 1 2657 556821641 556818985 0.000000e+00 4907
1 TraesCS1A01G388100 chr1A 99.202 2131 16 1 1 2131 556832448 556834577 0.000000e+00 3840
2 TraesCS1A01G388100 chr1A 98.779 2129 22 3 1 2129 553063694 553065818 0.000000e+00 3784
3 TraesCS1A01G388100 chr1A 98.507 2143 21 7 1 2140 555945814 555943680 0.000000e+00 3770
4 TraesCS1A01G388100 chr1A 94.504 1856 93 3 1 1850 8023904 8025756 0.000000e+00 2854
5 TraesCS1A01G388100 chr7A 99.202 2130 13 3 1 2130 589766508 589764383 0.000000e+00 3836
6 TraesCS1A01G388100 chr7A 85.172 580 63 13 1566 2131 695640165 695640735 8.250000e-160 573
7 TraesCS1A01G388100 chr2A 97.812 2148 28 3 1 2130 766840729 766842875 0.000000e+00 3688
8 TraesCS1A01G388100 chr2A 94.429 2154 94 7 1 2131 3768852 3766702 0.000000e+00 3290
9 TraesCS1A01G388100 chr3D 97.346 2148 33 5 1 2130 104033439 104035580 0.000000e+00 3629
10 TraesCS1A01G388100 chr4A 93.808 2164 106 7 1 2140 16991140 16993299 0.000000e+00 3229
11 TraesCS1A01G388100 chr1D 94.270 541 26 5 2121 2657 464396772 464396233 0.000000e+00 822
12 TraesCS1A01G388100 chr1D 86.145 332 36 8 1811 2136 442783014 442782687 1.510000e-92 350
13 TraesCS1A01G388100 chr1B 94.350 531 26 2 2131 2657 640600424 640599894 0.000000e+00 811
14 TraesCS1A01G388100 chr2D 92.174 345 24 3 1793 2136 599804207 599803865 3.980000e-133 484
15 TraesCS1A01G388100 chr5D 86.322 329 34 6 1811 2130 443248193 443248519 5.440000e-92 348


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G388100 chr1A 556818985 556821641 2656 True 4907 4907 100.000 1 2657 1 chr1A.!!$R2 2656
1 TraesCS1A01G388100 chr1A 556832448 556834577 2129 False 3840 3840 99.202 1 2131 1 chr1A.!!$F3 2130
2 TraesCS1A01G388100 chr1A 553063694 553065818 2124 False 3784 3784 98.779 1 2129 1 chr1A.!!$F2 2128
3 TraesCS1A01G388100 chr1A 555943680 555945814 2134 True 3770 3770 98.507 1 2140 1 chr1A.!!$R1 2139
4 TraesCS1A01G388100 chr1A 8023904 8025756 1852 False 2854 2854 94.504 1 1850 1 chr1A.!!$F1 1849
5 TraesCS1A01G388100 chr7A 589764383 589766508 2125 True 3836 3836 99.202 1 2130 1 chr7A.!!$R1 2129
6 TraesCS1A01G388100 chr7A 695640165 695640735 570 False 573 573 85.172 1566 2131 1 chr7A.!!$F1 565
7 TraesCS1A01G388100 chr2A 766840729 766842875 2146 False 3688 3688 97.812 1 2130 1 chr2A.!!$F1 2129
8 TraesCS1A01G388100 chr2A 3766702 3768852 2150 True 3290 3290 94.429 1 2131 1 chr2A.!!$R1 2130
9 TraesCS1A01G388100 chr3D 104033439 104035580 2141 False 3629 3629 97.346 1 2130 1 chr3D.!!$F1 2129
10 TraesCS1A01G388100 chr4A 16991140 16993299 2159 False 3229 3229 93.808 1 2140 1 chr4A.!!$F1 2139
11 TraesCS1A01G388100 chr1D 464396233 464396772 539 True 822 822 94.270 2121 2657 1 chr1D.!!$R2 536
12 TraesCS1A01G388100 chr1B 640599894 640600424 530 True 811 811 94.350 2131 2657 1 chr1B.!!$R1 526

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
910 920 1.540267 GTGTCGACTCTACCTTGCAGA 59.46 52.381 17.92 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2568 2613 1.062047 GTAGACGATGAGCACGCGA 59.938 57.895 15.93 0.0 0.0 5.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
358 360 7.602644 TGTACTTCTTGACGCAATAGATTCTTT 59.397 33.333 0.00 0.0 0.00 2.52
359 361 7.440523 ACTTCTTGACGCAATAGATTCTTTT 57.559 32.000 0.00 0.0 0.00 2.27
824 830 5.860941 TTTGAGTTTTTACTTGGCATGGA 57.139 34.783 5.31 0.0 0.00 3.41
910 920 1.540267 GTGTCGACTCTACCTTGCAGA 59.460 52.381 17.92 0.0 0.00 4.26
979 989 6.660521 AGGATTTGCATCTTGTTTGACTATCA 59.339 34.615 0.00 0.0 0.00 2.15
1158 1168 4.836125 TGCAAATGTCTCTCTGAAAACC 57.164 40.909 0.00 0.0 0.00 3.27
2096 2135 1.616994 GGCCCCTTATTGCTGTCTTGT 60.617 52.381 0.00 0.0 0.00 3.16
2208 2253 4.643385 CACGTCACCGCACGCAAC 62.643 66.667 0.00 0.0 43.93 4.17
2430 2475 2.659897 GGCCTCGAGCTATGCGTG 60.660 66.667 6.99 0.0 43.05 5.34
2455 2500 2.186644 CGATGACGGGCCACATGA 59.813 61.111 16.11 0.0 35.72 3.07
2463 2508 2.036256 GGCCACATGACCCTGCTT 59.964 61.111 0.00 0.0 0.00 3.91
2568 2613 2.282462 CTGCCGGCCACCTTCTTT 60.282 61.111 26.77 0.0 0.00 2.52
2572 2617 3.788766 CGGCCACCTTCTTTCGCG 61.789 66.667 2.24 0.0 0.00 5.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
910 920 4.519540 ACTGCATTACGCCTTCAATTTT 57.480 36.364 0.00 0.00 41.33 1.82
979 989 2.435372 TCAACTGCAAGACCTTTGGT 57.565 45.000 0.00 0.00 39.44 3.67
1158 1168 7.475015 TGAACACTTTGAGTTCTTTGAATCTG 58.525 34.615 7.47 0.00 44.30 2.90
2096 2135 1.229400 GATATACGGGGCCCAGGGA 60.229 63.158 26.70 13.57 0.00 4.20
2330 2375 1.289380 GAGTGCTCGAAGAACCCGT 59.711 57.895 0.00 0.00 34.09 5.28
2568 2613 1.062047 GTAGACGATGAGCACGCGA 59.938 57.895 15.93 0.00 0.00 5.87
2572 2617 1.269166 CGGTTGTAGACGATGAGCAC 58.731 55.000 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.