Multiple sequence alignment - TraesCS1A01G385200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G385200 chr1A 100.000 2162 0 0 1 2162 554511737 554513898 0 3993
1 TraesCS1A01G385200 chr3B 99.260 2162 16 0 1 2162 201526513 201528674 0 3904
2 TraesCS1A01G385200 chr5D 99.214 2162 17 0 1 2162 503217707 503219868 0 3899
3 TraesCS1A01G385200 chr5D 98.890 2162 24 0 1 2162 503278737 503276576 0 3860
4 TraesCS1A01G385200 chr5D 98.705 2162 28 0 1 2162 6188429 6190590 0 3838
5 TraesCS1A01G385200 chr6D 99.029 2162 21 0 1 2162 168254415 168256576 0 3877
6 TraesCS1A01G385200 chr3D 98.982 2162 19 2 1 2162 589280053 589277895 0 3868
7 TraesCS1A01G385200 chrUn 98.705 2162 27 1 1 2162 216519113 216516953 0 3836
8 TraesCS1A01G385200 chr1D 98.428 2163 32 2 1 2162 254398621 254396460 0 3805
9 TraesCS1A01G385200 chr2B 98.335 2162 31 2 1 2162 474907943 474910099 0 3788


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G385200 chr1A 554511737 554513898 2161 False 3993 3993 100.000 1 2162 1 chr1A.!!$F1 2161
1 TraesCS1A01G385200 chr3B 201526513 201528674 2161 False 3904 3904 99.260 1 2162 1 chr3B.!!$F1 2161
2 TraesCS1A01G385200 chr5D 503217707 503219868 2161 False 3899 3899 99.214 1 2162 1 chr5D.!!$F2 2161
3 TraesCS1A01G385200 chr5D 503276576 503278737 2161 True 3860 3860 98.890 1 2162 1 chr5D.!!$R1 2161
4 TraesCS1A01G385200 chr5D 6188429 6190590 2161 False 3838 3838 98.705 1 2162 1 chr5D.!!$F1 2161
5 TraesCS1A01G385200 chr6D 168254415 168256576 2161 False 3877 3877 99.029 1 2162 1 chr6D.!!$F1 2161
6 TraesCS1A01G385200 chr3D 589277895 589280053 2158 True 3868 3868 98.982 1 2162 1 chr3D.!!$R1 2161
7 TraesCS1A01G385200 chrUn 216516953 216519113 2160 True 3836 3836 98.705 1 2162 1 chrUn.!!$R1 2161
8 TraesCS1A01G385200 chr1D 254396460 254398621 2161 True 3805 3805 98.428 1 2162 1 chr1D.!!$R1 2161
9 TraesCS1A01G385200 chr2B 474907943 474910099 2156 False 3788 3788 98.335 1 2162 1 chr2B.!!$F1 2161

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
92 93 2.348411 AAGGGCATATCGGTTGAAGG 57.652 50.0 0.0 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1314 1317 1.813513 AGCATTGGGTCGAACTCTTG 58.186 50.0 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 2.348411 AAGGGCATATCGGTTGAAGG 57.652 50.000 0.00 0.0 0.00 3.46
920 923 8.502387 GTCGTATTCTATGGTTACGATTCTACT 58.498 37.037 15.61 0.0 46.31 2.57
1285 1288 2.236395 CCTTTTCCAGGTAGTCGATGGT 59.764 50.000 2.09 0.0 37.99 3.55
1294 1297 5.416083 CAGGTAGTCGATGGTTATTCACAA 58.584 41.667 0.00 0.0 0.00 3.33
1314 1317 4.641541 ACAACTACCACCTTAACACCAAAC 59.358 41.667 0.00 0.0 0.00 2.93
1919 1922 7.648908 GTCTGACTCATAGTGATCATTTCTCTG 59.351 40.741 0.00 0.0 30.95 3.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
564 567 9.213799 CCTCATAGAAAATTATTGGCTCTAGAC 57.786 37.037 0.0 0.0 0.00 2.59
920 923 7.485810 TCGACGGAATCAAAAAGACATATCTA 58.514 34.615 0.0 0.0 33.57 1.98
1285 1288 6.711645 GGTGTTAAGGTGGTAGTTGTGAATAA 59.288 38.462 0.0 0.0 0.00 1.40
1294 1297 4.506937 TGTTTGGTGTTAAGGTGGTAGT 57.493 40.909 0.0 0.0 0.00 2.73
1314 1317 1.813513 AGCATTGGGTCGAACTCTTG 58.186 50.000 0.0 0.0 0.00 3.02
1919 1922 6.374333 TGATAACCAAGGTCATTCTTTGCTAC 59.626 38.462 0.0 0.0 32.75 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.