Multiple sequence alignment - TraesCS1A01G385100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G385100 chr1A 100.000 2174 0 0 1 2174 554482252 554480079 0.000000e+00 4015
1 TraesCS1A01G385100 chr3A 98.956 2011 18 1 167 2174 105557129 105559139 0.000000e+00 3594
2 TraesCS1A01G385100 chr1B 98.703 2005 21 3 170 2174 633716797 633714798 0.000000e+00 3554
3 TraesCS1A01G385100 chr1B 100.000 149 0 0 1 149 633717212 633717064 2.130000e-70 276
4 TraesCS1A01G385100 chr5D 98.455 2007 27 3 170 2174 503339266 503337262 0.000000e+00 3531
5 TraesCS1A01G385100 chr5D 97.860 2009 33 4 170 2174 503313329 503311327 0.000000e+00 3463
6 TraesCS1A01G385100 chr5D 97.371 2016 24 3 167 2172 6253446 6255442 0.000000e+00 3402
7 TraesCS1A01G385100 chr5D 98.463 1692 16 3 487 2174 481597269 481595584 0.000000e+00 2972
8 TraesCS1A01G385100 chr5D 100.000 149 0 0 1 149 299972267 299972415 2.130000e-70 276
9 TraesCS1A01G385100 chr5D 100.000 149 0 0 1 149 503313743 503313595 2.130000e-70 276
10 TraesCS1A01G385100 chr5D 99.329 149 1 0 1 149 6253035 6253183 9.890000e-69 270
11 TraesCS1A01G385100 chr5D 99.329 149 1 0 1 149 503339681 503339533 9.890000e-69 270
12 TraesCS1A01G385100 chr3B 99.230 1948 14 1 170 2117 101924701 101922755 0.000000e+00 3513
13 TraesCS1A01G385100 chr3B 99.329 149 1 0 1 149 101925117 101924969 9.890000e-69 270
14 TraesCS1A01G385100 chr1D 97.366 2012 40 7 167 2174 51832131 51834133 0.000000e+00 3410
15 TraesCS1A01G385100 chr1D 99.329 149 1 0 1 149 254459649 254459501 9.890000e-69 270
16 TraesCS1A01G385100 chr7B 98.451 1872 24 3 167 2038 662755206 662757072 0.000000e+00 3291
17 TraesCS1A01G385100 chr7B 99.216 255 2 0 1920 2174 137684491 137684237 5.470000e-126 460
18 TraesCS1A01G385100 chr7B 99.329 149 1 0 1 149 662754794 662754942 9.890000e-69 270
19 TraesCS1A01G385100 chr4A 94.876 2010 80 4 167 2174 309446579 309448567 0.000000e+00 3120
20 TraesCS1A01G385100 chr7A 94.570 663 13 5 1513 2174 537849192 537848552 0.000000e+00 1003
21 TraesCS1A01G385100 chr5B 99.329 149 1 0 1 149 57514884 57515032 9.890000e-69 270


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G385100 chr1A 554480079 554482252 2173 True 4015.0 4015 100.0000 1 2174 1 chr1A.!!$R1 2173
1 TraesCS1A01G385100 chr3A 105557129 105559139 2010 False 3594.0 3594 98.9560 167 2174 1 chr3A.!!$F1 2007
2 TraesCS1A01G385100 chr1B 633714798 633717212 2414 True 1915.0 3554 99.3515 1 2174 2 chr1B.!!$R1 2173
3 TraesCS1A01G385100 chr5D 481595584 481597269 1685 True 2972.0 2972 98.4630 487 2174 1 chr5D.!!$R1 1687
4 TraesCS1A01G385100 chr5D 503337262 503339681 2419 True 1900.5 3531 98.8920 1 2174 2 chr5D.!!$R3 2173
5 TraesCS1A01G385100 chr5D 503311327 503313743 2416 True 1869.5 3463 98.9300 1 2174 2 chr5D.!!$R2 2173
6 TraesCS1A01G385100 chr5D 6253035 6255442 2407 False 1836.0 3402 98.3500 1 2172 2 chr5D.!!$F2 2171
7 TraesCS1A01G385100 chr3B 101922755 101925117 2362 True 1891.5 3513 99.2795 1 2117 2 chr3B.!!$R1 2116
8 TraesCS1A01G385100 chr1D 51832131 51834133 2002 False 3410.0 3410 97.3660 167 2174 1 chr1D.!!$F1 2007
9 TraesCS1A01G385100 chr7B 662754794 662757072 2278 False 1780.5 3291 98.8900 1 2038 2 chr7B.!!$F1 2037
10 TraesCS1A01G385100 chr4A 309446579 309448567 1988 False 3120.0 3120 94.8760 167 2174 1 chr4A.!!$F1 2007
11 TraesCS1A01G385100 chr7A 537848552 537849192 640 True 1003.0 1003 94.5700 1513 2174 1 chr7A.!!$R1 661

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
286 537 1.918957 AGGTCCAATAGAAGCAAGGCT 59.081 47.619 0.0 0.0 42.56 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2117 2425 4.270178 GATCGTCCTTGATCAGCAAAAG 57.73 45.455 0.0 0.0 43.43 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
149 150 9.995003 ATAAGAAGGTGAGCATATCTTCTAAAG 57.005 33.333 13.94 0.0 43.33 1.85
150 151 6.825610 AGAAGGTGAGCATATCTTCTAAAGG 58.174 40.000 12.45 0.0 42.61 3.11
284 535 2.239654 TCCAGGTCCAATAGAAGCAAGG 59.760 50.000 0.00 0.0 0.00 3.61
286 537 1.918957 AGGTCCAATAGAAGCAAGGCT 59.081 47.619 0.00 0.0 42.56 4.58
978 1252 7.225784 TGCAAAAATAAGAGCTTGAATACCA 57.774 32.000 0.00 0.0 0.00 3.25
1402 1676 8.954350 CATATTCTTCTCCAATCTGAGTTTTGT 58.046 33.333 0.00 0.0 33.93 2.83
2117 2425 5.419471 ACATTCCCGAAGAGCTATATACTCC 59.581 44.000 0.00 0.0 34.56 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
154 155 5.008331 TGCTTAGTCGAGGTCTTCTAAAGA 58.992 41.667 0.00 0.00 34.51 2.52
155 156 5.312120 TGCTTAGTCGAGGTCTTCTAAAG 57.688 43.478 0.00 0.00 0.00 1.85
157 158 5.916661 ATTGCTTAGTCGAGGTCTTCTAA 57.083 39.130 0.00 0.00 0.00 2.10
158 159 7.122353 ACTTTATTGCTTAGTCGAGGTCTTCTA 59.878 37.037 0.00 0.00 0.00 2.10
159 160 5.916661 TTATTGCTTAGTCGAGGTCTTCT 57.083 39.130 0.00 0.00 0.00 2.85
160 161 6.100668 ACTTTATTGCTTAGTCGAGGTCTTC 58.899 40.000 0.00 0.00 0.00 2.87
163 164 5.747675 GGTACTTTATTGCTTAGTCGAGGTC 59.252 44.000 0.00 0.00 0.00 3.85
164 165 5.421374 AGGTACTTTATTGCTTAGTCGAGGT 59.579 40.000 0.00 0.00 27.25 3.85
166 167 5.681982 CGAGGTACTTTATTGCTTAGTCGAG 59.318 44.000 0.00 0.00 41.55 4.04
167 168 5.124457 ACGAGGTACTTTATTGCTTAGTCGA 59.876 40.000 0.00 0.00 41.55 4.20
284 535 1.718757 CTGCTGGATTGGCCGTAAGC 61.719 60.000 0.00 3.37 40.66 3.09
286 537 1.748879 GCTGCTGGATTGGCCGTAA 60.749 57.895 0.00 0.00 40.66 3.18
835 1106 3.576078 TGCATGGTTCCGGATAATCTT 57.424 42.857 4.15 0.00 0.00 2.40
1402 1676 6.645415 GTCCTTGAGTTTATTCGAGACTTGAA 59.355 38.462 7.61 7.61 31.34 2.69
1751 2025 4.401022 TGATCTGATGTGCTTTCTTGGTT 58.599 39.130 0.00 0.00 0.00 3.67
2117 2425 4.270178 GATCGTCCTTGATCAGCAAAAG 57.730 45.455 0.00 0.00 43.43 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.