Multiple sequence alignment - TraesCS1A01G384500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G384500 chr1A 100.000 2678 0 0 1 2678 554447312 554449989 0.000000e+00 4946
1 TraesCS1A01G384500 chr3B 98.996 2589 24 2 92 2678 201493546 201490958 0.000000e+00 4636
2 TraesCS1A01G384500 chr3B 97.326 187 5 0 2295 2481 49388534 49388720 4.300000e-83 318
3 TraesCS1A01G384500 chr1D 98.661 2613 30 5 1 2610 254477631 254475021 0.000000e+00 4626
4 TraesCS1A01G384500 chr1D 96.597 2615 71 12 1 2610 244769112 244766511 0.000000e+00 4320
5 TraesCS1A01G384500 chr1D 96.554 2612 83 6 1 2610 244201924 244199318 0.000000e+00 4318
6 TraesCS1A01G384500 chr1D 97.572 2348 56 1 264 2610 180356024 180358371 0.000000e+00 4019
7 TraesCS1A01G384500 chr1D 98.226 1691 29 1 611 2301 290507190 290505501 0.000000e+00 2955
8 TraesCS1A01G384500 chr1D 100.000 71 0 0 2608 2678 180358494 180358564 6.020000e-27 132
9 TraesCS1A01G384500 chr1D 100.000 71 0 0 2608 2678 244199195 244199125 6.020000e-27 132
10 TraesCS1A01G384500 chr1D 100.000 71 0 0 2608 2678 254474898 254474828 6.020000e-27 132
11 TraesCS1A01G384500 chr5D 98.393 2613 38 4 1 2610 6235266 6237877 0.000000e+00 4590
12 TraesCS1A01G384500 chr5D 98.796 2326 25 3 288 2610 503331258 503328933 0.000000e+00 4137
13 TraesCS1A01G384500 chr2D 99.271 1784 11 2 897 2678 33929969 33931752 0.000000e+00 3221
14 TraesCS1A01G384500 chr2D 98.912 1655 17 1 1 1654 648662669 648664323 0.000000e+00 2955
15 TraesCS1A01G384500 chr3A 96.875 96 1 2 2517 2610 431321846 431321751 2.760000e-35 159
16 TraesCS1A01G384500 chrUn 100.000 71 0 0 2608 2678 406224515 406224585 6.020000e-27 132
17 TraesCS1A01G384500 chrUn 100.000 71 0 0 2608 2678 432962594 432962664 6.020000e-27 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G384500 chr1A 554447312 554449989 2677 False 4946.0 4946 100.0000 1 2678 1 chr1A.!!$F1 2677
1 TraesCS1A01G384500 chr3B 201490958 201493546 2588 True 4636.0 4636 98.9960 92 2678 1 chr3B.!!$R1 2586
2 TraesCS1A01G384500 chr1D 244766511 244769112 2601 True 4320.0 4320 96.5970 1 2610 1 chr1D.!!$R1 2609
3 TraesCS1A01G384500 chr1D 290505501 290507190 1689 True 2955.0 2955 98.2260 611 2301 1 chr1D.!!$R2 1690
4 TraesCS1A01G384500 chr1D 254474828 254477631 2803 True 2379.0 4626 99.3305 1 2678 2 chr1D.!!$R4 2677
5 TraesCS1A01G384500 chr1D 244199125 244201924 2799 True 2225.0 4318 98.2770 1 2678 2 chr1D.!!$R3 2677
6 TraesCS1A01G384500 chr1D 180356024 180358564 2540 False 2075.5 4019 98.7860 264 2678 2 chr1D.!!$F1 2414
7 TraesCS1A01G384500 chr5D 6235266 6237877 2611 False 4590.0 4590 98.3930 1 2610 1 chr5D.!!$F1 2609
8 TraesCS1A01G384500 chr5D 503328933 503331258 2325 True 4137.0 4137 98.7960 288 2610 1 chr5D.!!$R1 2322
9 TraesCS1A01G384500 chr2D 33929969 33931752 1783 False 3221.0 3221 99.2710 897 2678 1 chr2D.!!$F1 1781
10 TraesCS1A01G384500 chr2D 648662669 648664323 1654 False 2955.0 2955 98.9120 1 1654 1 chr2D.!!$F2 1653

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
815 819 7.736447 TTTTGTTGTTTTTGATGTGGAAACT 57.264 28.0 0.0 0.0 35.04 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2407 2417 6.240031 GGGGAATCCAAATGAAACCCTTTTTA 60.24 38.462 0.09 0.0 40.26 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
815 819 7.736447 TTTTGTTGTTTTTGATGTGGAAACT 57.264 28.0 0.0 0.0 35.04 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
158 160 9.899661 AGATAGTAGGACTAATCTATGCAGTAG 57.100 37.037 0.00 0.0 33.89 2.57
368 370 6.558394 TCCCTTTCTTTTGGATTTCCATTCTT 59.442 34.615 0.00 0.0 46.97 2.52
815 819 3.186283 TGCCCAAGGGTATAGAAAGACA 58.814 45.455 7.05 0.0 37.65 3.41
1688 1697 9.914923 CCTGCTTTTTATTTTTCTACACAAAAC 57.085 29.630 0.00 0.0 0.00 2.43
2407 2417 6.240031 GGGGAATCCAAATGAAACCCTTTTTA 60.240 38.462 0.09 0.0 40.26 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.