Multiple sequence alignment - TraesCS1A01G384400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G384400 chr1A 100.000 2363 0 0 1 2363 554446900 554449262 0.000000e+00 4364
1 TraesCS1A01G384400 chr1A 98.661 224 3 0 1 224 554447492 554447269 4.730000e-107 398
2 TraesCS1A01G384400 chr1A 98.214 224 4 0 1 224 554445684 554445461 2.200000e-105 392
3 TraesCS1A01G384400 chr5D 98.376 2155 33 2 210 2363 6235063 6237216 0.000000e+00 3784
4 TraesCS1A01G384400 chr5D 98.799 1665 19 1 700 2363 503331258 503329594 0.000000e+00 2963
5 TraesCS1A01G384400 chr1D 98.943 2081 20 2 284 2363 254477760 254475681 0.000000e+00 3720
6 TraesCS1A01G384400 chr1D 96.873 1951 58 2 413 2363 244201924 244199977 0.000000e+00 3262
7 TraesCS1A01G384400 chr1D 96.516 1952 57 8 413 2363 244769112 244767171 0.000000e+00 3217
8 TraesCS1A01G384400 chr1D 97.690 1688 39 0 676 2363 180356024 180357711 0.000000e+00 2902
9 TraesCS1A01G384400 chr1D 99.259 405 3 0 210 614 254478175 254477771 0.000000e+00 732
10 TraesCS1A01G384400 chr1D 99.107 224 2 0 1 224 180355439 180355216 1.020000e-108 403
11 TraesCS1A01G384400 chr1D 99.548 221 1 0 1 221 254477792 254478012 1.020000e-108 403
12 TraesCS1A01G384400 chr2D 99.031 1858 17 1 210 2066 648662466 648664323 0.000000e+00 3330
13 TraesCS1A01G384400 chr2D 99.095 221 2 0 1 221 648661726 648661946 4.730000e-107 398
14 TraesCS1A01G384400 chr2D 98.214 224 4 0 1 224 648662849 648662626 2.200000e-105 392
15 TraesCS1A01G384400 chr3B 98.872 1861 20 1 504 2363 201493546 201491686 0.000000e+00 3319
16 TraesCS1A01G384400 chr3B 99.525 632 3 0 210 841 201494190 201493559 0.000000e+00 1151
17 TraesCS1A01G384400 chr3B 99.095 221 2 0 1 221 201493807 201494027 4.730000e-107 398
18 TraesCS1A01G384400 chr3B 97.386 153 4 0 577 729 374245160 374245312 6.480000e-66 261
19 TraesCS1A01G384400 chr7A 94.408 1824 85 4 210 2032 352295623 352297430 0.000000e+00 2787
20 TraesCS1A01G384400 chr7A 95.563 293 13 0 1950 2242 647115792 647116084 9.890000e-129 470
21 TraesCS1A01G384400 chr7A 97.761 268 6 0 2070 2337 352297429 352297696 1.650000e-126 462
22 TraesCS1A01G384400 chr3A 97.857 280 6 0 2079 2358 581839411 581839690 3.530000e-133 484
23 TraesCS1A01G384400 chrUn 99.548 221 1 0 1 221 457255504 457255724 1.020000e-108 403
24 TraesCS1A01G384400 chrUn 99.107 224 2 0 1 224 462818970 462818747 1.020000e-108 403


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G384400 chr1A 554446900 554449262 2362 False 4364.0 4364 100.0000 1 2363 1 chr1A.!!$F1 2362
1 TraesCS1A01G384400 chr1A 554445461 554447492 2031 True 395.0 398 98.4375 1 224 2 chr1A.!!$R1 223
2 TraesCS1A01G384400 chr5D 6235063 6237216 2153 False 3784.0 3784 98.3760 210 2363 1 chr5D.!!$F1 2153
3 TraesCS1A01G384400 chr5D 503329594 503331258 1664 True 2963.0 2963 98.7990 700 2363 1 chr5D.!!$R1 1663
4 TraesCS1A01G384400 chr1D 244199977 244201924 1947 True 3262.0 3262 96.8730 413 2363 1 chr1D.!!$R2 1950
5 TraesCS1A01G384400 chr1D 244767171 244769112 1941 True 3217.0 3217 96.5160 413 2363 1 chr1D.!!$R3 1950
6 TraesCS1A01G384400 chr1D 180356024 180357711 1687 False 2902.0 2902 97.6900 676 2363 1 chr1D.!!$F1 1687
7 TraesCS1A01G384400 chr1D 254475681 254478175 2494 True 2226.0 3720 99.1010 210 2363 2 chr1D.!!$R4 2153
8 TraesCS1A01G384400 chr2D 648661726 648664323 2597 False 1864.0 3330 99.0630 1 2066 2 chr2D.!!$F1 2065
9 TraesCS1A01G384400 chr3B 201491686 201494190 2504 True 2235.0 3319 99.1985 210 2363 2 chr3B.!!$R1 2153
10 TraesCS1A01G384400 chr7A 352295623 352297696 2073 False 1624.5 2787 96.0845 210 2337 2 chr7A.!!$F2 2127

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1227 2914 7.736447 TTTTGTTGTTTTTGATGTGGAAACT 57.264 28.0 0.0 0.0 35.04 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2100 3813 9.914923 CCTGCTTTTTATTTTTCTACACAAAAC 57.085 29.63 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1227 2914 7.736447 TTTTGTTGTTTTTGATGTGGAAACT 57.264 28.0 0.0 0.0 35.04 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
780 1653 6.558394 TCCCTTTCTTTTGGATTTCCATTCTT 59.442 34.615 0.00 0.0 46.97 2.52
1227 2914 3.186283 TGCCCAAGGGTATAGAAAGACA 58.814 45.455 7.05 0.0 37.65 3.41
2100 3813 9.914923 CCTGCTTTTTATTTTTCTACACAAAAC 57.085 29.630 0.00 0.0 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.