Multiple sequence alignment - TraesCS1A01G382500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G382500 chr1A 100.000 2315 0 0 1 2315 553064034 553066348 0.000000e+00 4276
1 TraesCS1A01G382500 chr1A 98.658 1789 20 3 1 1785 556821301 556819513 0.000000e+00 3168
2 TraesCS1A01G382500 chr1A 98.602 1788 22 2 1 1785 556832788 556834575 0.000000e+00 3160
3 TraesCS1A01G382500 chr1A 97.988 1789 25 6 1 1785 555945474 555943693 0.000000e+00 3094
4 TraesCS1A01G382500 chr1A 93.531 1515 87 4 1 1506 8024244 8025756 0.000000e+00 2244
5 TraesCS1A01G382500 chr1A 96.975 529 15 1 1787 2315 566071211 566071738 0.000000e+00 887
6 TraesCS1A01G382500 chr1A 96.059 406 16 0 1910 2315 566060209 566060614 0.000000e+00 662
7 TraesCS1A01G382500 chr1A 96.923 130 3 1 1787 1915 566047746 566047875 1.390000e-52 217
8 TraesCS1A01G382500 chr7A 98.602 1788 19 4 1 1785 589766168 589764384 0.000000e+00 3158
9 TraesCS1A01G382500 chr7A 95.238 63 3 0 2241 2303 734508420 734508358 1.460000e-17 100
10 TraesCS1A01G382500 chr2A 97.387 1799 27 3 1 1779 766841070 766842868 0.000000e+00 3044
11 TraesCS1A01G382500 chr2A 93.153 1811 96 8 1 1785 3768512 3766704 0.000000e+00 2632
12 TraesCS1A01G382500 chr3D 96.415 1813 38 7 1 1791 104033779 104035586 0.000000e+00 2963
13 TraesCS1A01G382500 chr4A 92.660 1812 103 8 1 1785 16991480 16993288 0.000000e+00 2582
14 TraesCS1A01G382500 chr4A 95.841 529 18 2 1787 2315 602862262 602861738 0.000000e+00 852
15 TraesCS1A01G382500 chr3A 97.917 528 11 0 1788 2315 722380493 722381020 0.000000e+00 915
16 TraesCS1A01G382500 chr3A 96.975 529 16 0 1787 2315 26259352 26259880 0.000000e+00 889
17 TraesCS1A01G382500 chr2D 84.906 530 64 10 1788 2315 367359215 367359730 2.640000e-144 521
18 TraesCS1A01G382500 chr2D 91.716 338 26 2 1449 1785 599804207 599803871 3.480000e-128 468
19 TraesCS1A01G382500 chr5D 85.542 332 36 7 1467 1789 443248193 443248521 1.020000e-88 337
20 TraesCS1A01G382500 chr1D 85.938 320 36 7 1467 1780 442783014 442782698 1.330000e-87 333


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G382500 chr1A 553064034 553066348 2314 False 4276 4276 100.000 1 2315 1 chr1A.!!$F2 2314
1 TraesCS1A01G382500 chr1A 556819513 556821301 1788 True 3168 3168 98.658 1 1785 1 chr1A.!!$R2 1784
2 TraesCS1A01G382500 chr1A 556832788 556834575 1787 False 3160 3160 98.602 1 1785 1 chr1A.!!$F3 1784
3 TraesCS1A01G382500 chr1A 555943693 555945474 1781 True 3094 3094 97.988 1 1785 1 chr1A.!!$R1 1784
4 TraesCS1A01G382500 chr1A 8024244 8025756 1512 False 2244 2244 93.531 1 1506 1 chr1A.!!$F1 1505
5 TraesCS1A01G382500 chr1A 566071211 566071738 527 False 887 887 96.975 1787 2315 1 chr1A.!!$F6 528
6 TraesCS1A01G382500 chr7A 589764384 589766168 1784 True 3158 3158 98.602 1 1785 1 chr7A.!!$R1 1784
7 TraesCS1A01G382500 chr2A 766841070 766842868 1798 False 3044 3044 97.387 1 1779 1 chr2A.!!$F1 1778
8 TraesCS1A01G382500 chr2A 3766704 3768512 1808 True 2632 2632 93.153 1 1785 1 chr2A.!!$R1 1784
9 TraesCS1A01G382500 chr3D 104033779 104035586 1807 False 2963 2963 96.415 1 1791 1 chr3D.!!$F1 1790
10 TraesCS1A01G382500 chr4A 16991480 16993288 1808 False 2582 2582 92.660 1 1785 1 chr4A.!!$F1 1784
11 TraesCS1A01G382500 chr4A 602861738 602862262 524 True 852 852 95.841 1787 2315 1 chr4A.!!$R1 528
12 TraesCS1A01G382500 chr3A 722380493 722381020 527 False 915 915 97.917 1788 2315 1 chr3A.!!$F2 527
13 TraesCS1A01G382500 chr3A 26259352 26259880 528 False 889 889 96.975 1787 2315 1 chr3A.!!$F1 528
14 TraesCS1A01G382500 chr2D 367359215 367359730 515 False 521 521 84.906 1788 2315 1 chr2D.!!$F1 527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
180 184 7.554118 CCTCAATCTTACTTTGTGTGATATGGT 59.446 37.037 0.0 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2124 2162 1.977009 ACGATCTCAGGACGCCACA 60.977 57.895 0.0 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 184 7.554118 CCTCAATCTTACTTTGTGTGATATGGT 59.446 37.037 0.00 0.00 0.00 3.55
262 266 9.581289 TTATTTTCAGGTTCCACTAAAAGATGA 57.419 29.630 0.00 0.00 0.00 2.92
364 368 8.206867 AGTGTGAAAGCTATTAGATATCAAGCA 58.793 33.333 16.66 0.27 35.63 3.91
1322 1335 7.699812 ACGAATTTCCAAGTTCTAGTATACGTC 59.300 37.037 0.00 0.00 0.00 4.34
1410 1429 6.070656 AGATTTTTGGAGTGAAGAACATGGA 58.929 36.000 0.00 0.00 0.00 3.41
1780 1818 1.771565 CCCGTATATCTATGGGCCGA 58.228 55.000 2.59 0.00 45.26 5.54
2124 2162 0.109342 CAGGGCGATATTCTGGGCTT 59.891 55.000 0.00 0.00 0.00 4.35
2177 2215 6.594937 GCATGCCATATTTCTTTCCTTTTGAA 59.405 34.615 6.36 0.00 0.00 2.69
2306 2344 2.044450 AGGGCCCCCTGCATCTTA 59.956 61.111 21.43 0.00 46.22 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 249 8.942338 AAAACTTTTCATCTTTTAGTGGAACC 57.058 30.769 0.00 0.00 37.80 3.62
364 368 4.407365 ACAAAGCTAGCCTTAATTGTGGT 58.593 39.130 12.13 0.00 32.20 4.16
414 418 0.529773 TGCGTCGCTCTTTGACTTGT 60.530 50.000 19.50 0.00 34.17 3.16
1322 1335 7.274250 GGCATAGTAAAGCAAACTGAGAAATTG 59.726 37.037 0.00 0.00 0.00 2.32
1410 1429 4.286813 TCTAGATCCTCTCCCCAATTGT 57.713 45.455 4.43 0.00 0.00 2.71
1481 1500 5.526111 TGTCAAAACAGGTTGCTACTTAGAC 59.474 40.000 0.00 0.00 0.00 2.59
1780 1818 4.267341 ACCACTTATGCTAGACTAGGGT 57.733 45.455 11.48 5.25 0.00 4.34
1785 1823 8.409358 AAAAATCAAACCACTTATGCTAGACT 57.591 30.769 0.00 0.00 0.00 3.24
2030 2068 2.679132 ATTACGAATCGCGAGCGGCT 62.679 55.000 29.26 16.88 44.57 5.52
2124 2162 1.977009 ACGATCTCAGGACGCCACA 60.977 57.895 0.00 0.00 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.