Multiple sequence alignment - TraesCS1A01G377100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G377100 chr1A 100.000 2243 0 0 1 2243 550673756 550675998 0.000000e+00 4143.0
1 TraesCS1A01G377100 chr1A 98.219 2246 36 2 1 2243 550683530 550685774 0.000000e+00 3923.0
2 TraesCS1A01G377100 chr1A 97.866 2062 32 3 1 2058 550693149 550695202 0.000000e+00 3554.0
3 TraesCS1A01G377100 chr1A 92.581 984 57 9 489 1463 550646131 550647107 0.000000e+00 1399.0
4 TraesCS1A01G377100 chr1A 95.070 568 25 1 899 1463 550661201 550661768 0.000000e+00 891.0
5 TraesCS1A01G377100 chr1A 97.345 452 11 1 1 451 550660012 550660463 0.000000e+00 767.0
6 TraesCS1A01G377100 chr1A 94.792 480 20 3 1766 2243 550661763 550662239 0.000000e+00 743.0
7 TraesCS1A01G377100 chr1A 92.842 461 31 1 1 461 550829091 550829549 0.000000e+00 667.0
8 TraesCS1A01G377100 chr1A 89.528 487 41 6 1766 2243 550647102 550647587 1.900000e-170 608.0
9 TraesCS1A01G377100 chr1A 95.098 306 14 1 1464 1769 289004497 289004193 4.330000e-132 481.0
10 TraesCS1A01G377100 chr1A 88.372 387 30 10 523 905 550660420 550660795 3.400000e-123 451.0
11 TraesCS1A01G377100 chr1A 84.277 477 58 12 1780 2243 550721373 550721845 1.220000e-122 449.0
12 TraesCS1A01G377100 chr1A 84.706 425 52 11 1780 2195 550793934 550794354 1.600000e-111 412.0
13 TraesCS1A01G377100 chr1A 78.330 443 64 21 524 955 550792976 550793397 7.950000e-65 257.0
14 TraesCS1A01G377100 chr1A 100.000 30 0 0 435 464 550674219 550674190 3.110000e-04 56.5
15 TraesCS1A01G377100 chr1A 100.000 30 0 0 435 464 550683992 550683963 3.110000e-04 56.5
16 TraesCS1A01G377100 chr1A 100.000 30 0 0 435 464 550693612 550693583 3.110000e-04 56.5
17 TraesCS1A01G377100 chr1D 92.729 949 62 3 516 1461 458160538 458161482 0.000000e+00 1363.0
18 TraesCS1A01G377100 chr1D 91.684 938 66 6 528 1461 458256834 458257763 0.000000e+00 1290.0
19 TraesCS1A01G377100 chr1D 97.339 451 11 1 1 451 458256423 458256872 0.000000e+00 765.0
20 TraesCS1A01G377100 chr1D 94.577 461 25 0 1 461 458279696 458280156 0.000000e+00 713.0
21 TraesCS1A01G377100 chr1D 80.471 891 125 32 587 1457 458229799 458230660 8.740000e-179 636.0
22 TraesCS1A01G377100 chr1D 89.897 485 39 10 1768 2243 458161480 458161963 1.140000e-172 616.0
23 TraesCS1A01G377100 chr1D 86.481 540 65 4 919 1458 458164526 458165057 8.920000e-164 586.0
24 TraesCS1A01G377100 chr1D 85.412 473 56 11 1780 2243 458230778 458231246 1.560000e-131 479.0
25 TraesCS1A01G377100 chr1D 94.118 306 18 0 1464 1769 313817032 313817337 1.210000e-127 466.0
26 TraesCS1A01G377100 chr1D 94.118 306 18 0 1464 1769 481830734 481831039 1.210000e-127 466.0
27 TraesCS1A01G377100 chr1D 82.830 530 73 12 919 1445 458233902 458234416 2.030000e-125 459.0
28 TraesCS1A01G377100 chr1D 83.755 474 63 12 1780 2243 458257772 458258241 9.510000e-119 436.0
29 TraesCS1A01G377100 chr1D 81.750 537 58 7 919 1445 458200458 458200964 1.600000e-111 412.0
30 TraesCS1A01G377100 chr1B 94.643 448 24 0 1 448 628860495 628860942 0.000000e+00 695.0
31 TraesCS1A01G377100 chr1B 93.973 448 26 1 1 448 628979490 628979936 0.000000e+00 676.0
32 TraesCS1A01G377100 chr1B 93.304 448 29 1 1 448 628903379 628903825 0.000000e+00 660.0
33 TraesCS1A01G377100 chr3D 94.444 306 17 0 1464 1769 20892905 20893210 2.610000e-129 472.0
34 TraesCS1A01G377100 chr2D 94.175 309 18 0 1464 1772 76640438 76640746 2.610000e-129 472.0
35 TraesCS1A01G377100 chr2D 94.118 306 18 0 1464 1769 402238545 402238850 1.210000e-127 466.0
36 TraesCS1A01G377100 chr7D 94.137 307 18 0 1464 1770 444357229 444356923 3.370000e-128 468.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G377100 chr1A 550673756 550675998 2242 False 4143.000000 4143 100.000000 1 2243 1 chr1A.!!$F1 2242
1 TraesCS1A01G377100 chr1A 550683530 550685774 2244 False 3923.000000 3923 98.219000 1 2243 1 chr1A.!!$F2 2242
2 TraesCS1A01G377100 chr1A 550693149 550695202 2053 False 3554.000000 3554 97.866000 1 2058 1 chr1A.!!$F3 2057
3 TraesCS1A01G377100 chr1A 550646131 550647587 1456 False 1003.500000 1399 91.054500 489 2243 2 chr1A.!!$F6 1754
4 TraesCS1A01G377100 chr1A 550660012 550662239 2227 False 713.000000 891 93.894750 1 2243 4 chr1A.!!$F7 2242
5 TraesCS1A01G377100 chr1A 550792976 550794354 1378 False 334.500000 412 81.518000 524 2195 2 chr1A.!!$F8 1671
6 TraesCS1A01G377100 chr1D 458160538 458165057 4519 False 855.000000 1363 89.702333 516 2243 3 chr1D.!!$F5 1727
7 TraesCS1A01G377100 chr1D 458256423 458258241 1818 False 830.333333 1290 90.926000 1 2243 3 chr1D.!!$F7 2242
8 TraesCS1A01G377100 chr1D 458229799 458234416 4617 False 524.666667 636 82.904333 587 2243 3 chr1D.!!$F6 1656
9 TraesCS1A01G377100 chr1D 458200458 458200964 506 False 412.000000 412 81.750000 919 1445 1 chr1D.!!$F2 526

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
815 827 2.342279 GTGTGCTCGTGGGTGCTA 59.658 61.111 0.0 0.0 33.89 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1693 2336 1.152922 AACCAAAGGGCGAACCGAA 60.153 52.632 0.0 0.0 46.96 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
212 216 7.940688 TCGGATATATGAGTAGTCAGTAACCAA 59.059 37.037 6.39 0.00 35.66 3.67
815 827 2.342279 GTGTGCTCGTGGGTGCTA 59.658 61.111 0.00 0.00 33.89 3.49
877 889 4.402474 GTCCACTGGGCAAGCTTATAAAAT 59.598 41.667 0.00 0.00 0.00 1.82
1391 1919 9.416794 GCTACGAGTGTATATTAGACAGTACTA 57.583 37.037 0.00 0.00 30.51 1.82
1528 2171 8.515414 GTGAAAAATCTGCTATGGAAAACTAGT 58.485 33.333 0.00 0.00 0.00 2.57
1723 2366 3.873801 GCCCTTTGGTTCAGATTCTGCTA 60.874 47.826 8.89 0.00 0.00 3.49
1976 2626 1.147600 GTCCCAAACACCTGGACGT 59.852 57.895 0.00 0.00 39.22 4.34
2229 2888 3.816367 TTCATGGCGCCGTGTGTCA 62.816 57.895 39.93 23.64 34.75 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 1.746615 GTGCACGATGGTCATGGCT 60.747 57.895 0.00 0.00 0.00 4.75
212 216 2.029649 GCATGTTGAAACCATGTGCTCT 60.030 45.455 0.00 0.00 0.00 4.09
585 590 0.529773 GTGTCGACACAGGCAGTTGA 60.530 55.000 37.16 1.54 45.75 3.18
823 835 1.513586 CCGACAGTAACGACGGCTC 60.514 63.158 0.00 0.00 38.98 4.70
1391 1919 9.448438 TCAACAGTAAGCAACTTATGTATGAAT 57.552 29.630 0.00 0.00 35.76 2.57
1693 2336 1.152922 AACCAAAGGGCGAACCGAA 60.153 52.632 0.00 0.00 46.96 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.