Multiple sequence alignment - TraesCS1A01G333300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G333300 chr1A 100.000 2745 0 0 1 2745 521311189 521313933 0 5070
1 TraesCS1A01G333300 chr3B 98.798 2746 31 2 1 2745 193971337 193968593 0 4887
2 TraesCS1A01G333300 chr7A 98.654 2749 32 5 1 2745 393650427 393647680 0 4867
3 TraesCS1A01G333300 chr7A 98.471 2747 37 5 1 2745 457559983 457562726 0 4835
4 TraesCS1A01G333300 chr7A 98.436 2749 36 7 1 2744 690910444 690907698 0 4831
5 TraesCS1A01G333300 chr1B 98.618 2749 34 3 1 2745 419959909 419962657 0 4863
6 TraesCS1A01G333300 chr3A 98.544 2747 37 3 1 2745 591384379 591381634 0 4848
7 TraesCS1A01G333300 chr3A 98.507 2746 35 6 1 2745 591372804 591375544 0 4839
8 TraesCS1A01G333300 chr5B 98.472 2749 37 5 1 2745 474309068 474311815 0 4839
9 TraesCS1A01G333300 chr7B 98.399 2749 40 3 1 2745 570475188 570472440 0 4830


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G333300 chr1A 521311189 521313933 2744 False 5070 5070 100.000 1 2745 1 chr1A.!!$F1 2744
1 TraesCS1A01G333300 chr3B 193968593 193971337 2744 True 4887 4887 98.798 1 2745 1 chr3B.!!$R1 2744
2 TraesCS1A01G333300 chr7A 393647680 393650427 2747 True 4867 4867 98.654 1 2745 1 chr7A.!!$R1 2744
3 TraesCS1A01G333300 chr7A 457559983 457562726 2743 False 4835 4835 98.471 1 2745 1 chr7A.!!$F1 2744
4 TraesCS1A01G333300 chr7A 690907698 690910444 2746 True 4831 4831 98.436 1 2744 1 chr7A.!!$R2 2743
5 TraesCS1A01G333300 chr1B 419959909 419962657 2748 False 4863 4863 98.618 1 2745 1 chr1B.!!$F1 2744
6 TraesCS1A01G333300 chr3A 591381634 591384379 2745 True 4848 4848 98.544 1 2745 1 chr3A.!!$R1 2744
7 TraesCS1A01G333300 chr3A 591372804 591375544 2740 False 4839 4839 98.507 1 2745 1 chr3A.!!$F1 2744
8 TraesCS1A01G333300 chr5B 474309068 474311815 2747 False 4839 4839 98.472 1 2745 1 chr5B.!!$F1 2744
9 TraesCS1A01G333300 chr7B 570472440 570475188 2748 True 4830 4830 98.399 1 2745 1 chr7B.!!$R1 2744

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
202 203 2.461897 TCGTCAAGCGTTTTGGAAAC 57.538 45.0 2.69 0.0 42.13 2.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2528 2551 4.495565 TGTACCCCTATACGATGGGATTT 58.504 43.478 0.0 0.0 46.15 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 203 2.461897 TCGTCAAGCGTTTTGGAAAC 57.538 45.000 2.69 0.00 42.13 2.78
421 427 4.497340 GCTCATGTTTGGACAGAACGAAAA 60.497 41.667 0.00 0.00 39.58 2.29
502 508 5.106475 CCAAAGGGAAAAATGTCGACGAATA 60.106 40.000 11.62 0.00 35.59 1.75
642 648 5.021033 TGAGGAACAATTTTGCACAACAT 57.979 34.783 0.00 0.00 0.00 2.71
959 967 7.252612 TGTCCCTCTATTGTTCTTTCATGTA 57.747 36.000 0.00 0.00 0.00 2.29
1212 1221 4.513692 CACTACGAACATTCAAAGGTCCAA 59.486 41.667 0.00 0.00 0.00 3.53
1615 1625 3.321111 AGAAGTACAAGTGATCACGTGGT 59.679 43.478 34.69 26.73 43.49 4.16
1897 1911 3.610786 TTTTGCTGTTTCGAATGCGTA 57.389 38.095 0.00 0.00 38.98 4.42
1900 1914 2.073056 TGCTGTTTCGAATGCGTATGT 58.927 42.857 0.00 0.00 38.98 2.29
1945 1962 5.048782 GGCAAATGTAGTTCAACAGACATGA 60.049 40.000 8.44 0.00 32.92 3.07
2609 2633 4.258543 CAATTTTTGCTCATGGATTGCCT 58.741 39.130 0.00 0.00 34.31 4.75
2664 2688 3.527507 TCTCCAGTCCTGACTTGTACT 57.472 47.619 0.00 0.00 40.20 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 203 2.664851 TTGCTGTTGGTCCTCGCG 60.665 61.111 0.00 0.00 0.00 5.87
421 427 0.807667 GTCGCTCCGCACTGAATGAT 60.808 55.000 0.00 0.00 0.00 2.45
483 489 6.839820 ACTATATTCGTCGACATTTTTCCC 57.160 37.500 17.16 0.00 0.00 3.97
502 508 0.392706 TCGATCCCGCATGCAACTAT 59.607 50.000 19.57 4.99 35.37 2.12
642 648 1.486310 AGTGTGAGCTTGAAGTCACCA 59.514 47.619 18.40 9.12 42.11 4.17
2528 2551 4.495565 TGTACCCCTATACGATGGGATTT 58.504 43.478 0.00 0.00 46.15 2.17
2609 2633 2.358322 AGAAAACGAAGAAAGGGGCA 57.642 45.000 0.00 0.00 0.00 5.36
2664 2688 3.709587 AGGGTTGTCCGAGAGAGATAAA 58.290 45.455 0.00 0.00 41.52 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.