Multiple sequence alignment - TraesCS1A01G324400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G324400 chr1A 100.000 2744 0 0 1 2744 514964256 514961513 0.000000e+00 5068.0
1 TraesCS1A01G324400 chr1A 99.211 2663 9 1 1 2663 514703103 514700453 0.000000e+00 4791.0
2 TraesCS1A01G324400 chr1A 99.311 2032 9 2 717 2744 515237505 515235475 0.000000e+00 3670.0
3 TraesCS1A01G324400 chr1A 97.632 718 17 0 1 718 514975072 514974355 0.000000e+00 1232.0
4 TraesCS1A01G324400 chr1A 97.354 718 19 0 1 718 514713926 514713209 0.000000e+00 1221.0
5 TraesCS1A01G324400 chr1A 100.000 430 0 0 2902 3331 514961355 514960926 0.000000e+00 795.0
6 TraesCS1A01G324400 chr1A 93.598 453 6 1 2902 3331 515235433 515234981 0.000000e+00 654.0
7 TraesCS1A01G324400 chr1A 87.240 384 34 10 2303 2684 514698785 514698415 1.100000e-114 424.0
8 TraesCS1A01G324400 chr1A 80.000 305 38 11 1801 2094 514947175 514946883 1.570000e-48 204.0
9 TraesCS1A01G324400 chr1A 80.000 305 38 11 1801 2094 515203826 515203534 1.570000e-48 204.0
10 TraesCS1A01G324400 chr1D 94.792 960 41 6 844 1803 418102224 418101274 0.000000e+00 1487.0
11 TraesCS1A01G324400 chr1D 88.198 949 52 33 1801 2707 418101398 418100468 0.000000e+00 1077.0
12 TraesCS1A01G324400 chr1D 93.491 338 22 0 2994 3331 435761139 435761476 1.380000e-138 503.0
13 TraesCS1A01G324400 chr1B 91.053 950 49 6 855 1803 565567993 565567079 0.000000e+00 1251.0
14 TraesCS1A01G324400 chr1B 92.714 796 40 6 1872 2660 565567144 565566360 0.000000e+00 1133.0
15 TraesCS1A01G324400 chr1B 93.333 465 14 3 1989 2445 564919615 564919160 0.000000e+00 671.0
16 TraesCS1A01G324400 chr1B 94.624 186 6 3 2523 2706 564918769 564918586 5.440000e-73 285.0
17 TraesCS1A01G324400 chr3A 96.927 716 21 1 1 716 438340605 438341319 0.000000e+00 1199.0
18 TraesCS1A01G324400 chr3A 96.379 718 26 0 1 718 499714380 499715097 0.000000e+00 1182.0
19 TraesCS1A01G324400 chr2A 96.797 718 23 0 1 718 566787034 566787751 0.000000e+00 1199.0
20 TraesCS1A01G324400 chr2A 90.719 431 37 3 2902 3331 65082391 65081963 3.730000e-159 571.0
21 TraesCS1A01G324400 chr5A 96.788 716 23 0 1 716 430453911 430453196 0.000000e+00 1195.0
22 TraesCS1A01G324400 chr6A 96.653 717 24 0 2 718 363451754 363452470 0.000000e+00 1192.0
23 TraesCS1A01G324400 chr4A 96.518 718 25 0 1 718 298686712 298685995 0.000000e+00 1188.0
24 TraesCS1A01G324400 chr4A 96.513 717 25 0 1 717 306270502 306269786 0.000000e+00 1186.0
25 TraesCS1A01G324400 chr4D 91.872 406 32 1 2926 3331 6696346 6696750 1.730000e-157 566.0
26 TraesCS1A01G324400 chr4D 88.300 453 27 6 2902 3331 1615288 1615737 1.370000e-143 520.0
27 TraesCS1A01G324400 chr6D 88.962 453 25 4 2902 3331 262277327 262276877 1.360000e-148 536.0
28 TraesCS1A01G324400 chr5D 88.962 453 25 4 2902 3331 450524891 450524441 1.360000e-148 536.0
29 TraesCS1A01G324400 chr7D 88.742 453 27 5 2902 3331 543095704 543096155 1.760000e-147 532.0
30 TraesCS1A01G324400 chr7D 88.300 453 29 3 2902 3331 634756355 634755904 3.810000e-144 521.0
31 TraesCS1A01G324400 chr7D 86.580 462 28 12 2902 3331 482247861 482248320 2.320000e-131 479.0
32 TraesCS1A01G324400 chr7A 87.832 452 31 10 2903 3331 275083 275533 2.960000e-140 508.0
33 TraesCS1A01G324400 chr6B 100.000 28 0 0 2717 2744 204167682 204167709 6.000000e-03 52.8
34 TraesCS1A01G324400 chr2B 100.000 28 0 0 2717 2744 245688255 245688282 6.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G324400 chr1A 514960926 514964256 3330 True 2931.5 5068 100.0000 1 3331 2 chr1A.!!$R6 3330
1 TraesCS1A01G324400 chr1A 514698415 514703103 4688 True 2607.5 4791 93.2255 1 2684 2 chr1A.!!$R5 2683
2 TraesCS1A01G324400 chr1A 515234981 515237505 2524 True 2162.0 3670 96.4545 717 3331 2 chr1A.!!$R7 2614
3 TraesCS1A01G324400 chr1A 514974355 514975072 717 True 1232.0 1232 97.6320 1 718 1 chr1A.!!$R3 717
4 TraesCS1A01G324400 chr1A 514713209 514713926 717 True 1221.0 1221 97.3540 1 718 1 chr1A.!!$R1 717
5 TraesCS1A01G324400 chr1D 418100468 418102224 1756 True 1282.0 1487 91.4950 844 2707 2 chr1D.!!$R1 1863
6 TraesCS1A01G324400 chr1B 565566360 565567993 1633 True 1192.0 1251 91.8835 855 2660 2 chr1B.!!$R2 1805
7 TraesCS1A01G324400 chr1B 564918586 564919615 1029 True 478.0 671 93.9785 1989 2706 2 chr1B.!!$R1 717
8 TraesCS1A01G324400 chr3A 438340605 438341319 714 False 1199.0 1199 96.9270 1 716 1 chr3A.!!$F1 715
9 TraesCS1A01G324400 chr3A 499714380 499715097 717 False 1182.0 1182 96.3790 1 718 1 chr3A.!!$F2 717
10 TraesCS1A01G324400 chr2A 566787034 566787751 717 False 1199.0 1199 96.7970 1 718 1 chr2A.!!$F1 717
11 TraesCS1A01G324400 chr5A 430453196 430453911 715 True 1195.0 1195 96.7880 1 716 1 chr5A.!!$R1 715
12 TraesCS1A01G324400 chr6A 363451754 363452470 716 False 1192.0 1192 96.6530 2 718 1 chr6A.!!$F1 716
13 TraesCS1A01G324400 chr4A 298685995 298686712 717 True 1188.0 1188 96.5180 1 718 1 chr4A.!!$R1 717
14 TraesCS1A01G324400 chr4A 306269786 306270502 716 True 1186.0 1186 96.5130 1 717 1 chr4A.!!$R2 716

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
163 164 1.837439 AGGTCATTGAATGCCCGTCTA 59.163 47.619 12.77 0.00 32.49 2.59 F
1665 1671 1.069296 TCTTGCGCAATCCGAAACAAG 60.069 47.619 25.26 7.74 40.02 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1665 1671 8.877808 ATTCTTTCTTGAAGGAATCAACAAAC 57.122 30.769 12.82 0.0 43.08 2.93 R
3068 4260 2.202756 GTAGACGCGGCCCTCAAG 60.203 66.667 9.25 0.0 0.00 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 5.646215 TGGGCCTCCTTTTATACTTTCAAA 58.354 37.500 4.53 0.00 0.00 2.69
163 164 1.837439 AGGTCATTGAATGCCCGTCTA 59.163 47.619 12.77 0.00 32.49 2.59
1665 1671 1.069296 TCTTGCGCAATCCGAAACAAG 60.069 47.619 25.26 7.74 40.02 3.16
2442 2492 3.181501 CGTTCTTCTTTGTTTGCAGTGGA 60.182 43.478 0.00 0.00 0.00 4.02
2935 4104 2.363711 GATACATGTCCTCGCCGCCA 62.364 60.000 0.00 0.00 0.00 5.69
3229 4640 4.530857 GGATCCGGTGGCGGACTG 62.531 72.222 0.00 0.00 41.24 3.51
3253 4664 2.558380 GATGTGGGGTTGGGAGCTCC 62.558 65.000 25.59 25.59 0.00 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
115 116 1.005097 TGCCGTCAGAGTTAGGTAGGA 59.995 52.381 0.00 0.00 0.00 2.94
163 164 2.065899 TTGCACTGTTTAGGCAACCT 57.934 45.000 0.00 0.00 42.12 3.50
1665 1671 8.877808 ATTCTTTCTTGAAGGAATCAACAAAC 57.122 30.769 12.82 0.00 43.08 2.93
2442 2492 5.010282 GTCCATCCTAAACAACACCATCTT 58.990 41.667 0.00 0.00 0.00 2.40
3012 4204 2.363018 TCACTAGCAGAGGCCGCT 60.363 61.111 1.77 1.77 42.56 5.52
3068 4260 2.202756 GTAGACGCGGCCCTCAAG 60.203 66.667 9.25 0.00 0.00 3.02
3253 4664 2.544267 GCCAAGAAATTACTCCGATCCG 59.456 50.000 0.00 0.00 0.00 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.