Multiple sequence alignment - TraesCS1A01G324300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G324300 chr1A 100.000 2556 0 0 1 2556 514897828 514895273 0.000000e+00 4721.0
1 TraesCS1A01G324300 chr1A 99.452 2556 14 0 1 2556 515154055 515151500 0.000000e+00 4643.0
2 TraesCS1A01G324300 chr1A 96.161 2292 79 5 267 2556 96739933 96737649 0.000000e+00 3736.0
3 TraesCS1A01G324300 chr1A 90.674 193 12 4 4 196 96742039 96741853 4.220000e-63 252.0
4 TraesCS1A01G324300 chr1A 95.699 93 4 0 179 271 96741694 96741602 1.580000e-32 150.0
5 TraesCS1A01G324300 chr4B 91.065 1802 122 20 189 1964 238086059 238084271 0.000000e+00 2399.0
6 TraesCS1A01G324300 chr3B 90.829 1134 97 6 576 1707 285153083 285154211 0.000000e+00 1511.0
7 TraesCS1A01G324300 chr3B 92.308 338 26 0 1425 1762 570234512 570234175 4.950000e-132 481.0
8 TraesCS1A01G324300 chr3B 90.164 305 23 3 2008 2311 570233524 570233226 8.570000e-105 390.0
9 TraesCS1A01G324300 chr7A 90.819 403 36 1 236 637 490794296 490793894 2.890000e-149 538.0
10 TraesCS1A01G324300 chr7A 89.677 155 12 4 4 157 66749437 66749588 7.220000e-46 195.0
11 TraesCS1A01G324300 chr4A 86.869 396 46 4 243 637 195154898 195154508 3.020000e-119 438.0
12 TraesCS1A01G324300 chr4A 77.957 372 63 11 2008 2371 411048081 411048441 5.540000e-52 215.0
13 TraesCS1A01G324300 chr4A 89.024 82 7 2 1425 1505 411047408 411047488 1.620000e-17 100.0
14 TraesCS1A01G324300 chr5B 88.298 282 25 4 189 463 420015612 420015332 5.270000e-87 331.0
15 TraesCS1A01G324300 chr5B 83.198 369 51 6 895 1253 33132200 33131833 6.820000e-86 327.0
16 TraesCS1A01G324300 chr5B 80.682 176 21 9 905 1069 13354331 13354504 9.600000e-25 124.0
17 TraesCS1A01G324300 chr5B 77.108 166 35 3 769 933 32635502 32635339 2.710000e-15 93.5
18 TraesCS1A01G324300 chr3A 93.434 198 13 0 440 637 664411755 664411558 6.920000e-76 294.0
19 TraesCS1A01G324300 chr3A 92.929 198 14 0 440 637 681614652 681614455 3.220000e-74 289.0
20 TraesCS1A01G324300 chr3A 79.784 371 55 12 2009 2371 728790299 728789941 4.220000e-63 252.0
21 TraesCS1A01G324300 chr3A 83.537 164 24 3 2003 2163 529140838 529140675 1.580000e-32 150.0
22 TraesCS1A01G324300 chr5A 77.038 601 73 31 866 1426 6148027 6148602 4.160000e-73 285.0
23 TraesCS1A01G324300 chr5A 95.614 114 5 0 2443 2556 219247596 219247709 1.560000e-42 183.0
24 TraesCS1A01G324300 chr7D 80.707 368 50 15 2058 2417 15654774 15655128 1.510000e-67 267.0
25 TraesCS1A01G324300 chr5D 75.329 608 79 33 866 1426 7947538 7948121 2.560000e-55 226.0
26 TraesCS1A01G324300 chr5D 81.714 175 21 7 905 1069 13923557 13923730 4.440000e-28 135.0
27 TraesCS1A01G324300 chr4D 91.667 156 10 3 4 158 64577864 64578017 1.990000e-51 213.0
28 TraesCS1A01G324300 chrUn 97.368 114 3 0 2443 2556 337092899 337093012 7.220000e-46 195.0
29 TraesCS1A01G324300 chr2D 97.368 114 3 0 2443 2556 646461685 646461572 7.220000e-46 195.0
30 TraesCS1A01G324300 chr2A 94.737 114 6 0 2443 2556 1609213 1609326 7.270000e-41 178.0
31 TraesCS1A01G324300 chr1D 84.706 85 12 1 440 524 184386984 184387067 1.630000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G324300 chr1A 514895273 514897828 2555 True 4721.000000 4721 100.000 1 2556 1 chr1A.!!$R1 2555
1 TraesCS1A01G324300 chr1A 515151500 515154055 2555 True 4643.000000 4643 99.452 1 2556 1 chr1A.!!$R2 2555
2 TraesCS1A01G324300 chr1A 96737649 96742039 4390 True 1379.333333 3736 94.178 4 2556 3 chr1A.!!$R3 2552
3 TraesCS1A01G324300 chr4B 238084271 238086059 1788 True 2399.000000 2399 91.065 189 1964 1 chr4B.!!$R1 1775
4 TraesCS1A01G324300 chr3B 285153083 285154211 1128 False 1511.000000 1511 90.829 576 1707 1 chr3B.!!$F1 1131
5 TraesCS1A01G324300 chr3B 570233226 570234512 1286 True 435.500000 481 91.236 1425 2311 2 chr3B.!!$R1 886
6 TraesCS1A01G324300 chr5A 6148027 6148602 575 False 285.000000 285 77.038 866 1426 1 chr5A.!!$F1 560
7 TraesCS1A01G324300 chr5D 7947538 7948121 583 False 226.000000 226 75.329 866 1426 1 chr5D.!!$F1 560

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
761 2613 1.383248 CCATCTTCTCCTCCCCGGT 60.383 63.158 0.0 0.0 0.0 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2471 4803 2.047213 AACCGGTGTCCACGATGGTT 62.047 55.0 8.52 12.0 39.03 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
520 2372 3.842923 CCCTCGAGTCAGCGCCAT 61.843 66.667 12.31 0.0 0.0 4.40
761 2613 1.383248 CCATCTTCTCCTCCCCGGT 60.383 63.158 0.00 0.0 0.0 5.28
1455 3378 6.035435 CAGAGACAATACAAAATCGAGTCCAG 59.965 42.308 0.00 0.0 0.0 3.86
2471 4803 5.950544 ACTCATACATACAAACCTAGCCA 57.049 39.130 0.00 0.0 0.0 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
520 2372 1.871418 CAGGAACCAGATGGAGGAGA 58.129 55.000 5.72 0.0 38.94 3.71
1090 2943 1.482593 CTCGTGGTAGCCCATCTTCTT 59.517 52.381 0.00 0.0 44.35 2.52
2471 4803 2.047213 AACCGGTGTCCACGATGGTT 62.047 55.000 8.52 12.0 39.03 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.