AutoCloner

Multiple sequence alignment - TraesCS1A01G311600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS1A01G311600	chr1A	100.000	2651	0	0	1	2651	503324400	503327050	0.000000e+00	4896.0
1	TraesCS1A01G311600	chr1A	78.926	503	74	18	76	573	34175465	34174990	1.980000e-81	313.0
2	TraesCS1A01G311600	chr1A	86.792	106	11	3	110	214	489290147	489290250	6.000000e-22	115.0
3	TraesCS1A01G311600	chr1A	88.000	75	8	1	1	74	34175583	34175509	1.310000e-13	87.9
4	TraesCS1A01G311600	chr1D	87.898	942	64	27	834	1754	407695720	407696632	0.000000e+00	1062.0
5	TraesCS1A01G311600	chr1D	88.084	814	73	15	997	1793	407807904	407808710	0.000000e+00	944.0
6	TraesCS1A01G311600	chr1D	84.064	753	89	9	994	1722	407823306	407824051	0.000000e+00	697.0
7	TraesCS1A01G311600	chr1D	80.108	186	34	3	2398	2582	407704288	407704471	4.600000e-28	135.0
8	TraesCS1A01G311600	chr1D	85.586	111	14	2	1	110	394951298	394951407	6.000000e-22	115.0
9	TraesCS1A01G311600	chr1D	88.710	62	5	2	110	170	394951428	394951488	1.020000e-09	75.0
10	TraesCS1A01G311600	chr1B	85.714	952	77	26	834	1752	548278571	548279496	0.000000e+00	950.0
11	TraesCS1A01G311600	chr1B	86.782	870	85	14	1000	1846	548300583	548301445	0.000000e+00	942.0
12	TraesCS1A01G311600	chr1B	88.412	699	76	4	997	1692	548292931	548293627	0.000000e+00	837.0
13	TraesCS1A01G311600	chr1B	83.356	721	87	18	997	1692	548391034	548391746	1.040000e-178	636.0
14	TraesCS1A01G311600	chr1B	78.039	255	37	13	2399	2651	548280819	548281056	2.750000e-30	143.0
15	TraesCS1A01G311600	chr1B	84.821	112	15	2	94	205	54920821	54920712	7.760000e-21	111.0
16	TraesCS1A01G311600	chr1B	86.170	94	11	2	645	737	548278439	548278531	1.680000e-17	100.0
17	TraesCS1A01G311600	chr3B	83.462	647	81	13	1003	1645	684268898	684268274	1.770000e-161	579.0
18	TraesCS1A01G311600	chr3B	81.630	675	89	20	1002	1666	684413217	684412568	6.500000e-146	527.0
19	TraesCS1A01G311600	chr3B	81.053	570	72	19	1003	1557	684328204	684327656	3.160000e-114	422.0
20	TraesCS1A01G311600	chr3B	89.423	104	10	1	1	104	451342989	451343091	2.140000e-26	130.0
21	TraesCS1A01G311600	chr3A	82.371	658	88	16	1002	1654	655080885	655080251	4.990000e-152	547.0
22	TraesCS1A01G311600	chr3D	80.349	687	109	17	1000	1683	519710275	519709612	5.100000e-137	497.0
23	TraesCS1A01G311600	chr3D	87.263	369	35	9	1326	1692	519947647	519947289	6.830000e-111	411.0
24	TraesCS1A01G311600	chr3D	74.355	581	80	35	1	534	489410851	489411409	1.620000e-42	183.0
25	TraesCS1A01G311600	chr6B	90.909	110	9	1	1	110	18087674	18087566	2.130000e-31	147.0
26	TraesCS1A01G311600	chr6B	89.423	104	10	1	1	104	93643507	93643609	2.140000e-26	130.0
27	TraesCS1A01G311600	chr6B	86.076	79	10	1	85	163	18087526	18087449	1.690000e-12	84.2
28	TraesCS1A01G311600	chr7D	89.286	112	11	1	1	112	162153491	162153381	3.560000e-29	139.0
29	TraesCS1A01G311600	chr4B	88.596	114	11	2	98	211	615343659	615343548	1.280000e-28	137.0
30	TraesCS1A01G311600	chr4B	85.833	120	16	1	151	270	37873236	37873118	2.770000e-25	126.0
31	TraesCS1A01G311600	chr6A	89.773	88	8	1	151	238	12617624	12617538	7.760000e-21	111.0
32	TraesCS1A01G311600	chr7A	88.636	88	9	1	76	163	636698019	636698105	3.610000e-19	106.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS1A01G311600	chr1A	503324400	503327050	2650	False	4896.000000	4896	100.000000	1	2651	1	chr1A.!!$F2	2650
1	TraesCS1A01G311600	chr1A	34174990	34175583	593	True	200.450000	313	83.463000	1	573	2	chr1A.!!$R1	572
2	TraesCS1A01G311600	chr1D	407695720	407696632	912	False	1062.000000	1062	87.898000	834	1754	1	chr1D.!!$F1	920
3	TraesCS1A01G311600	chr1D	407807904	407808710	806	False	944.000000	944	88.084000	997	1793	1	chr1D.!!$F3	796
4	TraesCS1A01G311600	chr1D	407823306	407824051	745	False	697.000000	697	84.064000	994	1722	1	chr1D.!!$F4	728
5	TraesCS1A01G311600	chr1B	548300583	548301445	862	False	942.000000	942	86.782000	1000	1846	1	chr1B.!!$F2	846
6	TraesCS1A01G311600	chr1B	548292931	548293627	696	False	837.000000	837	88.412000	997	1692	1	chr1B.!!$F1	695
7	TraesCS1A01G311600	chr1B	548391034	548391746	712	False	636.000000	636	83.356000	997	1692	1	chr1B.!!$F3	695
8	TraesCS1A01G311600	chr1B	548278439	548281056	2617	False	397.666667	950	83.307667	645	2651	3	chr1B.!!$F4	2006
9	TraesCS1A01G311600	chr3B	684268274	684268898	624	True	579.000000	579	83.462000	1003	1645	1	chr3B.!!$R1	642
10	TraesCS1A01G311600	chr3B	684412568	684413217	649	True	527.000000	527	81.630000	1002	1666	1	chr3B.!!$R3	664
11	TraesCS1A01G311600	chr3B	684327656	684328204	548	True	422.000000	422	81.053000	1003	1557	1	chr3B.!!$R2	554
12	TraesCS1A01G311600	chr3A	655080251	655080885	634	True	547.000000	547	82.371000	1002	1654	1	chr3A.!!$R1	652
13	TraesCS1A01G311600	chr3D	519709612	519710275	663	True	497.000000	497	80.349000	1000	1683	1	chr3D.!!$R1	683

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
548	592	0.027194	CCATGAACGAAGCTGCGATG	59.973	55.0	24.02	14.19	34.83	3.84	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2002	2411	0.036306	ACAACCCCCAATCAGTCGAC	59.964	55.0	7.7	7.7	0.0	4.2	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
34	35	4.147653	GGTTGTAACATTATCGATCGTCGG	59.852	45.833	15.94	4.41	40.88	4.79
35	36	3.302555	TGTAACATTATCGATCGTCGGC	58.697	45.455	15.94	0.00	40.88	5.54
38	39	1.337071	ACATTATCGATCGTCGGCTGT	59.663	47.619	15.94	10.53	40.88	4.40
44	45	0.930742	CGATCGTCGGCTGTAGCTTC	60.931	60.000	7.03	0.00	41.70	3.86
57	58	2.271800	GTAGCTTCTAGTGTTGCGCAT	58.728	47.619	12.75	0.00	0.00	4.73
62	63	2.813179	CTAGTGTTGCGCATCGGCC	61.813	63.158	12.75	2.55	36.38	6.13
73	74	2.106683	CATCGGCCGACCCACTTTC	61.107	63.158	33.75	0.00	0.00	2.62
74	75	2.589157	ATCGGCCGACCCACTTTCA	61.589	57.895	33.75	3.58	0.00	2.69
104	148	0.520404	TCGTAGCTTTTCTCGTCGCT	59.480	50.000	0.00	0.00	36.56	4.93
108	152	0.249911	AGCTTTTCTCGTCGCTGGTT	60.250	50.000	0.00	0.00	0.00	3.67
123	167	2.157863	GCTGGTTGTAGCTTTTCTCGTC	59.842	50.000	0.00	0.00	40.52	4.20
139	183	3.418913	TCGCCGGTTGCAACATCG	61.419	61.111	29.55	25.58	41.33	3.84
140	184	4.459331	CGCCGGTTGCAACATCGG	62.459	66.667	31.06	31.06	44.70	4.18
149	193	3.521560	GTTGCAACATCGGTCATCTCTA	58.478	45.455	24.52	0.00	0.00	2.43
152	196	3.181486	TGCAACATCGGTCATCTCTAGTC	60.181	47.826	0.00	0.00	0.00	2.59
186	230	2.612567	GCCGGTTGCAACATCGTCA	61.613	57.895	29.55	0.00	40.77	4.35
189	233	1.465689	CCGGTTGCAACATCGTCATTC	60.466	52.381	29.55	9.03	0.00	2.67
194	238	1.733912	TGCAACATCGTCATTCTCTGC	59.266	47.619	0.00	0.00	0.00	4.26
208	252	3.944055	TCTCTGCTCGTAGCTTTTCTT	57.056	42.857	0.00	0.00	42.97	2.52
209	253	3.579709	TCTCTGCTCGTAGCTTTTCTTG	58.420	45.455	0.00	0.00	42.97	3.02
210	254	3.005897	TCTCTGCTCGTAGCTTTTCTTGT	59.994	43.478	0.00	0.00	42.97	3.16
211	255	3.728845	TCTGCTCGTAGCTTTTCTTGTT	58.271	40.909	0.00	0.00	42.97	2.83
212	256	3.494626	TCTGCTCGTAGCTTTTCTTGTTG	59.505	43.478	0.00	0.00	42.97	3.33
213	257	2.032030	TGCTCGTAGCTTTTCTTGTTGC	60.032	45.455	0.00	0.00	42.97	4.17
214	258	2.665794	GCTCGTAGCTTTTCTTGTTGCC	60.666	50.000	0.00	0.00	38.45	4.52

Showing 1 to 25 of 566 entries

Previous1 2 3 4 5…23Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
10	11	4.143885	CGACGATCGATAATGTTACAACCG	60.144	45.833	24.34	0.00	43.74	4.44
14	15	3.004002	AGCCGACGATCGATAATGTTACA	59.996	43.478	24.34	0.00	43.74	2.41
34	35	1.656095	CGCAACACTAGAAGCTACAGC	59.344	52.381	0.00	0.00	42.49	4.40
35	36	1.656095	GCGCAACACTAGAAGCTACAG	59.344	52.381	0.30	0.00	0.00	2.74
38	39	2.540515	GATGCGCAACACTAGAAGCTA	58.459	47.619	17.11	0.00	0.00	3.32
44	45	2.703409	GCCGATGCGCAACACTAG	59.297	61.111	17.11	1.55	0.00	2.57
57	58	2.515996	GATGAAAGTGGGTCGGCCGA	62.516	60.000	27.28	27.28	34.97	5.54
62	63	1.202582	AGAGACGATGAAAGTGGGTCG	59.797	52.381	0.00	0.00	39.78	4.79
69	70	2.638556	ACGACCAGAGACGATGAAAG	57.361	50.000	0.00	0.00	35.12	2.62
70	71	2.159421	GCTACGACCAGAGACGATGAAA	60.159	50.000	0.00	0.00	35.12	2.69
73	74	1.018148	AGCTACGACCAGAGACGATG	58.982	55.000	0.00	0.00	35.12	3.84
74	75	1.752683	AAGCTACGACCAGAGACGAT	58.247	50.000	0.00	0.00	35.12	3.73
104	148	2.400399	CGACGAGAAAAGCTACAACCA	58.600	47.619	0.00	0.00	0.00	3.67
108	152	3.117589	GGCGACGAGAAAAGCTACA	57.882	52.632	0.00	0.00	0.00	2.74
139	183	4.904253	AAAGCTACGACTAGAGATGACC	57.096	45.455	0.00	0.00	0.00	4.02
140	184	6.126568	AGAAAAGCTACGACTAGAGATGAC	57.873	41.667	0.00	0.00	0.00	3.06
149	193	2.059541	GCAACGAGAAAAGCTACGACT	58.940	47.619	0.00	0.00	0.00	4.18
152	196	3.949313	GGCAACGAGAAAAGCTACG	57.051	52.632	0.00	0.00	0.00	3.51
183	227	2.861462	AGCTACGAGCAGAGAATGAC	57.139	50.000	9.09	0.00	45.56	3.06
186	230	4.464069	AGAAAAGCTACGAGCAGAGAAT	57.536	40.909	9.09	0.00	45.56	2.40
189	233	3.321497	ACAAGAAAAGCTACGAGCAGAG	58.679	45.455	9.09	0.00	45.56	3.35
194	238	2.411547	CGGCAACAAGAAAAGCTACGAG	60.412	50.000	0.00	0.00	0.00	4.18
208	252	1.666054	AAAAGTTACGACCGGCAACA	58.334	45.000	0.00	0.00	0.00	3.33
209	253	3.482436	CGATAAAAGTTACGACCGGCAAC	60.482	47.826	0.00	0.45	0.00	4.17
210	254	2.667481	CGATAAAAGTTACGACCGGCAA	59.333	45.455	0.00	0.00	0.00	4.52

Showing 1 to 25 of 606 entries

Previous1 2 3 4 5…25Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.