Multiple sequence alignment - TraesCS1A01G307000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G307000 chr1A 100.000 2440 0 0 1 2440 498689625 498692064 0 4506
1 TraesCS1A01G307000 chr5A 99.142 2448 13 5 1 2440 19247241 19249688 0 4397
2 TraesCS1A01G307000 chr7D 99.059 2443 18 4 1 2440 382051681 382049241 0 4379
3 TraesCS1A01G307000 chr7D 98.896 2446 18 5 1 2440 381925603 381923161 0 4359
4 TraesCS1A01G307000 chr7B 98.936 2444 20 5 1 2440 716877179 716879620 0 4364
5 TraesCS1A01G307000 chr7A 98.854 2444 24 3 1 2440 60280915 60278472 0 4355
6 TraesCS1A01G307000 chr7A 98.772 2443 24 4 1 2440 120839558 120841997 0 4340
7 TraesCS1A01G307000 chr7A 96.731 2447 68 7 1 2440 686738549 686740990 0 4065
8 TraesCS1A01G307000 chr2B 98.283 2446 32 7 1 2439 112842637 112840195 0 4276
9 TraesCS1A01G307000 chr3B 97.177 2444 57 6 1 2439 797591335 797593771 0 4120


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G307000 chr1A 498689625 498692064 2439 False 4506 4506 100.000 1 2440 1 chr1A.!!$F1 2439
1 TraesCS1A01G307000 chr5A 19247241 19249688 2447 False 4397 4397 99.142 1 2440 1 chr5A.!!$F1 2439
2 TraesCS1A01G307000 chr7D 382049241 382051681 2440 True 4379 4379 99.059 1 2440 1 chr7D.!!$R2 2439
3 TraesCS1A01G307000 chr7D 381923161 381925603 2442 True 4359 4359 98.896 1 2440 1 chr7D.!!$R1 2439
4 TraesCS1A01G307000 chr7B 716877179 716879620 2441 False 4364 4364 98.936 1 2440 1 chr7B.!!$F1 2439
5 TraesCS1A01G307000 chr7A 60278472 60280915 2443 True 4355 4355 98.854 1 2440 1 chr7A.!!$R1 2439
6 TraesCS1A01G307000 chr7A 120839558 120841997 2439 False 4340 4340 98.772 1 2440 1 chr7A.!!$F1 2439
7 TraesCS1A01G307000 chr7A 686738549 686740990 2441 False 4065 4065 96.731 1 2440 1 chr7A.!!$F2 2439
8 TraesCS1A01G307000 chr2B 112840195 112842637 2442 True 4276 4276 98.283 1 2439 1 chr2B.!!$R1 2438
9 TraesCS1A01G307000 chr3B 797591335 797593771 2436 False 4120 4120 97.177 1 2439 1 chr3B.!!$F1 2438

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
898 899 2.672651 CCATTCCACACGCTGCCA 60.673 61.111 0.0 0.0 0.0 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1746 1758 5.411053 GCAATTTAGAGAGAAAGAGCAGTGT 59.589 40.0 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 5.863935 GGCGAAGAACAAATAGAATTTGCTT 59.136 36.000 11.32 8.11 32.93 3.91
717 718 4.452270 AGATTGAATAGATAGGGCCCCAT 58.548 43.478 21.43 11.55 0.00 4.00
898 899 2.672651 CCATTCCACACGCTGCCA 60.673 61.111 0.00 0.00 0.00 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 2.485795 GGCAGTTTTCCGTGCACCA 61.486 57.895 12.15 0.0 41.75 4.17
717 718 2.417239 CCAGCGGCGAATTAACAACTTA 59.583 45.455 12.98 0.0 0.00 2.24
898 899 2.826128 TCAGATAACCACGTCTCTGCTT 59.174 45.455 0.00 0.0 36.04 3.91
1215 1216 2.332654 GGAATGCCTGCCGACGTTT 61.333 57.895 0.00 0.0 0.00 3.60
1457 1460 1.280710 TCCGCTTTGCTAATCTTCCCA 59.719 47.619 0.00 0.0 0.00 4.37
1554 1557 1.826385 CCAACGAAATGAAGGCCTCT 58.174 50.000 5.23 0.0 0.00 3.69
1746 1758 5.411053 GCAATTTAGAGAGAAAGAGCAGTGT 59.589 40.000 0.00 0.0 0.00 3.55
2274 2296 5.714806 ACTCCTTCCTTTTGAAAAAGTGACA 59.285 36.000 13.09 0.0 42.92 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.