Multiple sequence alignment - TraesCS1A01G306800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G306800 chr1A 100.000 2644 0 0 1 2644 498684524 498687167 0 4883
1 TraesCS1A01G306800 chr7B 99.093 2647 21 2 1 2644 742996152 742993506 0 4752
2 TraesCS1A01G306800 chr7B 98.904 2647 25 3 1 2644 716872075 716874720 0 4724
3 TraesCS1A01G306800 chrUn 99.092 2644 21 2 1 2641 186201714 186204357 0 4747
4 TraesCS1A01G306800 chr5A 98.678 2647 32 2 1 2644 492862434 492859788 0 4691
5 TraesCS1A01G306800 chr2B 98.489 2647 37 2 1 2644 391167715 391165069 0 4663
6 TraesCS1A01G306800 chr4B 98.488 2646 37 2 1 2644 209306367 209303723 0 4662
7 TraesCS1A01G306800 chr4A 98.414 2648 37 4 1 2644 67603673 67601027 0 4652
8 TraesCS1A01G306800 chr3A 98.300 2647 42 2 1 2644 725803459 725800813 0 4636


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G306800 chr1A 498684524 498687167 2643 False 4883 4883 100.000 1 2644 1 chr1A.!!$F1 2643
1 TraesCS1A01G306800 chr7B 742993506 742996152 2646 True 4752 4752 99.093 1 2644 1 chr7B.!!$R1 2643
2 TraesCS1A01G306800 chr7B 716872075 716874720 2645 False 4724 4724 98.904 1 2644 1 chr7B.!!$F1 2643
3 TraesCS1A01G306800 chrUn 186201714 186204357 2643 False 4747 4747 99.092 1 2641 1 chrUn.!!$F1 2640
4 TraesCS1A01G306800 chr5A 492859788 492862434 2646 True 4691 4691 98.678 1 2644 1 chr5A.!!$R1 2643
5 TraesCS1A01G306800 chr2B 391165069 391167715 2646 True 4663 4663 98.489 1 2644 1 chr2B.!!$R1 2643
6 TraesCS1A01G306800 chr4B 209303723 209306367 2644 True 4662 4662 98.488 1 2644 1 chr4B.!!$R1 2643
7 TraesCS1A01G306800 chr4A 67601027 67603673 2646 True 4652 4652 98.414 1 2644 1 chr4A.!!$R1 2643
8 TraesCS1A01G306800 chr3A 725800813 725803459 2646 True 4636 4636 98.300 1 2644 1 chr3A.!!$R1 2643

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
510 514 2.769095 GGCTCACTTGGAAGGATAGAGT 59.231 50.0 0.0 0.0 0.0 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1843 1851 2.259618 GATCGAGCAACTAAACGAGCA 58.74 47.619 0.0 0.0 40.14 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 284 8.757982 AGTAATGCAAGGATGTAAAGAATGAT 57.242 30.769 0.00 0.00 0.00 2.45
510 514 2.769095 GGCTCACTTGGAAGGATAGAGT 59.231 50.000 0.00 0.00 0.00 3.24
580 584 2.811317 CTCTCGAACGCCTGGCAC 60.811 66.667 20.29 8.37 0.00 5.01
1760 1768 2.014857 GGGAAGCGAAACCATAGTTCC 58.985 52.381 0.00 0.00 34.19 3.62
1771 1779 5.431179 AACCATAGTTCCGGTTAGTTCAT 57.569 39.130 0.00 0.00 43.73 2.57
1843 1851 6.366061 GCGCAAAAGATTTCTATTTGGAGTTT 59.634 34.615 0.30 0.00 35.21 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 284 1.079819 GCCAGTCTGTTCTAGCGCA 60.080 57.895 11.47 0.0 0.00 6.09
494 498 1.482593 CGGCACTCTATCCTTCCAAGT 59.517 52.381 0.00 0.0 0.00 3.16
510 514 2.334946 GCCATCTTGTCTTGCGGCA 61.335 57.895 0.00 0.0 39.38 5.69
580 584 3.284323 AGTATGCGGCTCGTATTAGTG 57.716 47.619 0.00 0.0 33.75 2.74
1067 1073 5.607939 TGATACGGAAAGAAAGCCATCTA 57.392 39.130 0.00 0.0 0.00 1.98
1760 1768 6.379386 TCGATAATCTAGCATGAACTAACCG 58.621 40.000 0.00 0.0 0.00 4.44
1771 1779 6.475727 GTGTTACAAGCTTCGATAATCTAGCA 59.524 38.462 7.24 0.0 36.11 3.49
1843 1851 2.259618 GATCGAGCAACTAAACGAGCA 58.740 47.619 0.00 0.0 40.14 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.