Multiple sequence alignment - TraesCS1A01G285800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G285800 chr1A 100.000 4488 0 0 1 4488 482817833 482822320 0.000000e+00 8288.0
1 TraesCS1A01G285800 chr1A 98.598 3781 41 2 717 4488 146609531 146613308 0.000000e+00 6678.0
2 TraesCS1A01G285800 chr1A 84.903 2729 349 46 990 3683 555296116 555298816 0.000000e+00 2699.0
3 TraesCS1A01G285800 chr4A 98.890 3783 31 2 717 4488 481089109 481092891 0.000000e+00 6743.0
4 TraesCS1A01G285800 chr4A 88.460 2851 256 27 897 3716 90394584 90391776 0.000000e+00 3374.0
5 TraesCS1A01G285800 chr4A 96.792 717 23 0 1 717 363860036 363859320 0.000000e+00 1197.0
6 TraesCS1A01G285800 chr4A 96.662 719 23 1 1 718 393735798 393735080 0.000000e+00 1194.0
7 TraesCS1A01G285800 chr4A 96.513 717 25 0 1 717 363849135 363848419 0.000000e+00 1186.0
8 TraesCS1A01G285800 chr3B 98.889 3782 32 2 717 4488 768506010 768509791 0.000000e+00 6743.0
9 TraesCS1A01G285800 chr3B 94.595 37 2 0 3808 3844 768509186 768509222 1.740000e-04 58.4
10 TraesCS1A01G285800 chr5D 97.437 3784 55 14 717 4488 550419231 550415478 0.000000e+00 6412.0
11 TraesCS1A01G285800 chr7D 97.331 3784 58 14 717 4488 4417342 4421094 0.000000e+00 6388.0
12 TraesCS1A01G285800 chr5A 97.793 3715 52 12 717 4421 612386071 612382377 0.000000e+00 6379.0
13 TraesCS1A01G285800 chr5A 96.801 719 23 0 1 719 690136885 690137603 0.000000e+00 1201.0
14 TraesCS1A01G285800 chrUn 98.767 2676 21 5 1825 4488 62686915 62689590 0.000000e+00 4748.0
15 TraesCS1A01G285800 chrUn 99.285 1119 7 1 717 1834 62672527 62673645 0.000000e+00 2021.0
16 TraesCS1A01G285800 chr3D 88.961 2944 249 41 897 3787 41716731 41719651 0.000000e+00 3567.0
17 TraesCS1A01G285800 chr7A 88.916 2851 265 29 897 3716 727630581 727627751 0.000000e+00 3467.0
18 TraesCS1A01G285800 chr7A 96.653 717 24 0 1 717 479729017 479729733 0.000000e+00 1192.0
19 TraesCS1A01G285800 chr1D 96.287 1239 21 10 3250 4488 334045201 334043988 0.000000e+00 2010.0
20 TraesCS1A01G285800 chr1D 98.429 191 3 0 717 907 334045410 334045220 2.000000e-88 337.0
21 TraesCS1A01G285800 chr6B 91.508 1001 37 16 3503 4488 279329654 279328687 0.000000e+00 1334.0
22 TraesCS1A01G285800 chr6B 98.684 152 2 0 717 868 279329810 279329659 2.060000e-68 270.0
23 TraesCS1A01G285800 chr7B 96.792 717 23 0 1 717 558110396 558111112 0.000000e+00 1197.0
24 TraesCS1A01G285800 chr3A 96.792 717 23 0 1 717 148523178 148523894 0.000000e+00 1197.0
25 TraesCS1A01G285800 chr2A 96.653 717 24 0 1 717 658308093 658308809 0.000000e+00 1192.0
26 TraesCS1A01G285800 chr4B 96.513 717 25 0 1 717 486180708 486181424 0.000000e+00 1186.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G285800 chr1A 482817833 482822320 4487 False 8288.0 8288 100.000 1 4488 1 chr1A.!!$F2 4487
1 TraesCS1A01G285800 chr1A 146609531 146613308 3777 False 6678.0 6678 98.598 717 4488 1 chr1A.!!$F1 3771
2 TraesCS1A01G285800 chr1A 555296116 555298816 2700 False 2699.0 2699 84.903 990 3683 1 chr1A.!!$F3 2693
3 TraesCS1A01G285800 chr4A 481089109 481092891 3782 False 6743.0 6743 98.890 717 4488 1 chr4A.!!$F1 3771
4 TraesCS1A01G285800 chr4A 90391776 90394584 2808 True 3374.0 3374 88.460 897 3716 1 chr4A.!!$R1 2819
5 TraesCS1A01G285800 chr4A 363859320 363860036 716 True 1197.0 1197 96.792 1 717 1 chr4A.!!$R3 716
6 TraesCS1A01G285800 chr4A 393735080 393735798 718 True 1194.0 1194 96.662 1 718 1 chr4A.!!$R4 717
7 TraesCS1A01G285800 chr4A 363848419 363849135 716 True 1186.0 1186 96.513 1 717 1 chr4A.!!$R2 716
8 TraesCS1A01G285800 chr3B 768506010 768509791 3781 False 3400.7 6743 96.742 717 4488 2 chr3B.!!$F1 3771
9 TraesCS1A01G285800 chr5D 550415478 550419231 3753 True 6412.0 6412 97.437 717 4488 1 chr5D.!!$R1 3771
10 TraesCS1A01G285800 chr7D 4417342 4421094 3752 False 6388.0 6388 97.331 717 4488 1 chr7D.!!$F1 3771
11 TraesCS1A01G285800 chr5A 612382377 612386071 3694 True 6379.0 6379 97.793 717 4421 1 chr5A.!!$R1 3704
12 TraesCS1A01G285800 chr5A 690136885 690137603 718 False 1201.0 1201 96.801 1 719 1 chr5A.!!$F1 718
13 TraesCS1A01G285800 chrUn 62686915 62689590 2675 False 4748.0 4748 98.767 1825 4488 1 chrUn.!!$F2 2663
14 TraesCS1A01G285800 chrUn 62672527 62673645 1118 False 2021.0 2021 99.285 717 1834 1 chrUn.!!$F1 1117
15 TraesCS1A01G285800 chr3D 41716731 41719651 2920 False 3567.0 3567 88.961 897 3787 1 chr3D.!!$F1 2890
16 TraesCS1A01G285800 chr7A 727627751 727630581 2830 True 3467.0 3467 88.916 897 3716 1 chr7A.!!$R1 2819
17 TraesCS1A01G285800 chr7A 479729017 479729733 716 False 1192.0 1192 96.653 1 717 1 chr7A.!!$F1 716
18 TraesCS1A01G285800 chr1D 334043988 334045410 1422 True 1173.5 2010 97.358 717 4488 2 chr1D.!!$R1 3771
19 TraesCS1A01G285800 chr6B 279328687 279329810 1123 True 802.0 1334 95.096 717 4488 2 chr6B.!!$R1 3771
20 TraesCS1A01G285800 chr7B 558110396 558111112 716 False 1197.0 1197 96.792 1 717 1 chr7B.!!$F1 716
21 TraesCS1A01G285800 chr3A 148523178 148523894 716 False 1197.0 1197 96.792 1 717 1 chr3A.!!$F1 716
22 TraesCS1A01G285800 chr2A 658308093 658308809 716 False 1192.0 1192 96.653 1 717 1 chr2A.!!$F1 716
23 TraesCS1A01G285800 chr4B 486180708 486181424 716 False 1186.0 1186 96.513 1 717 1 chr4B.!!$F1 716

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
76 77 0.893270 ATAACAACAGCGGCAAGGCA 60.893 50.000 1.45 0.0 34.64 4.75 F
524 526 2.224281 ACATCACACTCTCGCTTTGGAA 60.224 45.455 0.00 0.0 0.00 3.53 F
2262 2298 4.160252 ACATTTCTGCAGTGTCCTTGTTTT 59.840 37.500 14.67 0.0 0.00 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1889 1896 1.539388 TGTAAATGCCTTGACCGCTTG 59.461 47.619 0.0 0.0 0.00 4.01 R
2498 2534 3.562141 TGACACGGTTTCTAACATTGTGG 59.438 43.478 0.0 0.0 35.91 4.17 R
3936 4014 1.546029 GGCAAGGTTCATGGTCTTTCC 59.454 52.381 0.0 0.0 0.00 3.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 3.766691 GTACCTCGAAGCCCGGCA 61.767 66.667 13.15 0.00 39.14 5.69
76 77 0.893270 ATAACAACAGCGGCAAGGCA 60.893 50.000 1.45 0.00 34.64 4.75
141 142 2.338620 CCAACGTGTCGCTCTGGA 59.661 61.111 0.00 0.00 0.00 3.86
369 370 5.504392 ACTACCTCGCTTTTTACGTTTTTG 58.496 37.500 0.00 0.00 0.00 2.44
452 454 2.365105 TAGAGGGGGTTCGGCTGG 60.365 66.667 0.00 0.00 0.00 4.85
524 526 2.224281 ACATCACACTCTCGCTTTGGAA 60.224 45.455 0.00 0.00 0.00 3.53
1387 1392 6.799441 CGAGTAGAATCCATATGAAGTTCTCG 59.201 42.308 15.72 14.49 32.02 4.04
1889 1896 9.752961 GTAATCTAGATCCCAAAGAGAAACTAC 57.247 37.037 5.51 0.00 0.00 2.73
2262 2298 4.160252 ACATTTCTGCAGTGTCCTTGTTTT 59.840 37.500 14.67 0.00 0.00 2.43
2498 2534 9.289303 CTACTCATGTTTTTACATACAATTGGC 57.711 33.333 10.83 0.00 0.00 4.52
3108 3154 7.444792 TGCAGGCAAATTTTATCTTGTTGATTT 59.555 29.630 0.00 0.00 36.65 2.17
3485 3531 3.022406 GGGCAAGCAAGAGAAGATGATT 58.978 45.455 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 1.439679 GCTTCGAGGTACCTTGGTTG 58.560 55.000 26.17 17.42 0.00 3.77
401 402 4.443881 GGGCCTCCTTTTATACGCTAAAGA 60.444 45.833 0.84 0.00 34.11 2.52
452 454 0.456628 GTCTGAGGCCTCGAACCTAC 59.543 60.000 27.43 14.31 37.77 3.18
524 526 6.151144 GGTTGTATTATCTGGTGTTCTTGCTT 59.849 38.462 0.00 0.00 0.00 3.91
1889 1896 1.539388 TGTAAATGCCTTGACCGCTTG 59.461 47.619 0.00 0.00 0.00 4.01
2262 2298 5.906113 AACCTTGTAAACAACACATCACA 57.094 34.783 0.00 0.00 38.00 3.58
2498 2534 3.562141 TGACACGGTTTCTAACATTGTGG 59.438 43.478 0.00 0.00 35.91 4.17
3108 3154 7.896383 AATTTTGGAGTATTTGCATAGCCTA 57.104 32.000 0.00 0.00 0.00 3.93
3485 3531 1.709578 ACTCTCTCACCAGCAACTCA 58.290 50.000 0.00 0.00 0.00 3.41
3919 3997 6.034577 GGTCTTTCCAAAAACAAGAAGTTTCG 59.965 38.462 0.00 0.00 41.78 3.46
3936 4014 1.546029 GGCAAGGTTCATGGTCTTTCC 59.454 52.381 0.00 0.00 0.00 3.13
4384 4462 0.461961 GTCAGCCAGCTCTATCCGTT 59.538 55.000 0.00 0.00 0.00 4.44
4439 4517 4.024984 CCTCCCCTCCCCTGGACA 62.025 72.222 0.00 0.00 0.00 4.02
4470 4551 2.853542 TTGCTGCTGGACTCCCCA 60.854 61.111 0.00 0.00 44.25 4.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.