Multiple sequence alignment - TraesCS1A01G258900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G258900 chr1A 100.000 2626 0 0 1 2626 452026618 452023993 0.000000e+00 4850.0
1 TraesCS1A01G258900 chr1A 94.558 1176 57 4 6 1176 548229640 548228467 0.000000e+00 1810.0
2 TraesCS1A01G258900 chr1A 93.697 714 27 7 1252 1964 548228465 548227769 0.000000e+00 1053.0
3 TraesCS1A01G258900 chr4A 98.151 2650 23 3 1 2626 41895263 41897910 0.000000e+00 4599.0
4 TraesCS1A01G258900 chr4A 92.125 1181 65 6 1 1176 725870613 725869456 0.000000e+00 1640.0
5 TraesCS1A01G258900 chr4A 92.157 408 20 6 1559 1964 725869206 725868809 1.360000e-157 566.0
6 TraesCS1A01G258900 chr4A 95.000 260 13 0 1252 1511 725869454 725869195 2.430000e-110 409.0
7 TraesCS1A01G258900 chr1D 98.118 1966 29 3 1 1964 156776732 156778691 0.000000e+00 3419.0
8 TraesCS1A01G258900 chr3A 97.770 1345 26 2 624 1964 662139618 662140962 0.000000e+00 2314.0
9 TraesCS1A01G258900 chr3A 97.143 630 15 2 1 629 662124525 662125152 0.000000e+00 1061.0
10 TraesCS1A01G258900 chr6A 96.779 1335 25 4 646 1964 99978139 99976807 0.000000e+00 2211.0
11 TraesCS1A01G258900 chr6A 96.040 606 18 4 1 602 100058479 100057876 0.000000e+00 981.0
12 TraesCS1A01G258900 chr5A 98.680 1212 15 1 754 1964 299774058 299772847 0.000000e+00 2148.0
13 TraesCS1A01G258900 chr5A 97.778 765 16 1 1 764 299775012 299774248 0.000000e+00 1317.0
14 TraesCS1A01G258900 chr2B 94.157 1181 63 3 1 1176 493241611 493242790 0.000000e+00 1794.0
15 TraesCS1A01G258900 chr2B 94.134 716 29 6 1252 1964 493242792 493243497 0.000000e+00 1077.0
16 TraesCS1A01G258900 chr4B 89.360 1438 100 23 1 1403 570343834 570345253 0.000000e+00 1759.0
17 TraesCS1A01G258900 chr7A 97.598 666 16 0 1961 2626 200007650 200008315 0.000000e+00 1142.0
18 TraesCS1A01G258900 chr7A 96.875 32 1 0 1961 1992 3968246 3968277 1.000000e-03 54.7
19 TraesCS1A01G258900 chr5D 97.285 663 18 0 1964 2626 34273858 34273196 0.000000e+00 1125.0
20 TraesCS1A01G258900 chr2D 96.847 666 21 0 1961 2626 433216743 433217408 0.000000e+00 1114.0
21 TraesCS1A01G258900 chr2A 95.067 669 22 3 1964 2626 554016842 554016179 0.000000e+00 1042.0
22 TraesCS1A01G258900 chr3D 86.806 288 35 2 1429 1715 350130046 350130331 4.220000e-83 318.0
23 TraesCS1A01G258900 chr5B 86.689 293 30 7 1429 1719 468630265 468629980 1.520000e-82 316.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G258900 chr1A 452023993 452026618 2625 True 4850.000000 4850 100.0000 1 2626 1 chr1A.!!$R1 2625
1 TraesCS1A01G258900 chr1A 548227769 548229640 1871 True 1431.500000 1810 94.1275 6 1964 2 chr1A.!!$R2 1958
2 TraesCS1A01G258900 chr4A 41895263 41897910 2647 False 4599.000000 4599 98.1510 1 2626 1 chr4A.!!$F1 2625
3 TraesCS1A01G258900 chr4A 725868809 725870613 1804 True 871.666667 1640 93.0940 1 1964 3 chr4A.!!$R1 1963
4 TraesCS1A01G258900 chr1D 156776732 156778691 1959 False 3419.000000 3419 98.1180 1 1964 1 chr1D.!!$F1 1963
5 TraesCS1A01G258900 chr3A 662139618 662140962 1344 False 2314.000000 2314 97.7700 624 1964 1 chr3A.!!$F2 1340
6 TraesCS1A01G258900 chr3A 662124525 662125152 627 False 1061.000000 1061 97.1430 1 629 1 chr3A.!!$F1 628
7 TraesCS1A01G258900 chr6A 99976807 99978139 1332 True 2211.000000 2211 96.7790 646 1964 1 chr6A.!!$R1 1318
8 TraesCS1A01G258900 chr6A 100057876 100058479 603 True 981.000000 981 96.0400 1 602 1 chr6A.!!$R2 601
9 TraesCS1A01G258900 chr5A 299772847 299775012 2165 True 1732.500000 2148 98.2290 1 1964 2 chr5A.!!$R1 1963
10 TraesCS1A01G258900 chr2B 493241611 493243497 1886 False 1435.500000 1794 94.1455 1 1964 2 chr2B.!!$F1 1963
11 TraesCS1A01G258900 chr4B 570343834 570345253 1419 False 1759.000000 1759 89.3600 1 1403 1 chr4B.!!$F1 1402
12 TraesCS1A01G258900 chr7A 200007650 200008315 665 False 1142.000000 1142 97.5980 1961 2626 1 chr7A.!!$F2 665
13 TraesCS1A01G258900 chr5D 34273196 34273858 662 True 1125.000000 1125 97.2850 1964 2626 1 chr5D.!!$R1 662
14 TraesCS1A01G258900 chr2D 433216743 433217408 665 False 1114.000000 1114 96.8470 1961 2626 1 chr2D.!!$F1 665
15 TraesCS1A01G258900 chr2A 554016179 554016842 663 True 1042.000000 1042 95.0670 1964 2626 1 chr2A.!!$R1 662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
691 730 1.584742 GTCGGTACTTCGCGGTAGC 60.585 63.158 6.13 10.43 40.74 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1899 2162 4.829064 TTGACTTGTGCATCAACCTAAC 57.171 40.909 0.0 0.0 29.89 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
691 730 1.584742 GTCGGTACTTCGCGGTAGC 60.585 63.158 6.13 10.43 40.74 3.58
758 997 8.756486 TGATGATGATTTGTTTCAGGATATGT 57.244 30.769 0.00 0.00 0.00 2.29
1899 2162 9.949174 CATAGCTAGATAGACATGCATAAGTAG 57.051 37.037 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
348 379 5.106157 GCCTACACATTATGCATACCAATCC 60.106 44.000 5.74 0.0 0.00 3.01
691 730 6.095021 TCGATGGAGAATTATGGAGGTATACG 59.905 42.308 0.00 0.0 0.00 3.06
758 997 0.539986 GCCTCGAATCCCTTGTACCA 59.460 55.000 0.00 0.0 0.00 3.25
1336 1581 5.995897 GCAACTAACCTTCTAACCTTCTTGA 59.004 40.000 0.00 0.0 0.00 3.02
1899 2162 4.829064 TTGACTTGTGCATCAACCTAAC 57.171 40.909 0.00 0.0 29.89 2.34
2342 2628 6.317140 GCATGACATGGGTACAATATGGATAG 59.683 42.308 17.03 0.0 0.00 2.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.