Multiple sequence alignment - TraesCS1A01G256600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G256600 chr1A 100.000 2303 0 0 1 2303 449186430 449184128 0 4253
1 TraesCS1A01G256600 chr1A 99.055 741 7 0 1 741 58184968 58184228 0 1330
2 TraesCS1A01G256600 chr4A 99.042 1566 15 0 738 2303 377596691 377595126 0 2809
3 TraesCS1A01G256600 chr4A 98.851 1566 18 0 738 2303 152583954 152582389 0 2793
4 TraesCS1A01G256600 chr4A 99.055 741 7 0 1 741 377600266 377599526 0 1330
5 TraesCS1A01G256600 chr4A 99.055 741 7 0 1 741 446477864 446477124 0 1330
6 TraesCS1A01G256600 chr5A 98.917 1570 16 1 735 2303 488269956 488268387 0 2804
7 TraesCS1A01G256600 chr5A 98.723 1566 20 0 738 2303 403297780 403296215 0 2782
8 TraesCS1A01G256600 chr5A 99.055 741 7 0 1 741 597067416 597068156 0 1330
9 TraesCS1A01G256600 chr7A 98.851 1566 18 0 738 2303 333075674 333074109 0 2793
10 TraesCS1A01G256600 chr7A 98.851 1566 17 1 738 2303 121050124 121048560 0 2791
11 TraesCS1A01G256600 chr7A 99.055 741 7 0 1 741 121053227 121052487 0 1330
12 TraesCS1A01G256600 chr2B 98.851 1566 18 0 738 2303 461106339 461104774 0 2793
13 TraesCS1A01G256600 chr3B 98.787 1566 19 0 738 2303 85114013 85115578 0 2787
14 TraesCS1A01G256600 chr3B 99.190 741 6 0 1 741 421085952 421086692 0 1336
15 TraesCS1A01G256600 chr1B 98.723 1566 20 0 738 2303 439506060 439507625 0 2782
16 TraesCS1A01G256600 chr1B 99.190 741 6 0 1 741 439503089 439503829 0 1336
17 TraesCS1A01G256600 chr6A 98.920 741 8 0 1 741 116915988 116916728 0 1325
18 TraesCS1A01G256600 chr4B 98.920 741 8 0 1 741 489021920 489022660 0 1325


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G256600 chr1A 449184128 449186430 2302 True 4253.0 4253 100.0000 1 2303 1 chr1A.!!$R2 2302
1 TraesCS1A01G256600 chr1A 58184228 58184968 740 True 1330.0 1330 99.0550 1 741 1 chr1A.!!$R1 740
2 TraesCS1A01G256600 chr4A 152582389 152583954 1565 True 2793.0 2793 98.8510 738 2303 1 chr4A.!!$R1 1565
3 TraesCS1A01G256600 chr4A 377595126 377600266 5140 True 2069.5 2809 99.0485 1 2303 2 chr4A.!!$R3 2302
4 TraesCS1A01G256600 chr4A 446477124 446477864 740 True 1330.0 1330 99.0550 1 741 1 chr4A.!!$R2 740
5 TraesCS1A01G256600 chr5A 488268387 488269956 1569 True 2804.0 2804 98.9170 735 2303 1 chr5A.!!$R2 1568
6 TraesCS1A01G256600 chr5A 403296215 403297780 1565 True 2782.0 2782 98.7230 738 2303 1 chr5A.!!$R1 1565
7 TraesCS1A01G256600 chr5A 597067416 597068156 740 False 1330.0 1330 99.0550 1 741 1 chr5A.!!$F1 740
8 TraesCS1A01G256600 chr7A 333074109 333075674 1565 True 2793.0 2793 98.8510 738 2303 1 chr7A.!!$R1 1565
9 TraesCS1A01G256600 chr7A 121048560 121053227 4667 True 2060.5 2791 98.9530 1 2303 2 chr7A.!!$R2 2302
10 TraesCS1A01G256600 chr2B 461104774 461106339 1565 True 2793.0 2793 98.8510 738 2303 1 chr2B.!!$R1 1565
11 TraesCS1A01G256600 chr3B 85114013 85115578 1565 False 2787.0 2787 98.7870 738 2303 1 chr3B.!!$F1 1565
12 TraesCS1A01G256600 chr3B 421085952 421086692 740 False 1336.0 1336 99.1900 1 741 1 chr3B.!!$F2 740
13 TraesCS1A01G256600 chr1B 439503089 439507625 4536 False 2059.0 2782 98.9565 1 2303 2 chr1B.!!$F1 2302
14 TraesCS1A01G256600 chr6A 116915988 116916728 740 False 1325.0 1325 98.9200 1 741 1 chr6A.!!$F1 740
15 TraesCS1A01G256600 chr4B 489021920 489022660 740 False 1325.0 1325 98.9200 1 741 1 chr4B.!!$F1 740

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
289 290 1.444724 CGTGCATTACCCGTGACGA 60.445 57.895 6.54 0.0 0.0 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1517 7040 1.270305 CCTCCTCACGAGCAAGTTTCA 60.27 52.381 0.0 0.0 37.27 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 3.318557 TCAATGCATTGCTCAGACACAAA 59.681 39.130 30.57 9.43 37.68 2.83
289 290 1.444724 CGTGCATTACCCGTGACGA 60.445 57.895 6.54 0.00 0.00 4.20
477 478 6.730175 AGAAGCTGTACTATATGACGACAAG 58.270 40.000 0.00 0.00 0.00 3.16
805 6328 4.757149 CCCTCGTTTTCATCCATAGGAATC 59.243 45.833 0.00 0.00 34.34 2.52
818 6341 4.336433 CCATAGGAATCGTCACATTTGCTT 59.664 41.667 0.00 0.00 0.00 3.91
926 6449 4.094476 TCATAGTATGCTAGGGTTAGGGC 58.906 47.826 5.18 0.00 30.61 5.19
1066 6589 0.396435 AGACATGCCGAACAAGTGGA 59.604 50.000 0.00 0.00 28.28 4.02
1360 6883 5.109903 GCAAGTACTTCACGTGGATAGATT 58.890 41.667 17.00 1.99 37.15 2.40
1493 7016 0.984230 AGGATGGAGCGGAAGAAACA 59.016 50.000 0.00 0.00 0.00 2.83
1517 7040 4.021925 GGAGAGGGCACGCCAAGT 62.022 66.667 10.83 0.00 37.98 3.16
1925 7448 4.256920 GTGAGATGTTGGAAGTAGTGCAT 58.743 43.478 0.00 0.00 0.00 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 2.596338 CCGCCGGGGTCAAGTTTT 60.596 61.111 18.27 0.0 0.00 2.43
289 290 9.897744 CTTGTCAAATGTGTATTGAACTATTGT 57.102 29.630 0.00 0.0 38.44 2.71
477 478 4.223032 TCTTTCACCTCATACTTCCACTCC 59.777 45.833 0.00 0.0 0.00 3.85
805 6328 5.156355 AGCAAGATTTAAGCAAATGTGACG 58.844 37.500 0.00 0.0 34.44 4.35
818 6341 4.938575 TCCCCCAAACTAGCAAGATTTA 57.061 40.909 0.00 0.0 0.00 1.40
926 6449 3.756434 CCACAACCCTAACACCAACATAG 59.244 47.826 0.00 0.0 0.00 2.23
1066 6589 2.154462 CTTGTCCAAAGATGCGTCCTT 58.846 47.619 1.23 0.0 0.00 3.36
1360 6883 3.819368 TCACATCTTCTGGCACTTCAAA 58.181 40.909 0.00 0.0 0.00 2.69
1493 7016 1.684049 CGTGCCCTCTCCTCCTCTT 60.684 63.158 0.00 0.0 0.00 2.85
1517 7040 1.270305 CCTCCTCACGAGCAAGTTTCA 60.270 52.381 0.00 0.0 37.27 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.