Multiple sequence alignment - TraesCS1A01G247600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G247600 chr1A 100.000 1787 0 0 577 2363 439487594 439489380 0.000000e+00 3301
1 TraesCS1A01G247600 chr1A 97.541 1789 42 2 577 2363 534010358 534012146 0.000000e+00 3059
2 TraesCS1A01G247600 chr1A 97.358 1779 47 0 585 2363 31697249 31699027 0.000000e+00 3025
3 TraesCS1A01G247600 chr1A 100.000 372 0 0 1 372 439487018 439487389 0.000000e+00 688
4 TraesCS1A01G247600 chr1A 96.237 372 10 1 1 372 534010001 534010368 7.220000e-170 606
5 TraesCS1A01G247600 chr2A 97.280 956 24 2 1408 2363 779440878 779439925 0.000000e+00 1620
6 TraesCS1A01G247600 chr2A 97.071 956 27 1 1408 2363 779537635 779536681 0.000000e+00 1609
7 TraesCS1A01G247600 chr2A 96.862 956 29 1 1408 2363 35027638 35028592 0.000000e+00 1598
8 TraesCS1A01G247600 chr4A 97.176 956 25 2 1408 2363 604684434 604685387 0.000000e+00 1615
9 TraesCS1A01G247600 chr4A 95.995 749 30 0 577 1325 718964325 718965073 0.000000e+00 1218
10 TraesCS1A01G247600 chr4A 96.471 170 5 1 204 372 718964166 718964335 1.790000e-71 279
11 TraesCS1A01G247600 chr3B 96.437 870 27 4 1408 2275 172154269 172153402 0.000000e+00 1432
12 TraesCS1A01G247600 chr3B 93.779 852 41 6 577 1417 509216579 509217429 0.000000e+00 1269
13 TraesCS1A01G247600 chr3B 96.515 746 26 0 580 1325 685090567 685089822 0.000000e+00 1234
14 TraesCS1A01G247600 chr3B 94.906 746 38 0 580 1325 615704469 615703724 0.000000e+00 1168
15 TraesCS1A01G247600 chr3B 93.834 373 14 3 1 372 615704826 615704462 9.540000e-154 553
16 TraesCS1A01G247600 chr2B 95.574 836 37 0 580 1415 632574264 632573429 0.000000e+00 1339
17 TraesCS1A01G247600 chr2B 94.638 373 12 2 1 372 632574622 632574257 2.630000e-159 571
18 TraesCS1A01G247600 chrUn 95.728 749 32 0 577 1325 384035627 384036375 0.000000e+00 1206
19 TraesCS1A01G247600 chrUn 96.471 170 5 1 204 372 384035468 384035637 1.790000e-71 279
20 TraesCS1A01G247600 chr6B 94.793 749 39 0 577 1325 304065127 304065875 0.000000e+00 1168
21 TraesCS1A01G247600 chr6B 94.370 373 13 2 1 372 304064772 304065137 1.230000e-157 566
22 TraesCS1A01G247600 chr5A 97.784 677 13 2 1408 2083 43682442 43681767 0.000000e+00 1166
23 TraesCS1A01G247600 chr5A 97.781 676 14 1 1408 2083 43768498 43767824 0.000000e+00 1164
24 TraesCS1A01G247600 chr7B 94.751 362 12 1 1 362 70662781 70663135 7.380000e-155 556
25 TraesCS1A01G247600 chr1B 89.005 382 26 10 1 372 200412250 200412625 2.140000e-125 459
26 TraesCS1A01G247600 chr6A 88.667 300 23 5 29 326 165814145 165814435 2.890000e-94 355
27 TraesCS1A01G247600 chr3D 91.566 249 10 6 1 246 456355976 456355736 1.350000e-87 333
28 TraesCS1A01G247600 chr5B 85.417 288 31 8 1 285 84849947 84849668 2.970000e-74 289


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G247600 chr1A 439487018 439489380 2362 False 1994.5 3301 100.0000 1 2363 2 chr1A.!!$F2 2362
1 TraesCS1A01G247600 chr1A 31697249 31699027 1778 False 3025.0 3025 97.3580 585 2363 1 chr1A.!!$F1 1778
2 TraesCS1A01G247600 chr1A 534010001 534012146 2145 False 1832.5 3059 96.8890 1 2363 2 chr1A.!!$F3 2362
3 TraesCS1A01G247600 chr2A 779439925 779440878 953 True 1620.0 1620 97.2800 1408 2363 1 chr2A.!!$R1 955
4 TraesCS1A01G247600 chr2A 779536681 779537635 954 True 1609.0 1609 97.0710 1408 2363 1 chr2A.!!$R2 955
5 TraesCS1A01G247600 chr2A 35027638 35028592 954 False 1598.0 1598 96.8620 1408 2363 1 chr2A.!!$F1 955
6 TraesCS1A01G247600 chr4A 604684434 604685387 953 False 1615.0 1615 97.1760 1408 2363 1 chr4A.!!$F1 955
7 TraesCS1A01G247600 chr4A 718964166 718965073 907 False 748.5 1218 96.2330 204 1325 2 chr4A.!!$F2 1121
8 TraesCS1A01G247600 chr3B 172153402 172154269 867 True 1432.0 1432 96.4370 1408 2275 1 chr3B.!!$R1 867
9 TraesCS1A01G247600 chr3B 509216579 509217429 850 False 1269.0 1269 93.7790 577 1417 1 chr3B.!!$F1 840
10 TraesCS1A01G247600 chr3B 685089822 685090567 745 True 1234.0 1234 96.5150 580 1325 1 chr3B.!!$R2 745
11 TraesCS1A01G247600 chr3B 615703724 615704826 1102 True 860.5 1168 94.3700 1 1325 2 chr3B.!!$R3 1324
12 TraesCS1A01G247600 chr2B 632573429 632574622 1193 True 955.0 1339 95.1060 1 1415 2 chr2B.!!$R1 1414
13 TraesCS1A01G247600 chrUn 384035468 384036375 907 False 742.5 1206 96.0995 204 1325 2 chrUn.!!$F1 1121
14 TraesCS1A01G247600 chr6B 304064772 304065875 1103 False 867.0 1168 94.5815 1 1325 2 chr6B.!!$F1 1324
15 TraesCS1A01G247600 chr5A 43681767 43682442 675 True 1166.0 1166 97.7840 1408 2083 1 chr5A.!!$R1 675
16 TraesCS1A01G247600 chr5A 43767824 43768498 674 True 1164.0 1164 97.7810 1408 2083 1 chr5A.!!$R2 675

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
642 644 0.042431 AGATCTCTGACCCAGCCACT 59.958 55.0 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1609 1628 0.916809 CCACGAAGGGGGAAAGGTAT 59.083 55.0 0.0 0.0 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 1.586422 GATCATGGATGGACACCGTG 58.414 55.000 0.00 0.00 43.43 4.94
105 106 2.954020 GATGCTCGCGGATCCAACGA 62.954 60.000 21.74 21.74 32.39 3.85
362 364 4.899239 CCATGCCGTCCTCGCTCC 62.899 72.222 0.00 0.00 35.54 4.70
363 365 4.899239 CATGCCGTCCTCGCTCCC 62.899 72.222 0.00 0.00 35.54 4.30
369 371 4.154347 GTCCTCGCTCCCCTGCTG 62.154 72.222 0.00 0.00 0.00 4.41
610 612 1.414061 CCTCCATCGCCATCTCCCTT 61.414 60.000 0.00 0.00 0.00 3.95
642 644 0.042431 AGATCTCTGACCCAGCCACT 59.958 55.000 0.00 0.00 0.00 4.00
776 778 1.079819 GCAACTCCTCTGCACGCTA 60.080 57.895 0.00 0.00 39.69 4.26
1125 1127 1.416243 ACAAGGTACGACAACTCCCA 58.584 50.000 0.00 0.00 0.00 4.37
1139 1141 2.034066 CCCATCGCACCAACCTGT 59.966 61.111 0.00 0.00 0.00 4.00
1141 1143 1.302431 CCATCGCACCAACCTGTCA 60.302 57.895 0.00 0.00 0.00 3.58
1229 1231 0.473326 GATGGAGGAGAGGCTGCATT 59.527 55.000 0.50 0.00 31.89 3.56
1383 1396 9.890352 GCATGAGATTCTAGTCCAAAATTTATC 57.110 33.333 0.00 0.00 0.00 1.75
1609 1628 6.998802 CCCCCTAAAACACATGAATTTGTTA 58.001 36.000 0.00 0.00 34.82 2.41
1696 1715 8.687301 AGTATTCACGTTTTATTTCTTTTTGCG 58.313 29.630 0.00 0.00 0.00 4.85
2220 2240 3.005554 CGACTTCCCTGAGTACTACGAA 58.994 50.000 0.00 0.00 0.00 3.85
2286 2306 3.571216 TGGTTGGTGGCGGGCTAA 61.571 61.111 2.38 0.00 0.00 3.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 3.460672 TTGGATCCGCGAGCATCCC 62.461 63.158 21.76 9.94 38.29 3.85
105 106 2.031163 GCTTGCGGTGAGGACTGT 59.969 61.111 0.00 0.00 0.00 3.55
176 177 1.474143 GGAGAAAGAATGGAGGCGAGG 60.474 57.143 0.00 0.00 0.00 4.63
177 178 1.474143 GGGAGAAAGAATGGAGGCGAG 60.474 57.143 0.00 0.00 0.00 5.03
178 179 0.541863 GGGAGAAAGAATGGAGGCGA 59.458 55.000 0.00 0.00 0.00 5.54
610 612 2.091389 CAGAGATCTGGGAGAGGGAGAA 60.091 54.545 0.00 0.00 40.20 2.87
1066 1068 1.320344 ATGACGTAGAAGCCGAGGCA 61.320 55.000 17.18 0.00 44.88 4.75
1125 1127 0.324614 TCATGACAGGTTGGTGCGAT 59.675 50.000 0.00 0.00 0.00 4.58
1229 1231 1.676635 GCACTCCAGCTTGCCATCA 60.677 57.895 0.00 0.00 32.21 3.07
1609 1628 0.916809 CCACGAAGGGGGAAAGGTAT 59.083 55.000 0.00 0.00 0.00 2.73
1696 1715 7.048512 ACAGCAAAGTGAATACTAACTATCCC 58.951 38.462 0.00 0.00 35.69 3.85
2286 2306 1.001641 GAGCATCTTGGCCACCAGT 60.002 57.895 3.88 0.00 33.81 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.