Multiple sequence alignment - TraesCS1A01G237400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G237400 chr1A 100.000 2938 0 0 1 2938 423164928 423161991 0 5426
1 TraesCS1A01G237400 chr1A 97.924 2939 60 1 1 2938 423290440 423287502 0 5088
2 TraesCS1A01G237400 chr1A 97.185 2948 69 10 1 2938 423228546 423225603 0 4972
3 TraesCS1A01G237400 chr1A 93.442 2943 186 7 1 2938 424272049 424274989 0 4359
4 TraesCS1A01G237400 chr1A 92.687 2940 191 9 3 2922 424079681 424082616 0 4217
5 TraesCS1A01G237400 chr1A 92.020 2782 178 15 173 2923 423551901 423549133 0 3868
6 TraesCS1A01G237400 chr1A 93.083 2559 166 9 368 2923 423594773 423592223 0 3735
7 TraesCS1A01G237400 chr1A 93.178 2228 143 6 700 2923 423515655 423513433 0 3264
8 TraesCS1A01G237400 chr1A 92.908 2228 147 7 700 2923 423462692 423460472 0 3229
9 TraesCS1A01G237400 chr1A 93.717 2053 123 6 866 2915 424392568 424394617 0 3072
10 TraesCS1A01G237400 chr1A 91.043 882 69 5 1 874 424390716 424391595 0 1182
11 TraesCS1A01G237400 chr1A 91.098 865 64 8 3 854 423144467 423143603 0 1158
12 TraesCS1A01G237400 chr1A 90.625 864 69 9 3 854 423085783 423084920 0 1136
13 TraesCS1A01G237400 chr1A 90.636 833 65 2 35 854 423270124 423269292 0 1094
14 TraesCS1A01G237400 chr1A 89.236 864 70 9 3 854 423208267 423207415 0 1059
15 TraesCS1A01G237400 chr1B 88.995 2090 173 24 1 2040 435811513 435813595 0 2532


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G237400 chr1A 423161991 423164928 2937 True 5426 5426 100.000 1 2938 1 chr1A.!!$R3 2937
1 TraesCS1A01G237400 chr1A 423287502 423290440 2938 True 5088 5088 97.924 1 2938 1 chr1A.!!$R7 2937
2 TraesCS1A01G237400 chr1A 423225603 423228546 2943 True 4972 4972 97.185 1 2938 1 chr1A.!!$R5 2937
3 TraesCS1A01G237400 chr1A 424272049 424274989 2940 False 4359 4359 93.442 1 2938 1 chr1A.!!$F2 2937
4 TraesCS1A01G237400 chr1A 424079681 424082616 2935 False 4217 4217 92.687 3 2922 1 chr1A.!!$F1 2919
5 TraesCS1A01G237400 chr1A 423549133 423551901 2768 True 3868 3868 92.020 173 2923 1 chr1A.!!$R10 2750
6 TraesCS1A01G237400 chr1A 423592223 423594773 2550 True 3735 3735 93.083 368 2923 1 chr1A.!!$R11 2555
7 TraesCS1A01G237400 chr1A 423513433 423515655 2222 True 3264 3264 93.178 700 2923 1 chr1A.!!$R9 2223
8 TraesCS1A01G237400 chr1A 423460472 423462692 2220 True 3229 3229 92.908 700 2923 1 chr1A.!!$R8 2223
9 TraesCS1A01G237400 chr1A 424390716 424394617 3901 False 2127 3072 92.380 1 2915 2 chr1A.!!$F3 2914
10 TraesCS1A01G237400 chr1A 423143603 423144467 864 True 1158 1158 91.098 3 854 1 chr1A.!!$R2 851
11 TraesCS1A01G237400 chr1A 423084920 423085783 863 True 1136 1136 90.625 3 854 1 chr1A.!!$R1 851
12 TraesCS1A01G237400 chr1A 423269292 423270124 832 True 1094 1094 90.636 35 854 1 chr1A.!!$R6 819
13 TraesCS1A01G237400 chr1A 423207415 423208267 852 True 1059 1059 89.236 3 854 1 chr1A.!!$R4 851
14 TraesCS1A01G237400 chr1B 435811513 435813595 2082 False 2532 2532 88.995 1 2040 1 chr1B.!!$F1 2039

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
274 278 1.202794 TCATGGAGAGCAGCACACAAA 60.203 47.619 0.00 0.0 0.0 2.83 F
903 1944 4.920927 CACGGCGAATTGTAAAAAGGAAAT 59.079 37.500 16.62 0.0 0.0 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1870 2940 2.173433 TGCATTCGCAGTGACCATG 58.827 52.632 0.0 0.0 45.36 3.66 R
2400 3473 1.070134 TGCAGCTCGTTAGTTTCCAGT 59.930 47.619 0.0 0.0 0.00 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 1.219724 AGGGATAGGCCTCCGTCTAAA 59.780 52.381 9.68 0.0 36.05 1.85
200 201 2.713976 CGAACGCAACACTGAAATTCAC 59.286 45.455 0.00 0.0 0.00 3.18
201 202 3.546020 CGAACGCAACACTGAAATTCACT 60.546 43.478 0.00 0.0 0.00 3.41
274 278 1.202794 TCATGGAGAGCAGCACACAAA 60.203 47.619 0.00 0.0 0.00 2.83
421 452 6.150976 CCAAATGAAACCTGCATAGTTGACTA 59.849 38.462 3.25 0.0 0.00 2.59
521 557 5.569059 GTCTTGTTCAAAAATCATAGGTGCG 59.431 40.000 0.00 0.0 0.00 5.34
638 684 8.185505 TGTAATTTTGGAGCGAATAAATACCAC 58.814 33.333 0.00 0.0 0.00 4.16
855 901 6.444816 ACCTATAGGATATTCCATGATGTGCA 59.555 38.462 26.01 0.0 39.61 4.57
903 1944 4.920927 CACGGCGAATTGTAAAAAGGAAAT 59.079 37.500 16.62 0.0 0.00 2.17
1015 2057 8.885722 CAAAGTAGTACAAGTCTAAACCAAACA 58.114 33.333 2.52 0.0 0.00 2.83
1471 2539 7.906527 CGTTCGTCCCCTTATTTAAAAGTTATG 59.093 37.037 0.00 0.0 0.00 1.90
2400 3473 6.440010 ACCAATGGTCCATCAAACATATTCAA 59.560 34.615 4.39 0.0 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 1.684248 GGGCTTGAGACCAATGCAGAT 60.684 52.381 0.00 0.0 44.76 2.90
85 86 0.107703 GATGATCTTGGCACGGTCCA 60.108 55.000 1.42 0.0 0.00 4.02
164 165 0.166814 GTTCGTTGAGCAGATGCACC 59.833 55.000 7.68 0.0 45.16 5.01
274 278 2.679837 CGAGCATGTGTAAGCCAAGAAT 59.320 45.455 0.00 0.0 0.00 2.40
494 530 6.578545 CACCTATGATTTTTGAACAAGACACG 59.421 38.462 0.00 0.0 0.00 4.49
903 1944 1.614996 TTCATTCCTGCTTTGGCGAA 58.385 45.000 0.00 0.0 42.25 4.70
1015 2057 7.451877 TGTTTAGTGTTCTCTTCTCCTATGTCT 59.548 37.037 0.00 0.0 0.00 3.41
1471 2539 5.658468 AGGTTTAAAGTACTATGAGGCGTC 58.342 41.667 0.00 0.0 0.00 5.19
1507 2575 3.766051 ACCTCTTTCTTTCCATGCCATTC 59.234 43.478 0.00 0.0 0.00 2.67
1870 2940 2.173433 TGCATTCGCAGTGACCATG 58.827 52.632 0.00 0.0 45.36 3.66
1897 2967 6.899393 TTCTTGGTCATTTTCTTGCTACAT 57.101 33.333 0.00 0.0 0.00 2.29
2400 3473 1.070134 TGCAGCTCGTTAGTTTCCAGT 59.930 47.619 0.00 0.0 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.