Multiple sequence alignment - TraesCS1A01G234000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G234000 chr1A 100.000 2237 0 0 1 2237 409610518 409612754 0 4132
1 TraesCS1A01G234000 chr2A 98.972 2237 22 1 1 2237 374484958 374487193 0 4002
2 TraesCS1A01G234000 chr2A 98.704 2237 27 2 1 2237 628571090 628573324 0 3969
3 TraesCS1A01G234000 chr2A 98.704 2237 28 1 1 2237 628646929 628644694 0 3969
4 TraesCS1A01G234000 chr2A 98.391 2237 30 2 1 2237 161528154 161530384 0 3927
5 TraesCS1A01G234000 chr1B 98.078 2237 43 0 1 2237 530762841 530760605 0 3893
6 TraesCS1A01G234000 chr1B 97.810 2237 45 2 1 2237 95493325 95495557 0 3856
7 TraesCS1A01G234000 chr2B 97.588 2239 48 3 1 2237 424683733 424681499 0 3831
8 TraesCS1A01G234000 chr2B 95.483 2258 71 7 1 2237 244702703 244704950 0 3576
9 TraesCS1A01G234000 chr6A 98.288 2161 37 0 77 2237 610981354 610983514 0 3786
10 TraesCS1A01G234000 chr7D 96.970 2244 57 3 1 2237 474678229 474680468 0 3757


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G234000 chr1A 409610518 409612754 2236 False 4132 4132 100.000 1 2237 1 chr1A.!!$F1 2236
1 TraesCS1A01G234000 chr2A 374484958 374487193 2235 False 4002 4002 98.972 1 2237 1 chr2A.!!$F2 2236
2 TraesCS1A01G234000 chr2A 628571090 628573324 2234 False 3969 3969 98.704 1 2237 1 chr2A.!!$F3 2236
3 TraesCS1A01G234000 chr2A 628644694 628646929 2235 True 3969 3969 98.704 1 2237 1 chr2A.!!$R1 2236
4 TraesCS1A01G234000 chr2A 161528154 161530384 2230 False 3927 3927 98.391 1 2237 1 chr2A.!!$F1 2236
5 TraesCS1A01G234000 chr1B 530760605 530762841 2236 True 3893 3893 98.078 1 2237 1 chr1B.!!$R1 2236
6 TraesCS1A01G234000 chr1B 95493325 95495557 2232 False 3856 3856 97.810 1 2237 1 chr1B.!!$F1 2236
7 TraesCS1A01G234000 chr2B 424681499 424683733 2234 True 3831 3831 97.588 1 2237 1 chr2B.!!$R1 2236
8 TraesCS1A01G234000 chr2B 244702703 244704950 2247 False 3576 3576 95.483 1 2237 1 chr2B.!!$F1 2236
9 TraesCS1A01G234000 chr6A 610981354 610983514 2160 False 3786 3786 98.288 77 2237 1 chr6A.!!$F1 2160
10 TraesCS1A01G234000 chr7D 474678229 474680468 2239 False 3757 3757 96.970 1 2237 1 chr7D.!!$F1 2236

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
401 402 1.080366 CGTTTCATGGGACGACCGA 60.08 57.895 14.06 0.0 44.64 4.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2133 2169 0.401738 CTGGACCACAGGGACAACAT 59.598 55.0 0.0 0.0 43.7 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 309 6.722129 AGAATCCTTATGCTAGGTACGAGAAT 59.278 38.462 0.00 0.0 36.63 2.40
381 382 5.316167 TCAAAGAGATAAGGAAGCAAAGCA 58.684 37.500 0.00 0.0 0.00 3.91
401 402 1.080366 CGTTTCATGGGACGACCGA 60.080 57.895 14.06 0.0 44.64 4.69
712 727 2.292828 ACTTGTAGGCCAAACTGCAT 57.707 45.000 5.01 0.0 33.12 3.96
853 868 1.556911 GAGGAGAAAGGGTGCAGATCA 59.443 52.381 0.00 0.0 0.00 2.92
1463 1489 9.708092 TTTTTCAAATGATTGCTTGATGTATCA 57.292 25.926 0.00 0.0 36.45 2.15
2074 2103 4.871933 TTGTCACTTCAGTCTGCATCTA 57.128 40.909 0.00 0.0 0.00 1.98
2181 2217 2.639065 GGGACTAACCGAATGCATGAA 58.361 47.619 0.00 0.0 40.11 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
381 382 1.375523 GGTCGTCCCATGAAACGCT 60.376 57.895 13.08 0.00 38.72 5.07
401 402 0.176680 CCGCTAGAATCCTGCACTGT 59.823 55.000 0.00 0.00 0.00 3.55
490 505 9.524106 CAAGAAAATGATATTAGAGCATGCAAA 57.476 29.630 21.98 11.43 33.38 3.68
712 727 9.310449 GATAGAGGTGAAGTTATATGTCCCTTA 57.690 37.037 0.00 0.00 0.00 2.69
853 868 5.643777 CGTAAACCTCCTCAACATCTTCATT 59.356 40.000 0.00 0.00 0.00 2.57
1463 1489 2.128771 AGCACTTGTCAACCTGTGTT 57.871 45.000 5.60 0.00 34.14 3.32
2074 2103 7.094075 ACAACAATTCTCATGCAGTAATGACAT 60.094 33.333 0.00 0.00 33.08 3.06
2133 2169 0.401738 CTGGACCACAGGGACAACAT 59.598 55.000 0.00 0.00 43.70 2.71
2181 2217 1.094785 GTATGCAATCCACGCCACTT 58.905 50.000 0.00 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.