Multiple sequence alignment - TraesCS1A01G231300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G231300 chr1A 100.000 3803 0 0 1 3803 404152300 404156102 0 7023
1 TraesCS1A01G231300 chr3A 99.132 3804 30 3 1 3803 609273617 609269816 0 6839
2 TraesCS1A01G231300 chr5A 99.106 3804 33 1 1 3803 34742400 34738597 0 6835
3 TraesCS1A01G231300 chr2B 99.080 3804 34 1 1 3803 105309259 105313062 0 6830
4 TraesCS1A01G231300 chr4B 99.054 3804 34 2 1 3803 317553960 317550158 0 6824
5 TraesCS1A01G231300 chr4A 99.054 3804 34 2 1 3803 246189 242387 0 6824
6 TraesCS1A01G231300 chr4A 99.054 3804 34 2 1 3803 507762623 507766425 0 6824
7 TraesCS1A01G231300 chr1B 99.054 3804 35 1 1 3803 533679088 533682891 0 6824
8 TraesCS1A01G231300 chr3B 99.028 3805 35 2 1 3803 733319861 733323665 0 6820
9 TraesCS1A01G231300 chr7B 99.027 3804 36 1 1 3803 734022740 734018937 0 6818


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G231300 chr1A 404152300 404156102 3802 False 7023 7023 100.000 1 3803 1 chr1A.!!$F1 3802
1 TraesCS1A01G231300 chr3A 609269816 609273617 3801 True 6839 6839 99.132 1 3803 1 chr3A.!!$R1 3802
2 TraesCS1A01G231300 chr5A 34738597 34742400 3803 True 6835 6835 99.106 1 3803 1 chr5A.!!$R1 3802
3 TraesCS1A01G231300 chr2B 105309259 105313062 3803 False 6830 6830 99.080 1 3803 1 chr2B.!!$F1 3802
4 TraesCS1A01G231300 chr4B 317550158 317553960 3802 True 6824 6824 99.054 1 3803 1 chr4B.!!$R1 3802
5 TraesCS1A01G231300 chr4A 242387 246189 3802 True 6824 6824 99.054 1 3803 1 chr4A.!!$R1 3802
6 TraesCS1A01G231300 chr4A 507762623 507766425 3802 False 6824 6824 99.054 1 3803 1 chr4A.!!$F1 3802
7 TraesCS1A01G231300 chr1B 533679088 533682891 3803 False 6824 6824 99.054 1 3803 1 chr1B.!!$F1 3802
8 TraesCS1A01G231300 chr3B 733319861 733323665 3804 False 6820 6820 99.028 1 3803 1 chr3B.!!$F1 3802
9 TraesCS1A01G231300 chr7B 734018937 734022740 3803 True 6818 6818 99.027 1 3803 1 chr7B.!!$R1 3802

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
555 556 1.191489 TGATCTCGGGGTTGAGTGCA 61.191 55.0 0.00 0.00 37.28 4.57 F
1815 1817 0.103208 CTATGGAGAAGCGGCGTCTT 59.897 55.0 19.12 12.57 0.00 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2407 2409 0.032403 ACGTGCTTGCCGTACTTACA 59.968 50.0 7.2 0.0 36.65 2.41 R
3698 3702 1.305219 CCAGTTGGCATGTACACCCG 61.305 60.0 0.0 0.0 0.00 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
513 514 2.067091 AACAACGACTCGGAGCGACA 62.067 55.000 22.23 0.00 0.00 4.35
555 556 1.191489 TGATCTCGGGGTTGAGTGCA 61.191 55.000 0.00 0.00 37.28 4.57
1204 1206 2.587753 CAACACCGCCAGTCGTGT 60.588 61.111 0.00 0.00 35.22 4.49
1270 1272 2.195741 CATCCCTATGCCACTGGATG 57.804 55.000 0.00 3.23 45.86 3.51
1455 1457 0.883833 CGGAGAAGCCAAGTTGCAAT 59.116 50.000 0.59 0.00 35.94 3.56
1547 1549 4.319177 GAGGTGCGAAATATTATCAGCCT 58.681 43.478 8.93 5.67 0.00 4.58
1815 1817 0.103208 CTATGGAGAAGCGGCGTCTT 59.897 55.000 19.12 12.57 0.00 3.01
2071 2073 0.462581 CAAGATCTTGGGCAGCGCTA 60.463 55.000 25.14 1.85 36.95 4.26
2511 2513 1.888638 CGCCATCCATCACATGCGA 60.889 57.895 0.00 0.00 0.00 5.10
2627 2629 4.520492 ACAAGAATTCTTTCGCATCCAGTT 59.480 37.500 18.16 0.00 36.93 3.16
2996 2998 9.161629 CTTATGTATTGTCTGTGAATTGGTACA 57.838 33.333 0.00 0.00 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
424 425 0.963856 TCTTGAACCTCTCGCGCCTA 60.964 55.000 0.00 0.0 0.00 3.93
513 514 2.676471 GGCACAAGGGCGGTGATT 60.676 61.111 6.74 0.0 38.54 2.57
1547 1549 1.581934 CGCCTTCTTGAGTGTGTTGA 58.418 50.000 0.00 0.0 0.00 3.18
1798 1800 0.103208 CTAAGACGCCGCTTCTCCAT 59.897 55.000 0.00 0.0 0.00 3.41
1815 1817 3.898123 GGTATGCCACATCCTTCTCTCTA 59.102 47.826 0.00 0.0 34.09 2.43
2407 2409 0.032403 ACGTGCTTGCCGTACTTACA 59.968 50.000 7.20 0.0 36.65 2.41
2511 2513 1.793134 GATGGTCCCGTACGATCGCT 61.793 60.000 18.76 5.2 34.21 4.93
2627 2629 2.091541 GGATGATTTCCGCAAACTCCA 58.908 47.619 0.00 0.0 33.93 3.86
3698 3702 1.305219 CCAGTTGGCATGTACACCCG 61.305 60.000 0.00 0.0 0.00 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.