Multiple sequence alignment - TraesCS1A01G199800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G199800 chr1A 100.000 2399 0 0 1 2399 359190690 359193088 0.000000e+00 4431
1 TraesCS1A01G199800 chr1A 97.543 2401 55 3 1 2399 181970719 181968321 0.000000e+00 4104
2 TraesCS1A01G199800 chr1A 96.833 2400 58 6 1 2399 579041649 579039267 0.000000e+00 3995
3 TraesCS1A01G199800 chr1A 96.922 2339 55 5 62 2399 67962183 67959861 0.000000e+00 3904
4 TraesCS1A01G199800 chr3A 98.041 2399 46 1 1 2399 171150131 171152528 0.000000e+00 4169
5 TraesCS1A01G199800 chr3A 97.375 2400 60 3 1 2399 545676421 545674024 0.000000e+00 4080
6 TraesCS1A01G199800 chr3A 97.126 2401 48 9 1 2399 58078400 58076019 0.000000e+00 4032
7 TraesCS1A01G199800 chr3A 97.564 1806 41 3 594 2399 122115255 122117057 0.000000e+00 3088
8 TraesCS1A01G199800 chr3A 96.849 1809 53 2 594 2399 48905594 48907401 0.000000e+00 3022
9 TraesCS1A01G199800 chr3A 98.438 64 1 0 1 64 373433552 373433615 1.950000e-21 113
10 TraesCS1A01G199800 chr7A 96.680 1807 56 3 594 2399 723589399 723591202 0.000000e+00 3001
11 TraesCS1A01G199800 chr5B 97.005 601 14 3 1801 2399 62546942 62547540 0.000000e+00 1007
12 TraesCS1A01G199800 chr4D 95.984 498 16 2 62 559 446550868 446550375 0.000000e+00 806
13 TraesCS1A01G199800 chr4D 95.783 498 17 2 62 559 99934868 99935361 0.000000e+00 800
14 TraesCS1A01G199800 chr4D 100.000 64 0 0 1 64 99934204 99934267 4.190000e-23 119
15 TraesCS1A01G199800 chr4D 98.438 64 1 0 1 64 446551531 446551468 1.950000e-21 113
16 TraesCS1A01G199800 chr1D 95.984 498 17 2 62 559 308936650 308937144 0.000000e+00 806
17 TraesCS1A01G199800 chr1D 98.438 64 1 0 1 64 308935983 308936046 1.950000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G199800 chr1A 359190690 359193088 2398 False 4431.0 4431 100.0000 1 2399 1 chr1A.!!$F1 2398
1 TraesCS1A01G199800 chr1A 181968321 181970719 2398 True 4104.0 4104 97.5430 1 2399 1 chr1A.!!$R2 2398
2 TraesCS1A01G199800 chr1A 579039267 579041649 2382 True 3995.0 3995 96.8330 1 2399 1 chr1A.!!$R3 2398
3 TraesCS1A01G199800 chr1A 67959861 67962183 2322 True 3904.0 3904 96.9220 62 2399 1 chr1A.!!$R1 2337
4 TraesCS1A01G199800 chr3A 171150131 171152528 2397 False 4169.0 4169 98.0410 1 2399 1 chr3A.!!$F3 2398
5 TraesCS1A01G199800 chr3A 545674024 545676421 2397 True 4080.0 4080 97.3750 1 2399 1 chr3A.!!$R2 2398
6 TraesCS1A01G199800 chr3A 58076019 58078400 2381 True 4032.0 4032 97.1260 1 2399 1 chr3A.!!$R1 2398
7 TraesCS1A01G199800 chr3A 122115255 122117057 1802 False 3088.0 3088 97.5640 594 2399 1 chr3A.!!$F2 1805
8 TraesCS1A01G199800 chr3A 48905594 48907401 1807 False 3022.0 3022 96.8490 594 2399 1 chr3A.!!$F1 1805
9 TraesCS1A01G199800 chr7A 723589399 723591202 1803 False 3001.0 3001 96.6800 594 2399 1 chr7A.!!$F1 1805
10 TraesCS1A01G199800 chr5B 62546942 62547540 598 False 1007.0 1007 97.0050 1801 2399 1 chr5B.!!$F1 598
11 TraesCS1A01G199800 chr4D 99934204 99935361 1157 False 459.5 800 97.8915 1 559 2 chr4D.!!$F1 558
12 TraesCS1A01G199800 chr4D 446550375 446551531 1156 True 459.5 806 97.2110 1 559 2 chr4D.!!$R1 558
13 TraesCS1A01G199800 chr1D 308935983 308937144 1161 False 459.5 806 97.2110 1 559 2 chr1D.!!$F1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
638 1245 1.003112 GGTGACCGGTGTTATGGCA 60.003 57.895 14.63 0.0 0.0 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2324 2935 3.341823 AGATGCAGCCTTTTACAGTCTG 58.658 45.455 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
369 976 3.869272 GTGCCCGAAGCTGATGCG 61.869 66.667 0.00 0.00 45.42 4.73
482 1089 4.040461 GCCATCCACTTTATAGCTGGACTA 59.960 45.833 0.00 0.00 35.69 2.59
638 1245 1.003112 GGTGACCGGTGTTATGGCA 60.003 57.895 14.63 0.00 0.00 4.92
711 1318 2.212327 CCTACCAGGGAGATTGCGT 58.788 57.895 0.00 0.00 0.00 5.24
967 1574 3.066621 TGTTGAACTGTTTCTGACCATGC 59.933 43.478 0.00 0.00 32.36 4.06
1114 1721 1.021275 ACCCCCTACCCTTACAGCTA 58.979 55.000 0.00 0.00 0.00 3.32
1363 1970 4.996758 GCTGGATGTGTTTTGCCTTAATTT 59.003 37.500 0.00 0.00 0.00 1.82
1632 2240 6.329496 GTTGGTTTCAGAATGTCTGTTTCAA 58.671 36.000 5.23 4.35 44.58 2.69
1633 2241 6.713762 TGGTTTCAGAATGTCTGTTTCAAT 57.286 33.333 5.23 0.00 44.58 2.57
1699 2307 4.069312 TGGTTTCTATGTACTCCCTCCA 57.931 45.455 0.00 0.00 0.00 3.86
1731 2339 6.899393 AGCCAAGACACTTATTTTTGATCA 57.101 33.333 0.00 0.00 0.00 2.92
1918 2526 5.047802 CCTCATTGGCTACTGTTTGATGTTT 60.048 40.000 0.00 0.00 0.00 2.83
2057 2667 5.071370 TGTAGGCAGTAGTAGGCTTATCTC 58.929 45.833 0.00 0.00 42.39 2.75
2265 2875 7.872163 TCAATTTTGTGATAAGCATGACAAC 57.128 32.000 0.00 0.00 0.00 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
97 704 8.453238 TGTACAACAACAATACCAACTAACAT 57.547 30.769 0.00 0.0 0.00 2.71
255 862 3.455990 TCATGCATGCAAAAGTGTGTT 57.544 38.095 26.68 0.8 0.00 3.32
369 976 1.237285 AACATCAGTCACTTGCCGCC 61.237 55.000 0.00 0.0 0.00 6.13
638 1245 1.366366 GTCACCACCGTACACAGCT 59.634 57.895 0.00 0.0 0.00 4.24
711 1318 1.856259 AGATGAGAGAGGGACCTGCTA 59.144 52.381 0.00 0.0 0.00 3.49
1038 1645 1.220206 CTCCGTGCTCCTCTTGCAT 59.780 57.895 0.00 0.0 42.69 3.96
1114 1721 0.746563 CAACCCACACCACACGAACT 60.747 55.000 0.00 0.0 0.00 3.01
1632 2240 9.525826 AAGTTCTTCCATTATCAGAAAAGACAT 57.474 29.630 0.00 0.0 0.00 3.06
1633 2241 8.924511 AAGTTCTTCCATTATCAGAAAAGACA 57.075 30.769 0.00 0.0 0.00 3.41
1731 2339 5.221541 GCTATTACAAGCATGTACTCCCTCT 60.222 44.000 0.32 0.0 41.64 3.69
1962 2572 4.098914 ACTTGGATTTGCACTTCACCTA 57.901 40.909 0.00 0.0 0.00 3.08
2057 2667 6.755141 ACAAACATTACAGTATACTACAGCCG 59.245 38.462 4.74 0.0 0.00 5.52
2324 2935 3.341823 AGATGCAGCCTTTTACAGTCTG 58.658 45.455 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.