Multiple sequence alignment - TraesCS1A01G195600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G195600 chr1A 100.000 2282 0 0 1 2282 353278864 353281145 0.000000e+00 4215
1 TraesCS1A01G195600 chr1A 98.207 1450 26 0 1 1450 97260641 97262090 0.000000e+00 2534
2 TraesCS1A01G195600 chr1A 97.241 1450 40 0 1 1450 563187055 563185606 0.000000e+00 2457
3 TraesCS1A01G195600 chr2A 97.931 1450 30 0 1 1450 702408803 702410252 0.000000e+00 2512
4 TraesCS1A01G195600 chr2A 97.596 832 20 0 1451 2282 357262341 357261510 0.000000e+00 1426
5 TraesCS1A01G195600 chr7A 96.621 1450 42 3 1 1450 707969989 707971431 0.000000e+00 2399
6 TraesCS1A01G195600 chr7A 97.837 832 18 0 1451 2282 481522630 481523461 0.000000e+00 1437
7 TraesCS1A01G195600 chr7A 97.716 832 19 0 1451 2282 169069219 169068388 0.000000e+00 1432
8 TraesCS1A01G195600 chr7A 97.596 832 20 0 1451 2282 265262346 265261515 0.000000e+00 1426
9 TraesCS1A01G195600 chr7A 97.596 832 20 0 1451 2282 450426710 450425879 0.000000e+00 1426
10 TraesCS1A01G195600 chr7D 95.361 927 43 0 1 927 41370513 41371439 0.000000e+00 1474
11 TraesCS1A01G195600 chr7D 92.341 927 51 10 2 927 449771211 449770304 0.000000e+00 1301
12 TraesCS1A01G195600 chr7D 88.783 526 55 3 925 1446 123493727 123493202 1.910000e-180 641
13 TraesCS1A01G195600 chr3A 97.957 832 16 1 1451 2282 594874952 594875782 0.000000e+00 1441
14 TraesCS1A01G195600 chr3A 97.837 832 18 0 1451 2282 300607454 300608285 0.000000e+00 1437
15 TraesCS1A01G195600 chr6A 97.716 832 19 0 1451 2282 562730408 562729577 0.000000e+00 1432
16 TraesCS1A01G195600 chr6A 94.118 527 28 3 925 1450 610216012 610216536 0.000000e+00 798
17 TraesCS1A01G195600 chr4A 97.716 832 19 0 1451 2282 68979892 68980723 0.000000e+00 1432
18 TraesCS1A01G195600 chr5D 92.125 927 53 10 2 927 354746407 354745500 0.000000e+00 1290
19 TraesCS1A01G195600 chr5D 92.017 927 54 10 2 927 547843948 547844855 0.000000e+00 1284
20 TraesCS1A01G195600 chr1D 92.125 927 53 10 2 927 417749276 417748369 0.000000e+00 1290
21 TraesCS1A01G195600 chr5A 91.361 926 59 11 3 927 476065898 476064993 0.000000e+00 1247
22 TraesCS1A01G195600 chr6B 88.636 528 52 6 927 1451 647587301 647586779 8.890000e-179 636
23 TraesCS1A01G195600 chr2D 88.324 531 58 4 925 1452 19527764 19527235 3.200000e-178 634
24 TraesCS1A01G195600 chr2B 87.594 532 64 2 921 1452 702712246 702711717 1.160000e-172 616


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G195600 chr1A 353278864 353281145 2281 False 4215 4215 100.000 1 2282 1 chr1A.!!$F2 2281
1 TraesCS1A01G195600 chr1A 97260641 97262090 1449 False 2534 2534 98.207 1 1450 1 chr1A.!!$F1 1449
2 TraesCS1A01G195600 chr1A 563185606 563187055 1449 True 2457 2457 97.241 1 1450 1 chr1A.!!$R1 1449
3 TraesCS1A01G195600 chr2A 702408803 702410252 1449 False 2512 2512 97.931 1 1450 1 chr2A.!!$F1 1449
4 TraesCS1A01G195600 chr2A 357261510 357262341 831 True 1426 1426 97.596 1451 2282 1 chr2A.!!$R1 831
5 TraesCS1A01G195600 chr7A 707969989 707971431 1442 False 2399 2399 96.621 1 1450 1 chr7A.!!$F2 1449
6 TraesCS1A01G195600 chr7A 481522630 481523461 831 False 1437 1437 97.837 1451 2282 1 chr7A.!!$F1 831
7 TraesCS1A01G195600 chr7A 169068388 169069219 831 True 1432 1432 97.716 1451 2282 1 chr7A.!!$R1 831
8 TraesCS1A01G195600 chr7A 265261515 265262346 831 True 1426 1426 97.596 1451 2282 1 chr7A.!!$R2 831
9 TraesCS1A01G195600 chr7A 450425879 450426710 831 True 1426 1426 97.596 1451 2282 1 chr7A.!!$R3 831
10 TraesCS1A01G195600 chr7D 41370513 41371439 926 False 1474 1474 95.361 1 927 1 chr7D.!!$F1 926
11 TraesCS1A01G195600 chr7D 449770304 449771211 907 True 1301 1301 92.341 2 927 1 chr7D.!!$R2 925
12 TraesCS1A01G195600 chr7D 123493202 123493727 525 True 641 641 88.783 925 1446 1 chr7D.!!$R1 521
13 TraesCS1A01G195600 chr3A 594874952 594875782 830 False 1441 1441 97.957 1451 2282 1 chr3A.!!$F2 831
14 TraesCS1A01G195600 chr3A 300607454 300608285 831 False 1437 1437 97.837 1451 2282 1 chr3A.!!$F1 831
15 TraesCS1A01G195600 chr6A 562729577 562730408 831 True 1432 1432 97.716 1451 2282 1 chr6A.!!$R1 831
16 TraesCS1A01G195600 chr6A 610216012 610216536 524 False 798 798 94.118 925 1450 1 chr6A.!!$F1 525
17 TraesCS1A01G195600 chr4A 68979892 68980723 831 False 1432 1432 97.716 1451 2282 1 chr4A.!!$F1 831
18 TraesCS1A01G195600 chr5D 354745500 354746407 907 True 1290 1290 92.125 2 927 1 chr5D.!!$R1 925
19 TraesCS1A01G195600 chr5D 547843948 547844855 907 False 1284 1284 92.017 2 927 1 chr5D.!!$F1 925
20 TraesCS1A01G195600 chr1D 417748369 417749276 907 True 1290 1290 92.125 2 927 1 chr1D.!!$R1 925
21 TraesCS1A01G195600 chr5A 476064993 476065898 905 True 1247 1247 91.361 3 927 1 chr5A.!!$R1 924
22 TraesCS1A01G195600 chr6B 647586779 647587301 522 True 636 636 88.636 927 1451 1 chr6B.!!$R1 524
23 TraesCS1A01G195600 chr2D 19527235 19527764 529 True 634 634 88.324 925 1452 1 chr2D.!!$R1 527
24 TraesCS1A01G195600 chr2B 702711717 702712246 529 True 616 616 87.594 921 1452 1 chr2B.!!$R1 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
244 246 0.825425 TTTGGCCGTTCCTTGATGCA 60.825 50.000 0.0 0.0 35.26 3.96 F
551 553 3.217608 CAACATCGACGACAACAATGTG 58.782 45.455 0.0 0.0 40.74 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1094 1096 0.684535 TCTTTCAGCCGATGTGACCA 59.315 50.0 0.00 0.0 0.00 4.02 R
1551 1559 1.128200 AACAGCACGGGCCATCTATA 58.872 50.0 5.73 0.0 42.56 1.31 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 5.073311 TCCTAATACAGTTCACAGCTGAC 57.927 43.478 23.35 8.49 37.40 3.51
244 246 0.825425 TTTGGCCGTTCCTTGATGCA 60.825 50.000 0.00 0.00 35.26 3.96
310 312 3.445096 GGATTGTGTTTTAGCATGCCTCT 59.555 43.478 15.66 0.00 0.00 3.69
420 422 4.566759 TGCACAGATATTTCAAGCGTACTC 59.433 41.667 0.00 0.00 0.00 2.59
439 441 4.091549 ACTCCCACTACTTCGATAAACCA 58.908 43.478 0.00 0.00 0.00 3.67
551 553 3.217608 CAACATCGACGACAACAATGTG 58.782 45.455 0.00 0.00 40.74 3.21
581 583 7.363880 GGCTCCGAGAATATAGGTAATTCATCA 60.364 40.741 0.00 0.00 36.09 3.07
808 810 8.985315 TTAAGCAATGGAGAGAAACATGATAT 57.015 30.769 0.00 0.00 0.00 1.63
1094 1096 5.297776 GCATCTTATTTACTGTGCCTGTGAT 59.702 40.000 0.00 0.00 0.00 3.06
1635 1643 8.408601 GTTGAAAGATGATGGTAGCAATTACAT 58.591 33.333 0.00 3.05 33.73 2.29
2061 2069 4.931601 TGACAGAATTCTCCAATCACTTCG 59.068 41.667 4.57 0.00 0.00 3.79
2253 2261 4.731313 AGGGGAACTTCAAGAAGAACAT 57.269 40.909 16.16 0.33 40.79 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 1.699752 AGGGCCCCCTGAATTGAAG 59.300 57.895 21.43 0.0 46.22 3.02
310 312 6.100279 ACCTGATGCATACTTCCTATTTCTCA 59.900 38.462 0.00 0.0 0.00 3.27
420 422 4.189231 CCTTGGTTTATCGAAGTAGTGGG 58.811 47.826 0.00 0.0 31.40 4.61
439 441 2.501723 ACTATCGCCAACTCATCACCTT 59.498 45.455 0.00 0.0 0.00 3.50
524 526 0.386113 TGTCGTCGATGTTGGTGTCA 59.614 50.000 4.21 0.0 0.00 3.58
551 553 3.158676 ACCTATATTCTCGGAGCCACTC 58.841 50.000 0.00 0.0 0.00 3.51
581 583 2.636893 AGGAGACTGTTCTTGTGCATCT 59.363 45.455 0.00 0.0 41.13 2.90
808 810 8.956426 CACCTTCTGAATAAACTAGCCATTTTA 58.044 33.333 0.00 0.0 0.00 1.52
1094 1096 0.684535 TCTTTCAGCCGATGTGACCA 59.315 50.000 0.00 0.0 0.00 4.02
1551 1559 1.128200 AACAGCACGGGCCATCTATA 58.872 50.000 5.73 0.0 42.56 1.31
1978 1986 8.094548 TGAATCAAGTGATTATTATACCCGGAG 58.905 37.037 0.73 0.0 44.14 4.63
1981 1989 9.273016 AGTTGAATCAAGTGATTATTATACCCG 57.727 33.333 6.52 0.0 44.14 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.