Multiple sequence alignment - TraesCS1A01G181300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G181300 chr1A 100.000 2425 0 0 1 2425 327384346 327381922 0.000000e+00 4479
1 TraesCS1A01G181300 chr1A 96.787 2428 70 6 1 2425 335871314 335873736 0.000000e+00 4045
2 TraesCS1A01G181300 chr1A 96.230 1671 58 3 757 2425 335905867 335907534 0.000000e+00 2732
3 TraesCS1A01G181300 chr1A 97.388 689 16 2 1 687 335905181 335905869 0.000000e+00 1171
4 TraesCS1A01G181300 chr2A 91.783 1643 111 3 712 2331 347862158 347863799 0.000000e+00 2265
5 TraesCS1A01G181300 chr7B 91.433 1424 95 5 957 2356 530664815 530666235 0.000000e+00 1929
6 TraesCS1A01G181300 chr7B 94.744 723 25 6 1 714 345988337 345989055 0.000000e+00 1112
7 TraesCS1A01G181300 chr7B 93.610 579 32 5 712 1289 336259342 336259916 0.000000e+00 859
8 TraesCS1A01G181300 chr7B 95.026 382 17 2 334 714 336259002 336259382 1.240000e-167 599
9 TraesCS1A01G181300 chr1D 96.897 1128 33 2 364 1489 93820796 93821923 0.000000e+00 1888
10 TraesCS1A01G181300 chr1D 97.273 550 15 0 1395 1944 93821922 93822471 0.000000e+00 933
11 TraesCS1A01G181300 chr1D 98.485 462 7 0 1 462 93820351 93820812 0.000000e+00 815
12 TraesCS1A01G181300 chr1D 97.368 418 10 1 1939 2356 93831322 93831738 0.000000e+00 710
13 TraesCS1A01G181300 chr1D 98.485 66 1 0 2359 2424 174150675 174150740 1.520000e-22 117
14 TraesCS1A01G181300 chr7A 90.162 1108 100 5 712 1814 354945785 354946888 0.000000e+00 1434
15 TraesCS1A01G181300 chr7A 93.223 723 36 7 1 714 354945108 354945826 0.000000e+00 1051
16 TraesCS1A01G181300 chr7A 90.203 541 31 1 1838 2356 354946881 354947421 0.000000e+00 686
17 TraesCS1A01G181300 chr2B 94.744 723 28 4 1 714 388578114 388577393 0.000000e+00 1116
18 TraesCS1A01G181300 chr2B 82.237 304 20 15 1765 2042 733164607 733164902 5.210000e-57 231
19 TraesCS1A01G181300 chr2B 95.455 66 3 0 2359 2424 135776868 135776933 3.300000e-19 106
20 TraesCS1A01G181300 chr2B 95.455 66 3 0 2359 2424 135780519 135780584 3.300000e-19 106
21 TraesCS1A01G181300 chr3B 94.053 723 33 4 1 714 648406980 648407701 0.000000e+00 1088
22 TraesCS1A01G181300 chr3B 95.550 382 15 2 334 714 589660388 589660008 5.730000e-171 610
23 TraesCS1A01G181300 chr5B 93.776 723 35 3 1 714 389235591 389236312 0.000000e+00 1077
24 TraesCS1A01G181300 chr5B 93.092 579 35 3 712 1289 22034211 22033637 0.000000e+00 843
25 TraesCS1A01G181300 chr5B 95.373 389 18 0 1341 1729 115862214 115861826 9.520000e-174 619
26 TraesCS1A01G181300 chr5B 95.550 382 15 2 334 714 463404230 463403850 5.730000e-171 610
27 TraesCS1A01G181300 chr5B 93.294 343 19 1 2014 2356 115861830 115861492 1.000000e-138 503
28 TraesCS1A01G181300 chr6B 93.638 723 36 4 1 714 185001062 185001783 0.000000e+00 1072
29 TraesCS1A01G181300 chr6B 94.764 382 17 3 334 714 587741824 587742203 2.080000e-165 592
30 TraesCS1A01G181300 chr6B 84.266 286 33 4 2079 2356 462911189 462911470 3.970000e-68 268
31 TraesCS1A01G181300 chr5A 92.725 701 49 2 712 1411 337891382 337890683 0.000000e+00 1011
32 TraesCS1A01G181300 chr4B 93.987 449 27 0 1281 1729 242921330 242920882 0.000000e+00 680
33 TraesCS1A01G181300 chr4B 91.324 219 15 2 2014 2232 242920886 242920672 1.820000e-76 296
34 TraesCS1A01G181300 chr3D 81.389 360 36 16 1764 2103 266652363 266652711 5.140000e-67 265
35 TraesCS1A01G181300 chr4D 81.818 330 24 15 1764 2067 451039472 451039791 6.700000e-61 244
36 TraesCS1A01G181300 chr4A 80.845 355 30 19 1772 2103 15918902 15918563 6.700000e-61 244
37 TraesCS1A01G181300 chr4A 79.515 371 31 17 1764 2103 682752730 682753086 3.140000e-54 222


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G181300 chr1A 327381922 327384346 2424 True 4479.0 4479 100.000000 1 2425 1 chr1A.!!$R1 2424
1 TraesCS1A01G181300 chr1A 335871314 335873736 2422 False 4045.0 4045 96.787000 1 2425 1 chr1A.!!$F1 2424
2 TraesCS1A01G181300 chr1A 335905181 335907534 2353 False 1951.5 2732 96.809000 1 2425 2 chr1A.!!$F2 2424
3 TraesCS1A01G181300 chr2A 347862158 347863799 1641 False 2265.0 2265 91.783000 712 2331 1 chr2A.!!$F1 1619
4 TraesCS1A01G181300 chr7B 530664815 530666235 1420 False 1929.0 1929 91.433000 957 2356 1 chr7B.!!$F2 1399
5 TraesCS1A01G181300 chr7B 345988337 345989055 718 False 1112.0 1112 94.744000 1 714 1 chr7B.!!$F1 713
6 TraesCS1A01G181300 chr7B 336259002 336259916 914 False 729.0 859 94.318000 334 1289 2 chr7B.!!$F3 955
7 TraesCS1A01G181300 chr1D 93820351 93822471 2120 False 1212.0 1888 97.551667 1 1944 3 chr1D.!!$F3 1943
8 TraesCS1A01G181300 chr7A 354945108 354947421 2313 False 1057.0 1434 91.196000 1 2356 3 chr7A.!!$F1 2355
9 TraesCS1A01G181300 chr2B 388577393 388578114 721 True 1116.0 1116 94.744000 1 714 1 chr2B.!!$R1 713
10 TraesCS1A01G181300 chr3B 648406980 648407701 721 False 1088.0 1088 94.053000 1 714 1 chr3B.!!$F1 713
11 TraesCS1A01G181300 chr5B 389235591 389236312 721 False 1077.0 1077 93.776000 1 714 1 chr5B.!!$F1 713
12 TraesCS1A01G181300 chr5B 22033637 22034211 574 True 843.0 843 93.092000 712 1289 1 chr5B.!!$R1 577
13 TraesCS1A01G181300 chr5B 115861492 115862214 722 True 561.0 619 94.333500 1341 2356 2 chr5B.!!$R3 1015
14 TraesCS1A01G181300 chr6B 185001062 185001783 721 False 1072.0 1072 93.638000 1 714 1 chr6B.!!$F1 713
15 TraesCS1A01G181300 chr5A 337890683 337891382 699 True 1011.0 1011 92.725000 712 1411 1 chr5A.!!$R1 699
16 TraesCS1A01G181300 chr4B 242920672 242921330 658 True 488.0 680 92.655500 1281 2232 2 chr4B.!!$R1 951

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
638 731 2.159653 CCTACAGCGTTGAATCAGTTGC 60.16 50.0 6.16 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2010 2324 0.03392 CCTTTTGGTTGGCAAGCCTC 59.966 55.0 25.02 1.84 34.0 4.7 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
585 678 6.353323 TGTCTTTTATATTGGCTCGGATTGA 58.647 36.000 0.00 0.00 0.00 2.57
638 731 2.159653 CCTACAGCGTTGAATCAGTTGC 60.160 50.000 6.16 0.00 0.00 4.17
689 856 9.213799 AGTCTTGAATTACAGTTTCAGATCTTC 57.786 33.333 0.00 0.00 34.76 2.87
708 875 7.613411 AGATCTTCTTTACTTAGCTTGGCAATT 59.387 33.333 0.00 0.00 0.00 2.32
872 1041 5.437060 TGAACCTGAACTGAAGTTTAGCTT 58.563 37.500 8.97 3.09 39.45 3.74
916 1085 8.996271 AGATACACACACAATGCAGAATATATG 58.004 33.333 0.00 0.00 0.00 1.78
1034 1206 2.421107 GCAGAATGATGGAGAAGGAGCA 60.421 50.000 0.00 0.00 39.69 4.26
1224 1397 4.169271 CGTCCCTCCTATACGCCA 57.831 61.111 0.00 0.00 0.00 5.69
1674 1944 8.506168 TTTCTGTCAGTAGTTTGTTCAATTCT 57.494 30.769 0.00 0.00 0.00 2.40
1701 1971 4.795962 GCTTGGGATTTGTTTGATTGACGT 60.796 41.667 0.00 0.00 0.00 4.34
1956 2270 5.136828 TGATGGTGAGTTATGTGTGGTTTT 58.863 37.500 0.00 0.00 0.00 2.43
1962 2276 5.048991 GTGAGTTATGTGTGGTTTTAGGGTG 60.049 44.000 0.00 0.00 0.00 4.61
2054 2368 7.648112 GGTGGTTCTTTCTTCTGTTAATTGTTC 59.352 37.037 0.00 0.00 0.00 3.18
2340 2654 1.555075 AGCTCGGAGACATTAAGGCAA 59.445 47.619 9.69 0.00 0.00 4.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 148 6.052840 ACTGCAATCTACGCTTATCAAATG 57.947 37.500 0.00 0.00 0.00 2.32
526 618 8.997323 CCATAATGTTGCAAAACAAAAATCCTA 58.003 29.630 0.00 0.00 40.82 2.94
689 856 8.726988 TGTAACTAATTGCCAAGCTAAGTAAAG 58.273 33.333 0.00 0.00 0.00 1.85
872 1041 6.371548 GTGTATCTGTTTGTCAAATGAGGCTA 59.628 38.462 0.40 0.00 0.00 3.93
1224 1397 4.225860 TGGGATCCAGACCAACGT 57.774 55.556 15.23 0.00 32.89 3.99
1644 1914 6.093495 TGAACAAACTACTGACAGAAAACTGG 59.907 38.462 10.08 0.00 0.00 4.00
1674 1944 5.010112 TCAATCAAACAAATCCCAAGCGTAA 59.990 36.000 0.00 0.00 0.00 3.18
1740 2010 4.618378 ATACCTTGGGCATAAAAAGGGA 57.382 40.909 5.72 0.00 44.01 4.20
2010 2324 0.033920 CCTTTTGGTTGGCAAGCCTC 59.966 55.000 25.02 1.84 34.00 4.70


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.