Multiple sequence alignment - TraesCS1A01G172000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G172000 chr1A 100.000 2870 0 0 1 2870 307487505 307484636 0.000000e+00 5301
1 TraesCS1A01G172000 chr3A 98.395 2804 45 0 1 2804 466482836 466480033 0.000000e+00 4929
2 TraesCS1A01G172000 chr3A 98.571 70 1 0 2801 2870 466479911 466479842 1.080000e-24 124
3 TraesCS1A01G172000 chr6A 94.128 2810 139 8 1 2804 171564189 171566978 0.000000e+00 4252
4 TraesCS1A01G172000 chr5D 83.747 2578 398 12 229 2798 453126849 453124285 0.000000e+00 2420
5 TraesCS1A01G172000 chr5D 96.814 1444 43 2 1362 2804 74468499 74469940 0.000000e+00 2409
6 TraesCS1A01G172000 chr5D 83.837 2017 312 9 786 2798 350301069 350303075 0.000000e+00 1906
7 TraesCS1A01G172000 chr1B 83.698 2012 307 16 381 2384 327336369 327334371 0.000000e+00 1879
8 TraesCS1A01G172000 chr1B 80.144 418 83 0 2381 2798 327318353 327317936 2.150000e-81 313
9 TraesCS1A01G172000 chr4A 73.742 636 149 17 1838 2465 68787482 68786857 1.720000e-57 233


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G172000 chr1A 307484636 307487505 2869 True 5301.0 5301 100.000 1 2870 1 chr1A.!!$R1 2869
1 TraesCS1A01G172000 chr3A 466479842 466482836 2994 True 2526.5 4929 98.483 1 2870 2 chr3A.!!$R1 2869
2 TraesCS1A01G172000 chr6A 171564189 171566978 2789 False 4252.0 4252 94.128 1 2804 1 chr6A.!!$F1 2803
3 TraesCS1A01G172000 chr5D 453124285 453126849 2564 True 2420.0 2420 83.747 229 2798 1 chr5D.!!$R1 2569
4 TraesCS1A01G172000 chr5D 74468499 74469940 1441 False 2409.0 2409 96.814 1362 2804 1 chr5D.!!$F1 1442
5 TraesCS1A01G172000 chr5D 350301069 350303075 2006 False 1906.0 1906 83.837 786 2798 1 chr5D.!!$F2 2012
6 TraesCS1A01G172000 chr1B 327334371 327336369 1998 True 1879.0 1879 83.698 381 2384 1 chr1B.!!$R2 2003
7 TraesCS1A01G172000 chr4A 68786857 68787482 625 True 233.0 233 73.742 1838 2465 1 chr4A.!!$R1 627

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
374 376 0.877071 ACTGTTTTGATCCAGCGCAG 59.123 50.0 11.47 0.0 31.76 5.18 F
1214 1220 0.461961 GGCGCCTCTAGTGAAGATGT 59.538 55.0 22.15 0.0 32.41 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1484 1496 5.466728 GCTGTTTCATTAGTCACTTCAGACA 59.533 40.000 0.00 0.0 40.98 3.41 R
2724 2738 3.165071 CCCAAGCTTTTAAGTCCATGGT 58.835 45.455 12.58 0.0 0.00 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 0.885150 GCGAATCCGGAATTCCTCCC 60.885 60.000 22.05 1.89 41.87 4.30
243 244 1.080498 TGACTCACCCCTCCACCTATT 59.920 52.381 0.00 0.00 0.00 1.73
253 254 2.588620 CTCCACCTATTAGCCTCTCGT 58.411 52.381 0.00 0.00 0.00 4.18
374 376 0.877071 ACTGTTTTGATCCAGCGCAG 59.123 50.000 11.47 0.00 31.76 5.18
751 753 2.223782 GCACCAAGCAAGACAATTGACA 60.224 45.455 13.59 0.00 44.79 3.58
991 993 3.265221 TGGAGAGGAAGAACATGAGCAAT 59.735 43.478 0.00 0.00 0.00 3.56
1214 1220 0.461961 GGCGCCTCTAGTGAAGATGT 59.538 55.000 22.15 0.00 32.41 3.06
1787 1799 1.893210 CGGAGAAGAGGAGGGACAAGT 60.893 57.143 0.00 0.00 0.00 3.16
2018 2030 5.929058 TGCAATGGCTCCAACATTTATTA 57.071 34.783 0.00 0.00 41.91 0.98
2386 2399 2.209690 TGTGGACTACATGACCTCGA 57.790 50.000 0.00 0.00 33.42 4.04
2724 2738 5.008613 GTGTCTCAAGGCATCAAAACTGTAA 59.991 40.000 0.00 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 0.163788 GGACACACACGCGAAATCAG 59.836 55.000 15.93 0.00 0.00 2.90
243 244 1.216444 CAGCAAGCACGAGAGGCTA 59.784 57.895 0.00 0.00 41.66 3.93
374 376 2.603021 TGTCTCCTCCCATCTCTATGC 58.397 52.381 0.00 0.00 0.00 3.14
447 449 2.484742 TACCTTTCTTTTCCGCCTCC 57.515 50.000 0.00 0.00 0.00 4.30
751 753 9.535878 GATCGGAATCTTCTTAAACTGATACTT 57.464 33.333 0.00 0.00 0.00 2.24
991 993 4.960332 TCTTCCTCTTCCATCTCCCTTTA 58.040 43.478 0.00 0.00 0.00 1.85
1141 1146 7.256083 CCCAAATTGTCTTTCTTCTCCTTTCAT 60.256 37.037 0.00 0.00 0.00 2.57
1484 1496 5.466728 GCTGTTTCATTAGTCACTTCAGACA 59.533 40.000 0.00 0.00 40.98 3.41
1787 1799 6.389830 TTTCTGCAGATTGTTTTGCTCTAA 57.610 33.333 19.04 0.46 40.87 2.10
2018 2030 7.890127 TCCTTCACTATCATTTTTGACATTCCT 59.110 33.333 0.00 0.00 0.00 3.36
2386 2399 8.325787 TCCATGTATACTTGTCACCAAAATAGT 58.674 33.333 15.41 0.00 0.00 2.12
2724 2738 3.165071 CCCAAGCTTTTAAGTCCATGGT 58.835 45.455 12.58 0.00 0.00 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.