Multiple sequence alignment - TraesCS1A01G166700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G166700 chr1A 100.000 2232 0 0 561 2792 299540153 299542384 0.000000e+00 4122.0
1 TraesCS1A01G166700 chr1A 95.440 614 28 0 561 1174 97423713 97423100 0.000000e+00 979.0
2 TraesCS1A01G166700 chr1A 100.000 226 0 0 1 226 299539593 299539818 4.300000e-113 418.0
3 TraesCS1A01G166700 chr1A 95.197 229 8 1 1 226 97423955 97423727 2.640000e-95 359.0
4 TraesCS1A01G166700 chr1A 96.396 111 4 0 2682 2792 97423109 97422999 1.710000e-42 183.0
5 TraesCS1A01G166700 chr1A 96.703 91 3 0 1 91 97421473 97421563 4.820000e-33 152.0
6 TraesCS1A01G166700 chr1A 95.604 91 4 0 1 91 299543899 299543809 2.240000e-31 147.0
7 TraesCS1A01G166700 chr2A 98.082 2190 40 2 603 2792 102023725 102021538 0.000000e+00 3810.0
8 TraesCS1A01G166700 chr2A 96.491 228 5 2 1 226 102024315 102024089 9.440000e-100 374.0
9 TraesCS1A01G166700 chr2A 96.774 62 1 1 561 621 102023735 102023674 4.920000e-18 102.0
10 TraesCS1A01G166700 chr1D 96.751 1693 54 1 585 2277 50967458 50969149 0.000000e+00 2820.0
11 TraesCS1A01G166700 chr1D 96.286 1050 39 0 1158 2207 51002253 51003302 0.000000e+00 1724.0
12 TraesCS1A01G166700 chr1D 94.850 602 30 1 561 1162 51000313 51000913 0.000000e+00 939.0
13 TraesCS1A01G166700 chr1D 98.635 293 4 0 2500 2792 50969151 50969443 1.150000e-143 520.0
14 TraesCS1A01G166700 chr1D 96.903 226 4 3 1 226 50966979 50967201 2.630000e-100 375.0
15 TraesCS1A01G166700 chr1D 95.794 214 8 1 3 216 51000099 51000311 7.400000e-91 344.0
16 TraesCS1A01G166700 chr1D 98.901 91 1 0 1 91 50970972 50970882 2.230000e-36 163.0
17 TraesCS1A01G166700 chr1D 94.231 52 3 0 570 621 50967476 50967527 2.310000e-11 80.5
18 TraesCS1A01G166700 chr3B 93.638 1336 79 4 835 2165 448751272 448752606 0.000000e+00 1991.0
19 TraesCS1A01G166700 chr3B 87.591 137 11 2 627 763 448751135 448751265 1.340000e-33 154.0
20 TraesCS1A01G166700 chr3B 95.556 90 1 2 4 91 448752943 448752855 1.040000e-29 141.0
21 TraesCS1A01G166700 chr3B 100.000 29 0 0 594 622 448751135 448751163 1.000000e-03 54.7
22 TraesCS1A01G166700 chr7A 81.991 211 13 12 27 226 533036357 533036553 3.720000e-34 156.0
23 TraesCS1A01G166700 chr7A 94.253 87 4 1 1 87 533037397 533037312 6.270000e-27 132.0
24 TraesCS1A01G166700 chr6D 71.074 363 92 12 2240 2593 452314711 452314353 2.980000e-10 76.8
25 TraesCS1A01G166700 chr5B 93.617 47 3 0 2555 2601 260237153 260237107 1.390000e-08 71.3
26 TraesCS1A01G166700 chr2B 93.617 47 3 0 2543 2589 697521724 697521770 1.390000e-08 71.3
27 TraesCS1A01G166700 chr2B 70.811 370 93 14 2240 2599 801009564 801009200 1.390000e-08 71.3
28 TraesCS1A01G166700 chr7D 91.489 47 4 0 2543 2589 552506640 552506686 6.460000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G166700 chr1A 299539593 299542384 2791 False 2270.000000 4122 100.000000 1 2792 2 chr1A.!!$F2 2791
1 TraesCS1A01G166700 chr1A 97422999 97423955 956 True 507.000000 979 95.677667 1 2792 3 chr1A.!!$R2 2791
2 TraesCS1A01G166700 chr2A 102021538 102024315 2777 True 1428.666667 3810 97.115667 1 2792 3 chr2A.!!$R1 2791
3 TraesCS1A01G166700 chr1D 51000099 51003302 3203 False 1002.333333 1724 95.643333 3 2207 3 chr1D.!!$F2 2204
4 TraesCS1A01G166700 chr1D 50966979 50969443 2464 False 948.875000 2820 96.630000 1 2792 4 chr1D.!!$F1 2791
5 TraesCS1A01G166700 chr3B 448751135 448752606 1471 False 733.233333 1991 93.743000 594 2165 3 chr3B.!!$F1 1571


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
129 130 1.544825 CGAGCACCCCCTTTCTCTCA 61.545 60.0 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1820 3445 2.065899 TGTGCACTTTGCCCTTACTT 57.934 45.0 19.41 0.0 44.23 2.24 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)



Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.