Multiple sequence alignment - TraesCS1A01G157300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G157300 chr1A 100.000 2273 0 0 1 2273 278534572 278532300 0.000000e+00 4198.0
1 TraesCS1A01G157300 chr7A 97.845 2274 46 2 1 2273 563511459 563513730 0.000000e+00 3925.0
2 TraesCS1A01G157300 chr7A 97.459 2283 46 3 1 2273 563578727 563581007 0.000000e+00 3886.0
3 TraesCS1A01G157300 chr7A 97.452 2276 55 2 1 2273 699870225 699867950 0.000000e+00 3879.0
4 TraesCS1A01G157300 chr7A 97.696 1866 40 2 160 2024 563582142 563584005 0.000000e+00 3205.0
5 TraesCS1A01G157300 chr2B 98.121 1543 23 3 733 2273 449209431 449210969 0.000000e+00 2684.0
6 TraesCS1A01G157300 chr2B 98.119 1542 24 2 733 2273 234531263 234532800 0.000000e+00 2682.0
7 TraesCS1A01G157300 chr3A 98.119 1542 24 2 733 2273 495092643 495094180 0.000000e+00 2682.0
8 TraesCS1A01G157300 chr3B 98.056 1543 24 3 733 2273 6000869 6002407 0.000000e+00 2678.0
9 TraesCS1A01G157300 chr4B 98.054 1542 25 2 733 2273 495578350 495579887 0.000000e+00 2676.0
10 TraesCS1A01G157300 chr5A 96.842 95 3 0 324 418 294916429 294916523 2.340000e-35 159.0
11 TraesCS1A01G157300 chr5A 100.000 84 0 0 109 192 206290793 206290876 3.020000e-34 156.0
12 TraesCS1A01G157300 chr5A 98.765 81 1 0 30 110 505903471 505903551 6.540000e-31 145.0
13 TraesCS1A01G157300 chr2A 98.113 53 1 0 320 372 432016158 432016106 2.400000e-15 93.5
14 TraesCS1A01G157300 chrUn 100.000 49 0 0 684 732 36547805 36547853 8.650000e-15 91.6
15 TraesCS1A01G157300 chrUn 100.000 49 0 0 684 732 186205662 186205614 8.650000e-15 91.6
16 TraesCS1A01G157300 chrUn 100.000 49 0 0 684 732 464745639 464745591 8.650000e-15 91.6
17 TraesCS1A01G157300 chr6D 100.000 49 0 0 684 732 124520286 124520334 8.650000e-15 91.6
18 TraesCS1A01G157300 chr6D 100.000 49 0 0 684 732 458900949 458900997 8.650000e-15 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G157300 chr1A 278532300 278534572 2272 True 4198.0 4198 100.0000 1 2273 1 chr1A.!!$R1 2272
1 TraesCS1A01G157300 chr7A 563511459 563513730 2271 False 3925.0 3925 97.8450 1 2273 1 chr7A.!!$F1 2272
2 TraesCS1A01G157300 chr7A 699867950 699870225 2275 True 3879.0 3879 97.4520 1 2273 1 chr7A.!!$R1 2272
3 TraesCS1A01G157300 chr7A 563578727 563584005 5278 False 3545.5 3886 97.5775 1 2273 2 chr7A.!!$F2 2272
4 TraesCS1A01G157300 chr2B 449209431 449210969 1538 False 2684.0 2684 98.1210 733 2273 1 chr2B.!!$F2 1540
5 TraesCS1A01G157300 chr2B 234531263 234532800 1537 False 2682.0 2682 98.1190 733 2273 1 chr2B.!!$F1 1540
6 TraesCS1A01G157300 chr3A 495092643 495094180 1537 False 2682.0 2682 98.1190 733 2273 1 chr3A.!!$F1 1540
7 TraesCS1A01G157300 chr3B 6000869 6002407 1538 False 2678.0 2678 98.0560 733 2273 1 chr3B.!!$F1 1540
8 TraesCS1A01G157300 chr4B 495578350 495579887 1537 False 2676.0 2676 98.0540 733 2273 1 chr4B.!!$F1 1540

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
510 511 1.452145 GCGGGGTTTCAAGCAGAACA 61.452 55.0 0.0 0.0 35.56 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2052 2066 2.034066 CCGGTGTGGATGGCAAGT 59.966 61.111 0.0 0.0 42.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 2.203252 CCTGTATGGGCTGCGCAT 60.203 61.111 30.63 30.63 40.13 4.73
510 511 1.452145 GCGGGGTTTCAAGCAGAACA 61.452 55.000 0.00 0.00 35.56 3.18
878 891 6.960542 TGAGAAGGAAAAGGGTAACTAGAGAT 59.039 38.462 0.00 0.00 0.00 2.75
879 892 7.124448 TGAGAAGGAAAAGGGTAACTAGAGATC 59.876 40.741 0.00 0.00 0.00 2.75
899 913 6.909076 AGATCAAATCAAAATAGGCTCTCCT 58.091 36.000 0.00 0.00 46.57 3.69
973 987 3.142951 ACATTCCATGTTTCCGAAACGA 58.857 40.909 17.16 7.53 44.28 3.85
1357 1371 3.206150 TCTTTTTGCCTGAGTCAGACAC 58.794 45.455 22.09 10.80 32.44 3.67
1460 1474 7.050377 TCCAATTTCTCGATTCAATAGAAGCT 58.950 34.615 0.00 0.00 37.99 3.74
1825 1839 3.118531 AGAGGGTATCCTGAGCAATTGT 58.881 45.455 0.00 0.00 45.05 2.71
2052 2066 9.793259 CTATTGAAACCAAGAAATATAGGCCTA 57.207 33.333 16.60 16.60 0.00 3.93
2068 2082 0.744414 CCTACTTGCCATCCACACCG 60.744 60.000 0.00 0.00 0.00 4.94
2204 2218 7.171508 GCATAATCTCGAATGTTATCAGTTCCA 59.828 37.037 0.00 0.00 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 3.506455 TGAAAGACAAACCCGTGAAAACA 59.494 39.130 0.00 0.0 0.00 2.83
335 336 3.137360 GCATTCCTATCAGGTTCCCTTCT 59.863 47.826 0.00 0.0 36.53 2.85
502 503 5.491982 AGTATTTCCGAAAGATGTTCTGCT 58.508 37.500 0.00 0.0 0.00 4.24
658 659 2.424956 CTGCCATTCCTTCCTAAGTTGC 59.575 50.000 0.00 0.0 0.00 4.17
878 891 5.653769 CCAAGGAGAGCCTATTTTGATTTGA 59.346 40.000 0.00 0.0 46.28 2.69
879 892 5.653769 TCCAAGGAGAGCCTATTTTGATTTG 59.346 40.000 0.00 0.0 46.28 2.32
899 913 1.544691 GAAGTCCTGCGTAGAGTCCAA 59.455 52.381 0.53 0.0 0.00 3.53
1241 1255 9.720667 CTTGAATGCAATTTATAGATTCGACAA 57.279 29.630 0.00 0.0 36.07 3.18
1284 1298 8.211629 ACAGAACTTTGTATTTGGTAACTCTCT 58.788 33.333 0.00 0.0 37.61 3.10
1357 1371 6.583806 GGATAATGCAAATCGAAGCTATTTGG 59.416 38.462 17.86 4.8 42.17 3.28
1460 1474 4.150897 GGTACCATATGCACCTCTTTGA 57.849 45.455 7.15 0.0 0.00 2.69
1825 1839 7.725397 CAGGAATATCAATGAACCCCATTCTTA 59.275 37.037 0.00 0.0 43.27 2.10
2052 2066 2.034066 CCGGTGTGGATGGCAAGT 59.966 61.111 0.00 0.0 42.00 3.16
2068 2082 8.819015 GTTTCTTCGGAAAACTCTATCTATTCC 58.181 37.037 0.00 0.0 44.30 3.01
2204 2218 7.982919 TGCATTGTATTATTTGGTCTACGTACT 59.017 33.333 0.00 0.0 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.