Multiple sequence alignment - TraesCS1A01G157100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G157100 chr1A 100.000 2477 0 0 1 2477 278526011 278528487 0 4575
1 TraesCS1A01G157100 chr2B 98.668 2477 33 0 1 2477 449214515 449212039 0 4392
2 TraesCS1A01G157100 chr6D 98.506 2477 36 1 1 2477 458923543 458921068 0 4368
3 TraesCS1A01G157100 chr1B 98.062 2477 48 0 1 2477 619190513 619188037 0 4309
4 TraesCS1A01G157100 chr7A 98.024 2480 45 2 1 2477 563517279 563514801 0 4305
5 TraesCS1A01G157100 chr3B 97.820 2477 53 1 1 2477 6005948 6003473 0 4274
6 TraesCS1A01G157100 chr6A 98.160 2446 43 1 34 2477 84404696 84402251 0 4266
7 TraesCS1A01G157100 chr6A 97.537 2477 59 2 1 2477 413574189 413571715 0 4235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G157100 chr1A 278526011 278528487 2476 False 4575 4575 100.000 1 2477 1 chr1A.!!$F1 2476
1 TraesCS1A01G157100 chr2B 449212039 449214515 2476 True 4392 4392 98.668 1 2477 1 chr2B.!!$R1 2476
2 TraesCS1A01G157100 chr6D 458921068 458923543 2475 True 4368 4368 98.506 1 2477 1 chr6D.!!$R1 2476
3 TraesCS1A01G157100 chr1B 619188037 619190513 2476 True 4309 4309 98.062 1 2477 1 chr1B.!!$R1 2476
4 TraesCS1A01G157100 chr7A 563514801 563517279 2478 True 4305 4305 98.024 1 2477 1 chr7A.!!$R1 2476
5 TraesCS1A01G157100 chr3B 6003473 6005948 2475 True 4274 4274 97.820 1 2477 1 chr3B.!!$R1 2476
6 TraesCS1A01G157100 chr6A 84402251 84404696 2445 True 4266 4266 98.160 34 2477 1 chr6A.!!$R1 2443
7 TraesCS1A01G157100 chr6A 413571715 413574189 2474 True 4235 4235 97.537 1 2477 1 chr6A.!!$R2 2476

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
523 524 5.645497 GCAGACTACCATGAGACAAAAGATT 59.355 40.0 0.0 0.0 0.0 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1628 1631 4.781934 TCTTATTCTTAAGCAAGCCCTCC 58.218 43.478 0.0 0.0 35.72 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
523 524 5.645497 GCAGACTACCATGAGACAAAAGATT 59.355 40.000 0.00 0.00 0.00 2.40
606 607 7.123383 TCTTTCAGAGGTTTTCCCTTACTTTT 58.877 34.615 0.00 0.00 46.51 2.27
650 651 6.872020 TCGAAATACCTCGACTTTTTCAGAAT 59.128 34.615 0.00 0.00 42.69 2.40
819 820 7.923414 AAGTGAGTAAACAGAATTCCATACC 57.077 36.000 0.65 0.00 0.00 2.73
1001 1004 4.911390 ACGGATTCTTGAACCTCTTTCAT 58.089 39.130 0.00 0.00 43.99 2.57
1107 1110 6.261381 TGGTTAACCATATTATGAAAGACGGC 59.739 38.462 23.69 0.00 42.01 5.68
1144 1147 5.928839 GCTTATCAAATTCTCTATCGAGCCA 59.071 40.000 0.00 0.00 37.19 4.75
1628 1631 4.412796 TCATGATCAACTAAGCCCTCTG 57.587 45.455 0.00 0.00 0.00 3.35
1793 1796 7.229308 ACTAATTCATGATCTGGCATGTACAT 58.771 34.615 1.41 1.41 44.59 2.29
1935 1938 6.491403 TCTGATGATCGATTCAACCTCTGATA 59.509 38.462 0.00 0.00 38.03 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 162 4.514401 GGGTTGATAGTGGAAAAGTCGAT 58.486 43.478 0.00 0.0 0.00 3.59
234 235 7.284034 CCTGGTATAAGCAGTGATTTCAAATCT 59.716 37.037 11.46 0.0 41.84 2.40
523 524 8.033038 TCCGAATCGAATCTCTTTAGAAAGAAA 58.967 33.333 3.36 0.0 43.84 2.52
606 607 3.374367 TCGAATTGTTTGTTGACACGGAA 59.626 39.130 0.00 0.0 0.00 4.30
650 651 4.404394 TCATTGCTATTTGACTCGGACCTA 59.596 41.667 0.00 0.0 0.00 3.08
1001 1004 1.212751 CCTCGACGTGACATGAGCA 59.787 57.895 0.00 0.0 0.00 4.26
1144 1147 9.874205 TTCTGTCTTTTGTTGAATCTTTTTCAT 57.126 25.926 0.00 0.0 0.00 2.57
1628 1631 4.781934 TCTTATTCTTAAGCAAGCCCTCC 58.218 43.478 0.00 0.0 35.72 4.30
2181 2184 7.184022 ACATAAAAACATTCCCCCTAGAGTAGT 59.816 37.037 0.00 0.0 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.