Multiple sequence alignment - TraesCS1A01G157000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G157000 chr1A 100.000 2192 0 0 1 2192 278521195 278523386 0.000000e+00 4048
1 TraesCS1A01G157000 chr3A 98.450 2193 33 1 1 2192 495104759 495102567 0.000000e+00 3860
2 TraesCS1A01G157000 chr3A 92.364 275 20 1 1 274 21285152 21284878 7.340000e-105 390
3 TraesCS1A01G157000 chr2B 98.358 2193 35 1 1 2192 234541159 234538967 0.000000e+00 3849
4 TraesCS1A01G157000 chr2B 97.960 1961 39 1 233 2192 234502228 234500268 0.000000e+00 3398
5 TraesCS1A01G157000 chrUn 98.267 2193 36 2 1 2192 217907669 217909860 0.000000e+00 3838
6 TraesCS1A01G157000 chr3B 98.267 2193 36 2 1 2192 6010765 6008574 0.000000e+00 3838
7 TraesCS1A01G157000 chr3B 98.041 2195 37 4 1 2192 92296731 92294540 0.000000e+00 3810
8 TraesCS1A01G157000 chr1B 97.994 2193 42 2 1 2192 619195330 619193139 0.000000e+00 3805
9 TraesCS1A01G157000 chr4A 97.766 2193 48 1 1 2192 67519499 67521691 0.000000e+00 3777
10 TraesCS1A01G157000 chr7A 97.720 2193 49 1 1 2192 563522097 563519905 0.000000e+00 3771


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G157000 chr1A 278521195 278523386 2191 False 4048 4048 100.000 1 2192 1 chr1A.!!$F1 2191
1 TraesCS1A01G157000 chr3A 495102567 495104759 2192 True 3860 3860 98.450 1 2192 1 chr3A.!!$R2 2191
2 TraesCS1A01G157000 chr2B 234538967 234541159 2192 True 3849 3849 98.358 1 2192 1 chr2B.!!$R2 2191
3 TraesCS1A01G157000 chr2B 234500268 234502228 1960 True 3398 3398 97.960 233 2192 1 chr2B.!!$R1 1959
4 TraesCS1A01G157000 chrUn 217907669 217909860 2191 False 3838 3838 98.267 1 2192 1 chrUn.!!$F1 2191
5 TraesCS1A01G157000 chr3B 6008574 6010765 2191 True 3838 3838 98.267 1 2192 1 chr3B.!!$R1 2191
6 TraesCS1A01G157000 chr3B 92294540 92296731 2191 True 3810 3810 98.041 1 2192 1 chr3B.!!$R2 2191
7 TraesCS1A01G157000 chr1B 619193139 619195330 2191 True 3805 3805 97.994 1 2192 1 chr1B.!!$R1 2191
8 TraesCS1A01G157000 chr4A 67519499 67521691 2192 False 3777 3777 97.766 1 2192 1 chr4A.!!$F1 2191
9 TraesCS1A01G157000 chr7A 563519905 563522097 2192 True 3771 3771 97.720 1 2192 1 chr7A.!!$R1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1206 1207 3.797039 CGTGTGAACCACCAGATCATAT 58.203 45.455 0.0 0.0 41.26 1.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2070 2074 2.18531 GAATGGGACGGCAGTGGTCT 62.185 60.0 0.0 0.0 34.82 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1206 1207 3.797039 CGTGTGAACCACCAGATCATAT 58.203 45.455 0.00 0.00 41.26 1.78
1471 1475 3.505386 ACCAGAGGAGATCGCTATGATT 58.495 45.455 0.00 0.00 37.47 2.57
1490 1494 6.381481 TGATTGTTACTGTATCCGTATCGT 57.619 37.500 0.00 0.00 0.00 3.73
1719 1723 2.552031 GAGTAAAGCATCCCGAGGTTC 58.448 52.381 0.00 0.00 0.00 3.62
1829 1833 1.002900 CGCTTTGCTTTCGGTTCTTCA 60.003 47.619 0.00 0.00 0.00 3.02
1874 1878 2.024414 CTTCATTGATCCGGGGGAAAC 58.976 52.381 0.00 0.00 34.34 2.78
2070 2074 4.314440 AGAACGAGCTTGCCGGCA 62.314 61.111 29.03 29.03 34.17 5.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1471 1475 6.515832 TCTCTACGATACGGATACAGTAACA 58.484 40.000 0.00 0.00 0.00 2.41
1490 1494 3.242518 CGAACACTTTGTCGCATCTCTA 58.757 45.455 0.00 0.00 0.00 2.43
1636 1640 1.931172 CGGTTAAGAACGGCGATGATT 59.069 47.619 16.62 5.24 0.00 2.57
1829 1833 3.517500 GGGAGAAGTCAGTTGATTCCTCT 59.482 47.826 0.00 0.00 0.00 3.69
1888 1892 3.274288 CTTGATGTCTAGCTTCCCAACC 58.726 50.000 0.00 0.00 0.00 3.77
2070 2074 2.185310 GAATGGGACGGCAGTGGTCT 62.185 60.000 0.00 0.00 34.82 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.