Multiple sequence alignment - TraesCS1A01G147900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G147900 chr1A 100.000 2663 0 0 1 2663 255473995 255471333 0 4918
1 TraesCS1A01G147900 chr2A 98.948 2662 26 2 3 2663 389206957 389209617 0 4759
2 TraesCS1A01G147900 chr2B 98.836 2663 28 3 1 2663 608457625 608460284 0 4743
3 TraesCS1A01G147900 chr2B 98.573 2663 36 2 1 2663 741912319 741909659 0 4706
4 TraesCS1A01G147900 chr6A 98.535 2663 35 4 1 2663 87943544 87940886 0 4698
5 TraesCS1A01G147900 chr7B 98.498 2663 38 2 1 2663 194130140 194127480 0 4695
6 TraesCS1A01G147900 chr7B 98.348 2663 42 2 1 2663 666524119 666526779 0 4673


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G147900 chr1A 255471333 255473995 2662 True 4918 4918 100.000 1 2663 1 chr1A.!!$R1 2662
1 TraesCS1A01G147900 chr2A 389206957 389209617 2660 False 4759 4759 98.948 3 2663 1 chr2A.!!$F1 2660
2 TraesCS1A01G147900 chr2B 608457625 608460284 2659 False 4743 4743 98.836 1 2663 1 chr2B.!!$F1 2662
3 TraesCS1A01G147900 chr2B 741909659 741912319 2660 True 4706 4706 98.573 1 2663 1 chr2B.!!$R1 2662
4 TraesCS1A01G147900 chr6A 87940886 87943544 2658 True 4698 4698 98.535 1 2663 1 chr6A.!!$R1 2662
5 TraesCS1A01G147900 chr7B 194127480 194130140 2660 True 4695 4695 98.498 1 2663 1 chr7B.!!$R1 2662
6 TraesCS1A01G147900 chr7B 666524119 666526779 2660 False 4673 4673 98.348 1 2663 1 chr7B.!!$F1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
932 934 0.462047 GGCTACCTAGTTGCGCATGT 60.462 55.0 12.75 3.63 35.33 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2595 2601 1.349542 TACCATTGCGGGGGCAGTAT 61.35 55.0 0.0 0.0 40.22 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 2.621526 GACCGAACCAGGAATTTGTTGT 59.378 45.455 0.00 0.00 34.73 3.32
187 188 1.157870 GGCGTTGATGTCATACCGGG 61.158 60.000 6.32 0.00 0.00 5.73
567 569 7.453752 TCCTGATCTAACTAGGTGTGTAACTTT 59.546 37.037 0.00 0.00 38.04 2.66
682 684 5.586243 ACGCATCAAAGATAACACAGCTAAT 59.414 36.000 0.00 0.00 0.00 1.73
745 747 3.700350 CCTCCTCCCCCTCCTGGT 61.700 72.222 0.00 0.00 0.00 4.00
932 934 0.462047 GGCTACCTAGTTGCGCATGT 60.462 55.000 12.75 3.63 35.33 3.21
1378 1381 4.935352 AAAATGTACTGTGTGGTTGCAT 57.065 36.364 0.00 0.00 0.00 3.96
1584 1587 2.032860 AATCGGCGCTGGAGCTACAT 62.033 55.000 17.88 0.00 39.32 2.29
1665 1668 3.135530 GTCCACAGAGGCTCCTATGATTT 59.864 47.826 16.59 0.00 37.45 2.17
2350 2356 2.027073 CTTACGCGCCACTCTGCAA 61.027 57.895 5.73 0.00 0.00 4.08
2595 2601 1.273986 TGCTTCCTCCATAGCTGGCA 61.274 55.000 0.00 0.00 42.80 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 7.333423 CCAAGTAGTTTCGAGAACCATATTTCA 59.667 37.037 6.79 0.00 0.00 2.69
187 188 1.823610 ACCGTCTTAGCAGGTACCTTC 59.176 52.381 13.15 7.78 36.34 3.46
217 218 1.079405 GGCGCACTAGGTACAGCAA 60.079 57.895 10.83 0.00 0.00 3.91
533 535 3.207044 AGTTAGATCAGGAGTTGGGGT 57.793 47.619 0.00 0.00 0.00 4.95
745 747 1.216977 CGGAGGATGCCGTGTACAA 59.783 57.895 0.00 0.00 46.07 2.41
1261 1264 2.673258 TGGATTGTAGTCGCCTATGGA 58.327 47.619 0.00 0.00 0.00 3.41
1378 1381 2.426522 GCAACCAGCACTGATGTTCTA 58.573 47.619 0.00 0.00 44.79 2.10
1584 1587 5.294060 GCTGCATTTGTTTTTCTTCTTTGGA 59.706 36.000 0.00 0.00 0.00 3.53
1665 1668 7.411486 TCCAAAGTTACAAATGAGGAAACAA 57.589 32.000 0.00 0.00 0.00 2.83
2595 2601 1.349542 TACCATTGCGGGGGCAGTAT 61.350 55.000 0.00 0.00 40.22 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.