Multiple sequence alignment - TraesCS1A01G140500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G140500 chr1A 100.000 2357 0 0 1 2357 238155129 238152773 0 4353
1 TraesCS1A01G140500 chr1A 99.406 2357 14 0 1 2357 238109744 238107388 0 4276
2 TraesCS1A01G140500 chr5A 99.321 2357 16 0 1 2357 16577919 16575563 0 4265
3 TraesCS1A01G140500 chr7A 99.151 2357 20 0 1 2357 60329009 60326653 0 4242
4 TraesCS1A01G140500 chr7D 98.982 2357 21 1 1 2357 579015579 579017932 0 4217
5 TraesCS1A01G140500 chr6B 98.897 2357 22 2 1 2357 596657305 596654953 0 4205
6 TraesCS1A01G140500 chr3B 98.515 2357 33 2 1 2357 483372317 483374671 0 4157


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G140500 chr1A 238152773 238155129 2356 True 4353 4353 100.000 1 2357 1 chr1A.!!$R2 2356
1 TraesCS1A01G140500 chr1A 238107388 238109744 2356 True 4276 4276 99.406 1 2357 1 chr1A.!!$R1 2356
2 TraesCS1A01G140500 chr5A 16575563 16577919 2356 True 4265 4265 99.321 1 2357 1 chr5A.!!$R1 2356
3 TraesCS1A01G140500 chr7A 60326653 60329009 2356 True 4242 4242 99.151 1 2357 1 chr7A.!!$R1 2356
4 TraesCS1A01G140500 chr7D 579015579 579017932 2353 False 4217 4217 98.982 1 2357 1 chr7D.!!$F1 2356
5 TraesCS1A01G140500 chr6B 596654953 596657305 2352 True 4205 4205 98.897 1 2357 1 chr6B.!!$R1 2356
6 TraesCS1A01G140500 chr3B 483372317 483374671 2354 False 4157 4157 98.515 1 2357 1 chr3B.!!$F1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
177 178 1.619332 GTCTTCTCTCTTGGTCGGGTT 59.381 52.381 0.0 0.0 0.0 4.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1606 1608 2.167693 TCCTGCGAATTATGACCTTCGT 59.832 45.455 6.56 0.0 44.54 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 1.619332 GTCTTCTCTCTTGGTCGGGTT 59.381 52.381 0.00 0.0 0.00 4.11
278 279 2.048127 GGTCTCGCTTGGACGCTT 60.048 61.111 0.00 0.0 34.82 4.68
332 333 3.750130 TCGCTCAGTAAAGAAGAGTACGT 59.250 43.478 0.00 0.0 0.00 3.57
1307 1309 9.116067 CATGATGGCCTTTTTATTGATTTTGAT 57.884 29.630 3.32 0.0 0.00 2.57
1606 1608 7.940688 ACATGATATATTTGCTCACATTCCAGA 59.059 33.333 0.00 0.0 0.00 3.86
1794 1796 5.059161 CGAAATGAATGGAAGATGCCTCTA 58.941 41.667 0.00 0.0 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 4.287067 ACTGAATGAGAAACTTAGCCTCCA 59.713 41.667 0.00 0.0 0.00 3.86
1052 1053 3.081804 GGAACACCGAGTGGAATCAAAT 58.918 45.455 8.57 0.0 37.94 2.32
1307 1309 7.622502 TTCCATTCATAGAGAGATCCAATCA 57.377 36.000 0.00 0.0 0.00 2.57
1606 1608 2.167693 TCCTGCGAATTATGACCTTCGT 59.832 45.455 6.56 0.0 44.54 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.