Multiple sequence alignment - TraesCS1A01G140100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G140100 chr1A 100.000 2471 0 0 1 2471 238107639 238105169 0.000000e+00 4564
1 TraesCS1A01G140100 chr1A 99.596 2475 6 2 1 2471 238153024 238150550 0.000000e+00 4512
2 TraesCS1A01G140100 chr5A 99.152 2476 15 3 1 2471 16575814 16573340 0.000000e+00 4451
3 TraesCS1A01G140100 chr6B 99.071 2476 16 4 1 2470 596655204 596652730 0.000000e+00 4438
4 TraesCS1A01G140100 chr3A 98.990 2476 19 4 1 2471 247672883 247675357 0.000000e+00 4429
5 TraesCS1A01G140100 chr4B 97.902 2479 32 5 1 2471 209048961 209051427 0.000000e+00 4272
6 TraesCS1A01G140100 chr2B 98.422 2345 30 4 132 2471 500759802 500757460 0.000000e+00 4119
7 TraesCS1A01G140100 chr2B 97.491 2192 36 7 294 2471 357280906 357278720 0.000000e+00 3725
8 TraesCS1A01G140100 chr2B 98.150 811 12 3 1663 2471 385133107 385132298 0.000000e+00 1411
9 TraesCS1A01G140100 chr2B 95.513 156 7 0 1984 2139 668825621 668825466 1.470000e-62 250
10 TraesCS1A01G140100 chr2B 94.444 108 6 0 1807 1914 799773854 799773961 1.520000e-37 167
11 TraesCS1A01G140100 chr2B 86.047 129 14 4 1749 1874 489504688 489504561 4.290000e-28 135
12 TraesCS1A01G140100 chr7A 99.155 2131 12 4 1 2127 60326904 60324776 0.000000e+00 3831
13 TraesCS1A01G140100 chrUn 97.463 1695 35 4 1 1689 371043358 371041666 0.000000e+00 2885
14 TraesCS1A01G140100 chrUn 97.407 1697 36 4 1 1691 237255730 237254036 0.000000e+00 2883


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G140100 chr1A 238105169 238107639 2470 True 4564 4564 100.000 1 2471 1 chr1A.!!$R1 2470
1 TraesCS1A01G140100 chr1A 238150550 238153024 2474 True 4512 4512 99.596 1 2471 1 chr1A.!!$R2 2470
2 TraesCS1A01G140100 chr5A 16573340 16575814 2474 True 4451 4451 99.152 1 2471 1 chr5A.!!$R1 2470
3 TraesCS1A01G140100 chr6B 596652730 596655204 2474 True 4438 4438 99.071 1 2470 1 chr6B.!!$R1 2469
4 TraesCS1A01G140100 chr3A 247672883 247675357 2474 False 4429 4429 98.990 1 2471 1 chr3A.!!$F1 2470
5 TraesCS1A01G140100 chr4B 209048961 209051427 2466 False 4272 4272 97.902 1 2471 1 chr4B.!!$F1 2470
6 TraesCS1A01G140100 chr2B 500757460 500759802 2342 True 4119 4119 98.422 132 2471 1 chr2B.!!$R4 2339
7 TraesCS1A01G140100 chr2B 357278720 357280906 2186 True 3725 3725 97.491 294 2471 1 chr2B.!!$R1 2177
8 TraesCS1A01G140100 chr2B 385132298 385133107 809 True 1411 1411 98.150 1663 2471 1 chr2B.!!$R2 808
9 TraesCS1A01G140100 chr7A 60324776 60326904 2128 True 3831 3831 99.155 1 2127 1 chr7A.!!$R1 2126
10 TraesCS1A01G140100 chrUn 371041666 371043358 1692 True 2885 2885 97.463 1 1689 1 chrUn.!!$R2 1688
11 TraesCS1A01G140100 chrUn 237254036 237255730 1694 True 2883 2883 97.407 1 1691 1 chrUn.!!$R1 1690

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
61 62 2.613691 GTATCACGGATGTTGGTTCGT 58.386 47.619 0.0 0.0 36.19 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2072 2104 3.706594 AGCAAGCTAGCTATAGGTGTTCA 59.293 43.478 19.7 0.0 44.5 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 2.613691 GTATCACGGATGTTGGTTCGT 58.386 47.619 0.0 0.0 36.19 3.85
2072 2104 6.875972 AACCCTCTATCAACACAACTATCT 57.124 37.500 0.0 0.0 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2072 2104 3.706594 AGCAAGCTAGCTATAGGTGTTCA 59.293 43.478 19.7 0.0 44.5 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.