Multiple sequence alignment - TraesCS1A01G132700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G132700 chr1A 100.000 2398 0 0 1 2398 181970719 181968322 0.000000e+00 4429
1 TraesCS1A01G132700 chr1A 97.542 2400 55 3 1 2398 359190690 359193087 0.000000e+00 4102
2 TraesCS1A01G132700 chr1A 96.750 2400 58 7 1 2398 579041649 579039268 0.000000e+00 3982
3 TraesCS1A01G132700 chr1A 96.878 2338 56 5 62 2398 67962183 67959862 0.000000e+00 3897
4 TraesCS1A01G132700 chr3A 97.874 2399 48 2 1 2398 171150131 171152527 0.000000e+00 4145
5 TraesCS1A01G132700 chr3A 97.124 2399 66 3 1 2398 545676421 545674025 0.000000e+00 4045
6 TraesCS1A01G132700 chr3A 97.081 2398 53 6 1 2398 58078400 58076020 0.000000e+00 4024
7 TraesCS1A01G132700 chr3A 97.341 1805 45 1 594 2398 122115255 122117056 0.000000e+00 3064
8 TraesCS1A01G132700 chr3A 96.956 1807 53 2 594 2398 48905594 48907400 0.000000e+00 3031
9 TraesCS1A01G132700 chr7A 96.678 1806 56 3 594 2398 723589399 723591201 0.000000e+00 3000
10 TraesCS1A01G132700 chr7A 96.262 535 20 0 62 596 662680420 662680954 0.000000e+00 878
11 TraesCS1A01G132700 chr7A 100.000 64 0 0 1 64 662679753 662679816 4.190000e-23 119
12 TraesCS1A01G132700 chr4D 95.382 498 19 2 62 559 446550868 446550375 0.000000e+00 789
13 TraesCS1A01G132700 chr4D 100.000 64 0 0 1 64 99934204 99934267 4.190000e-23 119
14 TraesCS1A01G132700 chr1D 95.382 498 20 2 62 559 308936650 308937144 0.000000e+00 789
15 TraesCS1A01G132700 chr1D 98.438 64 1 0 1 64 308935983 308936046 1.950000e-21 113
16 TraesCS1A01G132700 chr7B 100.000 64 0 0 1 64 574900460 574900397 4.190000e-23 119


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G132700 chr1A 181968322 181970719 2397 True 4429.0 4429 100.000 1 2398 1 chr1A.!!$R2 2397
1 TraesCS1A01G132700 chr1A 359190690 359193087 2397 False 4102.0 4102 97.542 1 2398 1 chr1A.!!$F1 2397
2 TraesCS1A01G132700 chr1A 579039268 579041649 2381 True 3982.0 3982 96.750 1 2398 1 chr1A.!!$R3 2397
3 TraesCS1A01G132700 chr1A 67959862 67962183 2321 True 3897.0 3897 96.878 62 2398 1 chr1A.!!$R1 2336
4 TraesCS1A01G132700 chr3A 171150131 171152527 2396 False 4145.0 4145 97.874 1 2398 1 chr3A.!!$F3 2397
5 TraesCS1A01G132700 chr3A 545674025 545676421 2396 True 4045.0 4045 97.124 1 2398 1 chr3A.!!$R2 2397
6 TraesCS1A01G132700 chr3A 58076020 58078400 2380 True 4024.0 4024 97.081 1 2398 1 chr3A.!!$R1 2397
7 TraesCS1A01G132700 chr3A 122115255 122117056 1801 False 3064.0 3064 97.341 594 2398 1 chr3A.!!$F2 1804
8 TraesCS1A01G132700 chr3A 48905594 48907400 1806 False 3031.0 3031 96.956 594 2398 1 chr3A.!!$F1 1804
9 TraesCS1A01G132700 chr7A 723589399 723591201 1802 False 3000.0 3000 96.678 594 2398 1 chr7A.!!$F1 1804
10 TraesCS1A01G132700 chr7A 662679753 662680954 1201 False 498.5 878 98.131 1 596 2 chr7A.!!$F2 595
11 TraesCS1A01G132700 chr1D 308935983 308937144 1161 False 451.0 789 96.910 1 559 2 chr1D.!!$F1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
980 1587 1.29286 CCATGTTTGCCCGCATTGT 59.707 52.632 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2033 2643 4.073549 AGATAAGCCTACTACTGCCTACG 58.926 47.826 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 767 7.185565 TCTCCTAGAGATATAATTCTGGGTGG 58.814 42.308 14.75 10.89 41.39 4.61
237 844 9.397280 GTGTTCCTTTCTTCCTTATAAAGCTAT 57.603 33.333 0.00 0.00 0.00 2.97
402 1009 4.079253 ACTGATGTTTACATGTTGGGTCC 58.921 43.478 2.30 0.00 36.57 4.46
543 1150 1.637553 AGGAGCAACATTCCTGATGGT 59.362 47.619 0.00 0.00 43.38 3.55
552 1159 1.874129 TTCCTGATGGTGACGGGTAT 58.126 50.000 0.00 0.00 35.49 2.73
774 1381 5.483937 TCCTCTGACTGCTATTTTTCACCTA 59.516 40.000 0.00 0.00 0.00 3.08
823 1430 4.081087 TGTTAATTGGACCTCCTGTCTAGC 60.081 45.833 0.00 0.00 43.89 3.42
980 1587 1.292860 CCATGTTTGCCCGCATTGT 59.707 52.632 0.00 0.00 0.00 2.71
1126 1733 0.032952 TACAGCTGGTTCGTGTGGTC 59.967 55.000 19.93 0.00 0.00 4.02
1323 1930 7.667575 ATTATTCACTTTCTCTCTCCTGCTA 57.332 36.000 0.00 0.00 0.00 3.49
1535 2144 5.888724 TGTTGGTTGTTACTTCCAATTGAGA 59.111 36.000 7.12 0.00 42.10 3.27
1635 2244 6.206634 GGTTTCAGAATGTCTGTTTCATGGTA 59.793 38.462 5.23 0.00 44.58 3.25
1739 2348 5.065218 CACTTATTTTTGATCGGAGGGAGTG 59.935 44.000 0.00 0.00 0.00 3.51
1922 2531 5.804639 TGGCTACTGTTTGATGTTCTGTAT 58.195 37.500 0.00 0.00 0.00 2.29
1991 2601 3.188460 GTGCAAATCCAAGTTCGAAGCTA 59.812 43.478 0.00 0.00 0.00 3.32
2069 2679 5.594777 AGGCTTATCTGGGCTGTAGTATAT 58.405 41.667 0.00 0.00 38.18 0.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 767 6.985188 TGCACTAAAACTATGATGAACCTC 57.015 37.500 0.00 0.00 0.00 3.85
237 844 8.362464 AGTGTGTCAAGTTCAATATAGTAGGA 57.638 34.615 0.00 0.00 0.00 2.94
252 859 2.811855 TGCATGCAAAAGTGTGTCAAG 58.188 42.857 20.30 0.00 0.00 3.02
354 961 4.838152 GCGGCATCAGCTTCGGGA 62.838 66.667 0.00 0.00 41.70 5.14
402 1009 5.177142 TGCAACAACAAATGATTTTCATCGG 59.823 36.000 0.00 0.00 35.76 4.18
507 1114 2.430465 CTCCTACAGCAGCAACAACAT 58.570 47.619 0.00 0.00 0.00 2.71
543 1150 3.259625 TGAACTTCATCACATACCCGTCA 59.740 43.478 0.00 0.00 0.00 4.35
552 1159 8.716646 ATCATACGTTTATGAACTTCATCACA 57.283 30.769 7.57 0.00 45.83 3.58
709 1316 2.686835 AGAGAGGGACCTGCTGCC 60.687 66.667 0.00 0.00 0.00 4.85
823 1430 4.511527 AGCATTCACTGACTTGTCCTATG 58.488 43.478 0.00 0.00 0.00 2.23
980 1587 1.093972 CAACACCTGCACAGAACACA 58.906 50.000 0.00 0.00 0.00 3.72
1126 1733 3.968265 ACCCATCAAATCTACAACCCAG 58.032 45.455 0.00 0.00 0.00 4.45
1182 1789 1.071605 GACACTTCATCGACACTGCC 58.928 55.000 0.00 0.00 0.00 4.85
1272 1879 0.250234 TGGAGATGTTCCTCTTGCCG 59.750 55.000 0.00 0.00 46.92 5.69
1323 1930 2.283298 CAGCAGACATAATGCCGAACT 58.717 47.619 0.00 0.00 44.97 3.01
1535 2144 5.461032 TTTCTCAACACCAACAAACAGTT 57.539 34.783 0.00 0.00 42.42 3.16
1739 2348 4.096984 AGTTCAAGGCTATTACAAGCATGC 59.903 41.667 10.51 10.51 44.64 4.06
1991 2601 6.825213 TGCTAGTCTTTGTTGATATGCTTCAT 59.175 34.615 0.00 0.00 0.00 2.57
2033 2643 4.073549 AGATAAGCCTACTACTGCCTACG 58.926 47.826 0.00 0.00 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.